BIOO LIFE SCIENCE PRODUCTS

Transcription

1 BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit and protocol, so it is important to always use the protocol included with the kit. NEXTflex TM DNA Sequencing Kit (SOLiD 4 Compatible) Catalog #: (12 reactions) BIOO Scientific Corp V12.08

2 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Overview... 1 Contents, Storage and Shelf Life... 1 Required Materials not Provided... 2 Warnings and Precautions... 3 NEXTflex DNA SAMPLE PREPARATION PROTOCOL... 4 NEXTflex DNA Sample Preparation Flow Chart... 4 Reagent Preparation... 5 STEP A: End Repair... 5 STEP B: Bead Size Selection... 6 STEP C: Adapter Ligation... 7 STEP D: Clean-Up... 8 STEP E: PCR Amplification... 9 LIBRARY VALIDATION APPENDIX A Oligonucleotide Sequences RELATED PRODUCTS DNA Fragmentation DNA Next Generation Sequencing Kits for Ion Torrent DNA Next Generation Sequencing Kits for 5500 SOLiD DNA Next Generation Sequencing Kits for Illumina RNA Next Generation Sequencing Kits for Illumina The NEXTflex DNA Sequencing Kit is intended for research use only. Corporation. NEXTflex is a trademark of Bioo Scientific

3 GENERAL INFORMATION Product Overview NEXTflex DNA Sequencing Kit Manual for SOLiD GENERAL INFORMATION The NEXTflex DNA Sequencing Kit is designed to prepare single and multiplexed DNA libraries for sequencing using the SOLiD 4 platform. The DNA libraries can be sequenced with a forward only run or with a paired end run. The NEXTflex DNA Sequencing Kit simplifies workflow by using master mixed reagents and magnetic bead based cleanup, reducing pipetting and eliminating time consuming steps in library preparation. A bead-based, gel-free size selection protocol eliminates the need for agarose gel size selection. There are five main steps involved in preparing genomic DNA for sequencing: DNA extraction, DNA fragmentation, DNA end repair, adapter ligation and PCR amplification. The NEXTflex Sequencing Kit contains the necessary material to prepare the user s purified and fragmented genomic DNA for emulsion PCR and sequencing. Contents, Storage and Shelf Life The NEXTflex DNA Sequencing Kit contains enough material to prepare 12 genomic DNA samples for SOLiD 4 compatible sequencing. The shelf life of all reagents is 12 months when stored properly. All the components can be safely stored at -20 C. Kit Contents Amount CLEAR CAP NEXTflex End Repair Buffer Mix 84 µl NEXTflex End Repair Enzyme Mix 36 µl RED CAP NEXTflex Adenylation Mix 42 µl PURPLE CAP NEXTflex Ligation Mix 378 µl NEXTflex DNA P1 Adapter (12.5 µm) 30 µl NEXTflex DNA P2 Adapter (12.5 µm) 30 µl NEXTflex Adapter Dilution Buffer 90 µl GREEN CAP NEXTflex Primer Mix (12.5 µm) 24 µl NEXTflex PCR Master Mix 120 µl WHITE CAP Nuclease-free Water Resuspension Buffer 1.0 ml (2) 1 ml BIOO LIFE SCIENCE PRODUCTS 1

4 Required Materials not Provided 10 ng -1 µg of fragmented genomic DNA in up to 40 µl nuclease-free water. NEXTflex DNA Barcodes for SOLiD / / / / / 81-96/1-96 (Cat # , , , , , , ) Ethanol 80% (room temperature) AIR DNA Fragmentation Kit (Bioo Scientific, Cat # ) / or / Covaris System (S2, E210) 96 well PCR Plate Non-skirted (Phenix Research, Cat # MPS-499) / or / similar 96 well Library Storage and Pooling Plate (Fisher Scientific, Cat # AB-0765) / or / similar Adhesive PCR Plate Seal (BioRad, Cat # MSB1001) Agencourt AMPure XP 5 ml (Beckman Coulter Genomics, Cat # A63880) Magnetic Stand -96 (Ambion, Cat # AM10027) / or / similar Heat block Thermocycler 2, 10, 20, 200 and 1000 µl pipettes / multichannel pipettes Nuclease-free barrier pipette tips Microcentrifuge 1.5 ml nuclease-free microcentrifuge tubes Agilent 2100 Bioanalyzer BIOO LIFE SCIENCE PRODUCTS 2

5 Warnings and Precautions NEXTflex DNA Sequencing Kit Manual for SOLiD Bioo Scientific strongly recommends that you read the following warnings and precautions. Periodically, optimizations and revisions are made to the components and manual. Therefore, it is important to follow the protocol included with the kit. If you need further assistance, you may contact your local distributor or Bioo Scientific at Do not use the kit past the expiration date. DTT in buffers may precipitate after freezing. If precipitate is seen, vortex buffer for 1-2 minutes or until the precipitate is in solution. The performance of the buffer is not affected once precipitate is in solution. Ensure pipettes are properly calibrated as library preparations are highly sensitive to pipetting error. Do not heat the DNA Adapters above room temperature. Try to maintain a laboratory temperature of 20º 25ºC (68º 77ºF). DNA sample quality may vary between preparations. It is the user s responsibility to utilize high quality DNA. DNA that is heavily nicked or damaged may cause library preparation failure. Absorbance measurements at 260 nm are commonly used to quantify DNA and 260 nm / 280 nm ratios of usually indicate relatively pure DNA. Other quantification methods using fluorescent dyes may also be used. The user should be aware that contaminating RNA, nucleotides and single-stranded DNA may affect the amount of usable DNA in a sample preparation. DNA fragmentation methods that physically break up DNA into pieces of less than 300 bp are compatible with this kit. These methods include the AIR DNA Fragmentation Kit ( ), based on the nebulization of DNA or acoustic technologies that fragment DNA in a controlled and accurate manner. We do not recommend any enzymatic methods of fragmentation as this may introduce sequence bias into the preparation. Bioo Scientific makes no warranty of any kind, either expressed or implied, except that the materials from which its products are made are of standard quality. There is no warranty of merchantability of this product, or of the fitness of the product for any purpose. Bioo Scientific shall not be liable for any damages, including special or consequential damage, or expense arising directly or indirectly from the use of this product. BIOO LIFE SCIENCE PRODUCTS 3

6 NEXTflex DNA SAMPLE PREPARATION PROTOCOL NEXTflex DNA SAMPLE PREPARATION PROTOCOL NEXTflex DNA Sample Preparation Flow Chart Figure 1: Sample flow chart with approximate times necessary for each step. BIOO LIFE SCIENCE PRODUCTS 4

7 Starting Material The NEXTflex DNA Sequencing Kit has been optimized and validated using genomic DNA. Starting with 10ng - 1 µg of high quality fragmented genomic DNA will allow you to perform at least 12 reactions per adapter set (see page 3, Warnings and Precautions). Reagent Preparation 1. Briefly spin down each component to ensure material has not lodged in the cap or side of tube. Keep on ice and vortex each NEXTflex Mix just prior to use. 2. DTT in buffers may precipitate after freezing. If precipitate is seen in any mix, vortex for 1 minute or until the precipitate is in solution. The performance of the mix is not affected once precipitate is in solution. 3. Allow Agencourt AMPure XP Beads to come to room temperature and vortex the beads until liquid appear homogenous before every use. STEP A: End Repair Materials Bioo Scientific Supplied CLEAR CAP NEXTflex End Repair Buffer Mix NEXTflex End Repair Enzyme Mix WHITE CAP Nuclease-free H 2O User Supplied Fragmented DNA in 40 µl (or less) nuclease-free water 96 well PCR Plate Adhesive PCR Plate Seal Agencourt AMPure XP Magnetic Beads Microcentrifuge Ice 1. For each sample, combine the following reagents on ice in a nuclease-free 96 well PCR Plate: _ µl Nuclease-free H 2O _ µl Fragmented DNA (10 ng - 1 µg) 7 µl NEXTflex End Repair Buffer Mix 3 µl NEXTflex End Repair Enzyme Mix 50 µl TOTAL 2. Set pipette to 50 µl, gently pipette the entire volume up and down 10 times. 3. Apply adhesive PCR plate seal and incubate on a thermocycler for 30 minutes at 22 C. BIOO LIFE SCIENCE PRODUCTS 5

8 STEP B: Bead Size Selection NEXTflex DNA Sequencing Kit Manual for SOLiD Size selection using Agencourt AMPure XP Magnetic Beads in this protocol will result in a DNA insert size between bp with a total length of bp post adapter ligation. Materials Bioo Scientific Supplied WHITE CAP Resuspension Buffer User Supplied Agencourt AMPure XP Magnetic Beads (room temperature) 80% Ethanol, freshly prepared (room temperature) Magnetic Stand 1. Add 53 µl of AMPure XP Beads to each sample and gently pipette the entire volume up and down 10 times. 2. Incubate sample at room temperature for 5 minutes. 3. Place the 96 well PCR Plate on the magnetic stand at room temperature until the sample appears clear. 4. Gently transfer 101 µl of clear sample to a new well. Make sure beads are not transferred along with the sample. Some liquid may remain in wells. This selectively removes DNA above 250 bp. 5. Add 100 µl of AMPure XP Beads to each sample and gently pipette the entire volume up and down 10 times. 6. Incubate sample at room temperature for 5 minutes. 7. Place the 96 well PCR Plate on the magnetic stand at room temperature until the sample appears clear. 8. Once solution clears, gently remove and discard clear sample taking care not to disturb beads. Some liquid may remain in wells. 9. With plate on stand, gently add 200 µl of freshly prepared 80% ethanol to each magnetic bead pellet and incubate plate at room temperature for 30 seconds. Carefully, remove ethanol by pipette. 10. Repeat step 9, for a total of 2 ethanol washes. Ensure all ethanol has been removed. 11. Remove the plate from the magnetic stand and let dry at room temperature for 3 minutes. 12. Resuspend dried beads with 19 µl Resuspension Buffer. Gently, pipette entire volume up and down 10 times mixing thoroughly. Ensure beads are no longer attached to the side of the well. 13. Incubate resuspended beads at room temperature for 2 minutes. 14. Place plate on magnetic stand for 5 minutes until the sample appears clear. 15. Gently transfer 17 µl of clear sample to a new well. BIOO LIFE SCIENCE PRODUCTS 6

9 16. Proceed to Step C. 17. If you wish to pause your experiment, the procedure may be safely stopped at this step and samples stored at -20 C. To restart, thaw frozen samples on ice before proceeding. STEP C: Adapter Ligation Materials Bioo Scientific Supplied PURPLE CAP NEXTflex Ligation Mix (remove right before use and store immediately at -20 C after use) NEXTflex DNA P1 and P2 Adapter User Supplied 17 µl Size Selected DNA (from STEP B) IMPORTANT! For multiplexed sequencing, use at least one of the following full sets of four barcodes for each sequencing run: Barcodes 1 4, 5 8, 9 12, 13 16, 17 20, 21 24, 25 28, 29 32, 33 36, 37 40, 41 44, 45 48, 49 52, 53 56, 57 60, 61 64, 65 68, 69 72, 73 76, 77 80, 81 84, 85 88, 89 92, or Use only one of the barcoded adaptors for each ligation reaction, unless < 4 libraries are being barcoded. For <4 libraries, use multiple barcodes per library in equal ratios. For example, for 2 libraries, use 2 barcodes for each library. For 3 libraries, use 4 barcode adaptors for each library for a total of 12 barcodes. For 4 libraries, split into sets of 4 to use full sets of barcodes, then use one set of barcodes for the remaining libraries (1, 2, or 3 libraries). There is no need to use multiple barcodes per library in equal ratios. The following adapter titrations for the given DNA starting input amounts are recommended: For DNA input amounts between 10 ng ng the supplied adapter (12.5µM) should be diluted to 5.0 µm using the Adapter dilution buffer. DNA input amount Adapter amount Adapter concentration 1000 ng 2.5 µl 12.5 µm 500 ng 2.5 µl 12.5 µm 100 ng 2.5 µl 5.0 µm 50 ng 2.5 µl 5.0 µm 10 ng 2.5 µl 5.0 µm 1. For each sample, combine the following reagents (in this order) in the PCR plate: 17.0 µl Size Selected DNA (from step B) 31.5 µl NEXTflex Ligation Mix 2.5 µl NEXTflex DNA P1 Adapter 2.5 µl NEXTflex DNA P2 Adapter / Barcoded Adapter 53.5 µl TOTAL 2. Set pipette to 53 µl, gently pipette the entire volume up and down 10 times. 3. Apply adhesive PCR plate seal and incubate on a thermocycler for 30 minutes at 20 C. BIOO LIFE SCIENCE PRODUCTS 7

10 STEP D: Clean-Up Materials Bioo Scientific Supplied WHITE CAP Resuspension Buffer NEXTflex DNA Sequencing Kit Manual for SOLiD User Supplied Agencourt AMPure XP Magnetic Beads (room temperature) 80% Ethanol, freshly prepared (room temperature) Magnetic Stand 1. Add 53 µl of AMPure XP Beads to each sample and gently pipette the entire volume up and down 10 times. 2. Incubate at room temperature for 5 minutes. 3. Place the 96 well PCR Plate on the magnetic stand at room temperature until the sample appears clear. 4. Gently remove and discard clear sample taking care not to disturb beads. Some liquid may remain in wells. 5. With plate on stand, gently add 200 µl of freshly prepared 80% ethanol to each magnetic bead pellet and incubate plate at room temperature for 30 seconds. Carefully, remove ethanol by pipette. 6. Repeat step 5, for a total of 2 ethanol washes and ensure all ethanol has been removed. 7. Remove the plate from the magnetic stand and let dry at room temperature for 3 minutes. 8. Resuspend dried beads with 30 µl Resuspension Buffer. Gently, pipette entire volume up and down 10 times mixing thoroughly and ensuring beads are no longer attached to the side of the well. 9. Incubate resuspended beads at room temperature for 2 minutes. 10. Place plate on magnetic stand for 5 minutes until the sample appears clear. 11. Gently transfer 28 µl of clear sample to new well. 12. Add 28 µl of AMPure XP Beads to each sample and gently pipette the entire volume up and down 10 times. 13. Repeat steps Resuspend dried beads with 22.5 µl Resuspension Buffer. Gently, pipette entire volume up and down 10 times mixing thoroughly. Ensure beads are no longer attached to the side of the well. 15. Incubate resuspended beads at room temperature for 2 minutes. 16. Place plate on magnetic stand for 5 minutes until the sample appears clear. 17. Gently transfer 20 µl of clear sample to new well. BIOO LIFE SCIENCE PRODUCTS 8

11 18. If you wish to pause your experiment, the procedure may be safely stopped at this step and samples stored at -20 C. To restart, thaw frozen samples on ice before proceeding. STEP E: PCR Amplification Materials Bioo Scientific Supplied GREEN CAP NEXTflex Primer Mix NEXTflex PCR Master Mix User Supplied Thermocycler 96 Well PCR Plate Resuspension Buffer *Ligation Product (from STEP D) 1. For each sample, combine the following reagents on ice in the PCR plate. 20 µl Ligation Product 18 µl Nuclease-free H 2O 10 µl NEXTflex PCR Master Mix 2 µl NEXTflex Primer Mix 50 µl TOTAL 2. Set pipette to 50 µl, gently pipette the entire volume up and down 10 times. 3. Apply adhesive PCR plate seal and place in thermocycler for the following PCR cycles: 20 min 72 C Nick Translation 2 min 95 C 30 sec 95 C 30 sec 62 C Repeat 6-12 cycles* 60 sec 72 C 4 min 72 C Starting amount of DNA No. of cycles 10 ng ng ng ng 6 *PCR cycles will vary depending on the amount of starting material and quality of your sample. Further optimization may be necessary. Always use the least number of cycles possible. 4. Add 50 µl of AMPure XP Beads to each sample and gently pipette the entire volume up and down 10 times. 5. Incubate at room temperature for 5 minutes. 6. Place the 96 well PCR Plate on the magnetic stand at room temperature until the sample appears clear. 7. Gently remove and discard clear sample taking care not to disturb beads. Some liquid may remain in wells. BIOO LIFE SCIENCE PRODUCTS 9

12 8. With plate on stand, gently add 200 µl of freshly prepared 80% ethanol to each magnetic bead pellet and incubate plate at room temperature for 30 seconds. Carefully, remove ethanol by pipette. 9. Repeat step 5, for a total of 2 ethanol washes and ensure all ethanol has been removed. 10. Remove the plate from the magnetic stand and let dry at room temperature for 3 minutes. 11. Resuspend dried beads with 33 µl Resuspension Buffer. Gently, pipette entire volume up and down 10 times mixing thoroughly and ensuring beads are no longer attached to the side of the well. 12. Incubate resuspended beads at room temperature for 2 minutes. 13. Place plate on magnetic stand for 5 minutes until the sample appears clear. 14. Gently transfer 30 µl of clear sample to a well of a new 96 well PCR Plate. 15. Check the size distribution of your library by Agilent Bioanalyzer or gel. To check size by gel, load 2 µl of 6X Gel Loading Dye and 10 µl of PCR Product in a SYBR stained 2% agarose gel. 16. Before proceeding to emulsion PCR, it is recommended that you quantify your library by qpcr. This can be performed using any qpcr quantification kit with the NEXTflex Primer Mix. For multiplexing pool equal molar concentration of barcoded libraries. LIBRARY VALIDATION LIBRARY VALIDATION Figure 2. Bioanalyzer validation of NEXTflex PCR product (100 ng, 10 cycles) A. B. High Sensitivity DNA Chip Ladder / Electropherogram BIOO LIFE SCIENCE PRODUCTS 10

13 A) Gel image of ladder and NEXTflex PCR product (100 ng, 10 cycles) B) Electropherogram of NEXTflex PCR product (100 ng, 10 cycles) APPENDIX A APPENDIX A Oligonucleotide Sequences NEXTflex P1 Adapter P2 Adapter Primer 1 Primer 2 Sequence 5' CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT 5' ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT 5 AGAGAATGAGGAACCCGGGGCAGTT 5 CTGCCCCGGGTTCCTCATTCTCT 5 CCACTACGCCTCCGCTTTCCTCTCTATG 5 CTGCCCCGGGTTCCTCATTCT RELATED PRODUCTS DNA Fragmentation RELATED PRODUCTS Product Catalog Number AIR DNA Fragmentation Kit (10 reactions) AIR DNA Fragmentation Kit (40 reactions) DNA Next Generation Sequencing Kits for Ion Torrent Product Catalog Number NEXTflex DNA Sequencing Kit (48 reactions) NEXTflex DNA Barcodes NEXTflex DNA Barcodes DNA Next Generation Sequencing Kits for 5500 SOLiD Product Catalog Number NEXTflex DNA Sequencing Kit (12 reactions) NEXTflex DNA Sequencing Kit (48 reactions) NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes DNA Next Generation Sequencing Kits for SOLiD 4 Product Catalog Number NEXTflex DNA Sequencing Kit (12 reactions) BIOO LIFE SCIENCE PRODUCTS 11

14 DNA Next Generation Sequencing Kits for Illumina Product Catalog Number NEXTflex ChIP-Seq Kit (8 reactions) NEXTflex ChIP-Seq Kit (48 reactions) NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex-96 ChIP-Seq Barcodes NEXTflex DNA Sequencing Kit (8 reactions) NEXTflex DNA Sequencing Kit (48 reactions) NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex-96 DNA Barcodes NEXTflex Methyl-Seq 1 kit (8 reactions) NEXTflex Methyl-Seq 1 kit (48 reactions) NEXTflex PCR-Free DNA Sequencing Kit (8 reactions) NEXTflex PCR-Free DNA Sequencing Kit (48 reactions) NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes RNA Next Generation Sequencing Kits for Illumina Product Catalog Number NEXTflex Directional RNA-Seq Kit (8 reactions) NEXTflex Directional RNA-Seq Kit (24 reactions) NEXTflex Directional RNA-Seq Kit (48 reactions) NEXTflex Directional RNA-Seq Barcodes Set A NEXTflex Directional RNA-Seq Barcodes Set B NEXTflex Directional RNA-Seq Barcodes Set C NEXTflex Directional RNA-Seq Barcodes Set D NEXTflex Small RNA Sequencing Kit (24 reactions) NEXTflex Small RNA Sequencing Kit (48 reactions) NEXTflex Small RNA Barcodes Set A NEXTflex Small RNA Barcodes Set B NEXTflex Small RNA Barcodes Set C NEXTflex Small RNA Barcodes Set D Bioo Scientific Corporation 3913 Todd Lane Suite 312 Austin, TX USA Tel: Fax: (512) Made in USA BIOO Research Products Group nextgen@biooscientific.com BIOO LIFE SCIENCE PRODUCTS 12