Characterization of resistance to Clover yellow vein virus in pea. Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA

Transcription

1 Characterization of resistance to Clover yellow vein virus in pea Sun Hee CHOI, Ryoko SHIMADA, Go ATSUMI, Kenji NAKAHARA and Ichiro UYEDA Graduated school of Agriculture Hokkaido University Sapporo, Japan

2 visual Clover yellow vein virus (ClYVV) visual GFP filter Upper leaf 6dpi 8dpi 35S Potyviridae, Potyvirus + single-strand RNA virus, about 10Kb Mature proteins : 10 proteins + 1 Host: legume - pea (Pisum sativum), broad bean (Vicia faba) Symptoms: Mosaic, vein yellowing, necrosis Recessive resistance gene in pea: cyv-1, cyv-2 isolates: Cl-no30, 90-1 pclyvv/c3-s65t-sal (pcl-no30) 6K1 6K2 P1 HC-Pro P3 CI VPg NIa NIb CP Poly A dpi: days post inoculation GFP PIPO (Masuta et al., 2000) P3N-PIPO P3 PIPO

3 RESISTANCE GENES IN PEA AGAINST Clover yellow vein virus. Two resistance genes, cyv-1 and cyv-2, has been reported by Provvidenti (J. Hered. 78: , 1978) and Provvidenti and Hampton (Pisum genetics 23:26-28, 1991). Resistance genes, cyv-1 and cyv-2, are mapped Linkage groups 2 and 6, respectively. There are two resistance modes in pea against Clover yellow vein virus based on the virus movement monitored by GFP tagged virus (Andrade and Uyeda Phytopathology 97: , 2007 ) The question is; Do cyv-1 and cyv-2 correspond to resistance modes described by Andrade and Uyeda? One of the resistance modes of Andrade is controlled by cyv-2 encoding eukaryotic initiation factor 4E (Andrade et al, JGPP 75: , 2009 ) and Present study suggests that cyv-1 corresponds to another mode of resistance described by Andrade and it operates by restricting cell-to-cell movement of the virus.

4 PI (2/42) PI The movement of Cl-no30 in pea lines 1dpi 2dpi 3dpi 4dpi 5dpi 500μm

5 sbm 2, mo, and cyv-1 clustered on Linkage group II and liked with PGM2 AFLP analyses showed eif(iso)4e linked with makers on Linkage group II and hence with mo and sbm 2. (Gao et al., TAG 109: , 2004) Is cyv-1 closely linked with PGM2? Is cyv-1 cosegregates with eif(iso)4e? Recessive resistance gene Against virus Pepper pvr6 pvr1 TEV, PepMoV, ChiVMV pvr2 1~9 PVY, TEV Lettuce mo1 LMV Tomato pot-1 TEV, PVY cyv1 cyv2 ClYVV Pea sbm-2 sbm-1,3,4 PSbMV mo BYMV eif(iso)4e? eif4e Pisum Genetics

6 Sequence of pgm2 genomic analysis A large deletion in intron of PI a PGM2 AB40 Design primers to descriminate the lines 1 2 M 1 2 SSR markers of Loridon (2005) 100 F2 progenies from cross between PI and PI were tested Map manager was used to calculate distances

7 AA473 50cM 75.8cM PI250 F2 PI429 S visual Inoculated leaf GFP filter CFP filter Resistance gene AB149 AB40 PGM2(pPgm) * 4cM 1cM R AA205 6dpi Line Susceptible Resistance Ratio X 2 Goodness of fit, P= 0.05 PI ~104 79/100 21/100 3: < P < 1.0

8 AA473 50cM 75.8cM 50cM AB149 AB40 PGM2(pPgm) * Resistance gene 4cM 1cM AA205

9 Reaction to Cl-no30 6K1 6K2 P1 HC-Pro P3 CI VPg NIa NIb CP GFP Cl-no30 GFP filter Cl-no30 GFP filter visual PI (0/7) PI (15/15) PI RS-7 - (0/3) PI S-4 + (7/7) PI R-18 - (0/9) PI (3/3) PI R-8 - (0/6) PI (3/3) cyv1 pea lines PI (0/3) PI (3/3) PI (0/4) PI (3/3) PI (0/5) PI (0/5)

10 Cross PI with a pea line carrying cyv-1 (PI ) Inoculate progeny with ClYVV F1 was resistance to infection up to 10days!

11 Is eif(iso)4e closely linked with cyv-1? 1. Are there any sequence polymorphism in eif(iso)4e? 2. Genomic cdna Sequence comparison of eif(iso)4e between PI (Sus) and PI (cyv-1) 3. No nucleotide sequence difference in genomic sequence encoding eif(iso)4e 4. Are there difference in promoter region?

12 A DNA extraction DNA purification with CsCl 2 Ligation; request to TaKaRa electroporation Genomic DNA library screening for eif(iso)4e Incubation PCR Row pools 10 3 Pfu/1 plate Colonies collection Column pools

13 Pea genome cloning (Pea genome size=4300 Mbp) More than 10 3 clones per petri plate generated with about average 5 kbp insert 40 X 27 (1080) petri plates prepared and total DNAs are extacted from each petri plate Total of more than 10 6 clones were obtained (5000 Mbp) Promoter sequencingofeif(iso)4e 6 clones that are positive in PCR amplification of eif(iso)4e sequence obtained About 2Kpb Upstream of the transcription start site of eif(iso)4e was sequenced Promoter sequence comparison between S and R pea lines Based on above sequence, PCR primers were designed for cloning promoter region of the eif(iso)4e gene Promotor region of eif(iso)4e gene from PI (susceptible) and PI (cyv1) was cloned and sequenced.

14 B PCR screening for eif(iso)4e sequencing 3Kb M PI PI Primer design Cloning Promoter eif(iso)4e cyv1 Sequencing a pea carrying cyv1

15 AC Upstream of eif(iso)4e from 2-H-8 clone Medtr1g (eif4e-2) 241bp+eIF(iso)4E PI A CAAGGTGTCTAACCTTAT CTGACTA A TTTTT GAGAGAAACGAAATATGGCAACAAC PI T CAAGGTGTCTAACCTTAT CTGACTA T TTTTT GAGAGAAACGAAATATGGCAACAAC initiation codon bp GAAACATATACAATATTTTAA TATA box? ATTCAGAAAGAGAGAGAAACGAAATATGGCAACAAC Inr? GAAATATGGCAACAAC Initiator sequence

16 CONCLUSIONS Cyv-1 resistance operates by restricting cell to cell movement of ClYVV SSR marker AB40 is closely linked with cyv-1 There are no differences in the sequence of eif(iso)4e gene between resistance and susceptible pea lines

17 Sun Hee CHOI Ryoko SHIMADA Go ATSUMI Kenji NAKAHARA C o n t r i b u t o r s Marcelo ANDRADE Ichiro UYEDA Graduated school of Agriculture, Hokkaido University, Sapporo, Japan.