CRISPR AgBio Workshop London Vladimir Nekrasov

Transcription

1 CRISPR AgBio Workshop London 2017 Vladimir Nekrasov

2

3

4 Applying CRISPR-Cas9 technology in model and crop plants Model plant: Crop plants: Nicotiana benthamiana Tomato Barley Arabidopsis thaliana Maize Brassica Wheat

5 The pipeline of targeted mutagenesis in plants using the CRISPR/Cas9 system Belhaj et al. Current Opinion in Biotechnology (2015)

6 Targeted modification of a plant genome is achieved via harnessing DNA double strand break (DSB) repair pathways: 1. Non-Homologous End Joining (NHEJ): small random deletions or insertions introduced 2. Homology-Directed Repair (HDR): specified locus modification introduced The key to targeted genome modification is to have means of introducing a DSB at a specific locus Adapted from Voytas D. Annu. Rev. Plant Biol. (2013)

7 CRISPR/Cas9 applications in plants: targeted genome modification via DNA double strand break (DSB) repair by the non-homologous end joining (NHEJ) Single locus mutation Cas9/sgRNA Large scale chromosomal deletion Cas9/sgRNA 1 Cas9/sgRNA

8 CRISPR RGEN Tools is a webtool for designing CRISPR/Cas targets and finding off-targets in genomes

9 73 plant genomes are in the database

10 Methods for detecting CRISPR/Cas9-induced mutations PCR Sanger sequencing Decomposition using TIDE webtool Mutant (biallelic)

11

12

13 Methods for detecting CRISPR/Cas9-induced mutations PCR Sanger sequencing Decomposition using TIDE webtool Mutant (biallelic) Mutant 1 PCR with barcoded oligos Next Generation Sequencing (NGS) Mutant 2

14

15

16 Methods for detecting CRISPR/Cas9-induced mutations PCR Sanger sequencing Decomposition using TIDE webtool Mutant (biallelic) Mutant 1 PCR with barcoded oligos Next Generation Sequencing (NGS) Mutant 2 Fluorescent PCR high-resolution fragment analysis (HRFA) Capillary electrophoresis

17 Detection of induced mutations in the GBSS gene by high-resolution fragment analysis (HRFA) using capillary electrophoresis

18 Methods for detecting CRISPR/Cas9-induced mutations PCR, denaturation, annealing Surveyor assay CelI, T7 High Resolution Melting analysis Heteroduplex Mobility Assay (non-denaturing PAGE) PCR, denaturation + + Single-strand conformation polymorphism (SSCP) (non-denaturing PAGE)

19 High Resolution Melting analysis

20 Heteroduplex Mobility Assay (non-denaturing PAGE)

21 Single-strand conformation polymorphism (SSCP) (non-denaturing PAGE)

22 Methods for detecting CRISPR/Cas9-induced mutations PCR, denaturation, annealing Surveyor assay CelI, T7 High Resolution Melting analysis Heteroduplex Mobility Assay (non-denaturing PAGE) PCR, denaturation + + Single-strand conformation polymorphism (SSCP) (non-denaturing PAGE) PCR, digesting with a restriction enzyme Restriction enzyme site loss assay

23 Restriction enzyme site loss assay Transgenic N. benthamiana Plant: 2 3 Arrowhead ( ) MlyI-resistant band Asterisk (*) MlyI star activity band Nekrasov et al. Nat. Biotech. (2013)

24 Methods for detecting CRISPR/Cas9-induced mutations PCR, denaturation, annealing Surveyor assay CelI, T7 High Resolution Melting analysis Heteroduplex Mobility Assay (non-denaturing PAGE) PCR, denaturation + + Single-strand conformation polymorphism (SSCP) (non-denaturing PAGE) PCR, digesting with a restriction enzyme Restriction enzyme site loss assay PCR Amplified fragment length polymorphism (AFLP)

25

26 The Golden Gate cloning system allows easy assembly of multiple expression units Promoters 5' UTR Signal Peptides ORF Terminators P1 P6 P SP1 SP6 SP11 ORF1 ORF6 ORF11 Ter1 Ter6 Ter10 Libraries of basic modules P2 P3 P4 P7 P8 P9 P12 P13 P SP2 SP3 SP4 SP7 SP8 SP9 SP12 SP13 SP14 ORF2 ORF3 ORF4 ORF7 ORF8 ORF9 ORF12 ORF13 ORF14 Ter2 Ter3 Ter4 Ter7 Ter8 Ter Ter10 Ter12 Ter13 P5 P10 P SP5 SP10 SP15 ORF5 ORF10 ORF15 Ter5 Ter9 Ter14 Level 0 Choice of modules Promoter 5' UTR ORF Ter P ORF Ter Level 1 transcription units 35S ORF Ter Level 2 multigene constructs LB P1 1 ORF1 T1 P2 2 ORF2 T2 P3 3 ORF3 T3 P4 4 ORF4 T4 P5 5 ORF5 T5 P6 6 ORF6 T6 P7 7 ORF7 T7 P8 8 ORF8 T8 P9 9 ORF9 T9 P10 10 ORF10 T10 P11 11 ORF11 T11 RB In collaboration with S. Marillonnet

27 BpiI BpiI BpiI BpiI BpiI BpiI BpiI BpiI BpiI BpiI BpiI BpiI Using the Golden Gate cloning system to assemble CRISPR constructs pich47732:: NOSp::NPTII-OCST Level 1 pich47742:: 35Sp::Cas9-NOST Level 1 pich47751 AtU6p::sgRNA1 Level 1 pich47761 AtU6p::sgRNA2 Level 1 pich41780 Linker TGCC NPTII GCAA + GCAA Cas9 ACTA + ACTA sgrna1 TTAC + TTAC sgrna2 CAGA + CAGA L4E GGGA Carb Carb Carb Carb Spec + LB TGCC Red GGGA RB pagm4723 Level 2 vector Kan BpiI + ligase LB TGCC GCAA ACTA TTAC CAGA GGGA NPTII Cas9 sgrna1 sgrna2 Kan L4E RB NPTII-Cas9-sgRNA Level 2 select white colonies

28 Generating a knockout deletion in the SlMlo1 locus of the Moneymaker tomato using CRISPR/Cas bp * * * bp WT * * * over 80% of T0 plants carry deletions * * Target 1 PAM PAM Target 2 WT ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG Plant 1 ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG Plant 2 ACATAGTAAAAGGTGTACCTGTGGTGGA CTTGATTAACTTTGTACTCTTTCAGG -48 Plant 8 ACATAGTAAAAGGTGTACCTGTGGTGGA CTTGATTAACTTTGTACTCTTTCAGG -48 ACATAGTAAAAGGTGTACCTGTGGTGGA CTTGATTAACTTTGTACTCTTTCAGG -48 Plant 10 ACATAGTAAAAGGTGTACCTGTGGTGGA TTGATTAACTTTGTACTCTTTCAGG -49 Nekrasov et al. Scientific Reports (In Press)

29 CRISPR/Cas-engineered slmlo1 tomato line is fully resistant to the powdery mildew pathogen Oidium neolycopersici SlMLO1 (WT) slmlo1

30 T1 generation slmlo1 plants were screened for the absence of T-DNA bp WT slmlo1 T-DNA slmlo1 8-6 SlMlo1 T-DNA WT slmlo1 8-2 slmlo1 8-4 slmlo1 8-6 (T-DNA) LB T-DNA RB Illumina reads matching the T-DNA Nekrasov et al. Scientific Reports (In Press)

31 Illumina whole genome sequencing confirmed presence of a homozygous deletion in the SlMlo1 locus WT slmlo1 8-2 slmlo1 8-4 slmlo1 8-6 (T-DNA) WT slmlo1 8-2 slmlo1 8-4 slmlo1 8-6 (T-DNA) Nekrasov et al. Scientific Reports (In Press)

32 Off-target analysis: 145 putative off-targets with up to 4 mismatches analysed Target sequence (PAM is in Green) Sites chromosome position off-target sequence Reference base Called base (slmlo1 8-2) Rate of the Mutation? called base Different from wild type? Reference base Called base (wild type) Rate of the Mutation? called base CCAATTCTTGATTAACTTTGTAC 1 chr CCAATTCTTtATTAttTTTGTAC C C C C chr CCAATTCTTtATTAttTTTGTAC C C C C chr CCAATTCTTtATTAttTTTGTAC A A A A 1-4 chr CCAATTCTTtATTAttTTTGTAC A A A A 1-5 chr CCAATTCTTtATTAttTTTGTAC T T T T 1-6 chr CCAATTCTTtATTAttTTTGTAC T T T T chr CCAATTCTTtATTAttTTTGTAC C C C C chr CCAATTCTTtATTAttTTTGTAC T T T T chr CCAATTCTTtATTAttTTTGTAC T T T T 1-10 chr CCAATTCTTtATTAttTTTGTAC t T t T chr CCAATTCTTtATTAttTTTGTAC A A A A chr CCAATTCTTtATTAttTTTGTAC T T T T 1-13 chr CCAATTCTTtATTAttTTTGTAC T T T T 1-14 chr CCAATTCTTtATTAttTTTGTAC A A A A 1-15 chr CCAATTCTTtATTAttTTTGTAC t T t T chr CCAATTCTTtATTAttTTTGTAC t T t T chr CCAATTCTTtATTAttTTTGTAC T T T T 1-18 chr CCAATTCTTtATTAttTTTGTAC T T T T 1-19 chr CCAATTCTTtATTAttTTTGTAC T T T T 1-20 chr CCAATTCTTtATTAttTTTGTAC G G G G chr CCAATTCTTtATTAttTTTGTAC T T T T 1-22 chr CCAATTCTTtATTAttTTTGTAC A A A A chr CCAATTCTTtATTAttTTTGTAC C C C C Result: no off-target mutations detected suggesting that CRISPR/Cas is a highly precise tool in tomato Nekrasov et al. Scientific Reports (In Press)

33 Homozygous T-DNA free slmlo1 tomato lines have been produced in less than 1 year Callus tissue Transform with Cas9/sgRNAs T0 plantlets Screen for homozygous slmlo1 T0 mutants T1 seeds slmlo1 T-DNA segregating Screen T1 generation for T-DNA-free plants T2 seeds slmlo1 T-DNA-free Time, months 3 months 3 months 3.5 months

34 Targeted modification of a plant genome is achieved via harnessing DNA double strand break (DSB) repair pathways: 1. Non-Homologous End Joining (NHEJ): small random deletions or insertions introduced 2. Homology-Directed Repair (HDR): specified locus modification introduced Adapted from Voytas D. Annu. Rev. Plant Biol. (2013)

35 CRISPR/Cas9 technology applications involving homologous recombination (HR) Targeted gene insertion (e.g. GFP tag) Targeted gene replacement (introducing SNPs into a desired gene) Targeted Gene Insertion Targeted Gene Replacement GFP Cas9/ sgrna Repair template Cas9/ sgrna Repair template Gene 1 Target locus Gene 1 Target locus Gene 1 GFP Gene 1

36 Targeted insertion of the nptii selectable marker into Arabidopsis ADH1 locus using homologous recombination (HR) LB Cas9 sgrna nptii RB ADH1 LB Cas9 sgrna Cas9/ sgrna nptii Cas9/ sgrna RB Cas9/ sgrna ADH1 LB Cas9 sgrna RB nptii Selected on kanamycin and allyl alcohol Adapted from Schiml et al. Plant J. (2014)

37 Chlorsulfuron (100 µg L 1 ) HDR-mediated ZmALS2 allele replacement in maize using CRISPR/Cas9 Cas9 sgrna + ZmALS2 P165S DNA repair template Maize resistant to chlorsulfuron ZmALS2 Plant cell nucleus ZmALS2 P165S Cas9/sgRNA ZmALS2 P165S ZmALS2 ALS2 P165S ZmALS2 P165S WT ZmALS2 Adapted from Svitashev et al. Plant Physiology (2015)

38 Generating a Landing Pad (LP) for inserting genes of interest (GOIs) at a specified location on a chromosome LP Chromosome P GOI1 T LP P GOI1 T P GOI2 T LP P GOI1 T P GOI2 T P GOI3 T LP Advantage: one can avoid the position effect when expressing transgenes

39 Generating a Landing Pad for inserting genes of interest at a specified location on a chromosome P BAR T intron exon2 HPT T Chromosome P GOI T P exon1 HPT intron P Cas9 T P sgrna DNA repair template/ Cas9 + sgrna vector P GOI T P exon1 HPT intron exon2 HPT T Chromosome BAR Basta selectable marker; HPT Hygromycin selectable marker; GOI gene of interest; P promoter; T terminator

40 Genome Editing As A Tool To Speed Up Breeding Of Crops With Improved Agronomic Traits CRISPR/Cas system

41 Advantages of genome editing as compared to traditional breeding: Speed: mutations can be introduced directly into an elite variety without lengthy crosses with e.g. a related wild species and then backcrosses to the elite line No linkage drag: unlike in conventional breeding, a mutation can be introduced into an elite variety without closely linked genes that may confer an adverse phenotype Precision: CRISPR practically does not generate off-target mutations, while e.g. EMS mutant lines have thousands of background mutations Multiplexing: ability to target a few genes at the same time (e.g. homologues or genes arranged in a gene cluster)

42 Challenges for CRISPR/Cas-assisted crop breeding: need to broadly connect genotype with phenotype - Gene function predictions based on model species e.g. Arabidopsis - GWAS on accessions that show variation in the trait of interest - Forward genetic screen (e.g. using EMS-mutagenized population) Genetic locus fine-mapping aim to develop the technology to level when multiple precise genetic changes can be simultaneously introduced into an elite crop variety

43

44 Acknowledgements Achim Dobermann Malcolm Hawkesford Caroline Sparks Damiano Martignago Lucy Hyde The Sainsbury Laboratory (Norwich) Sophien Kamoun Joe Win and the rest of the Kamoun Lab Jonathan Jones Earlham Institute Nicola Patron Oleg Raitskin Cold Spring Harbor Laboratories Zachary Lippman Chris Brooks Boyce Thompson Institute Joyce van Eck MPI Tubingen Detlef Weigel Institute of Digital Agriculture, Zhejiang Academy of Agriculture Sciences Congmao Wang