Genetic diversity and phylogenetic relationships of Romanian cattle breeds inferred from cytochrome b gene partial sequences

Transcription

1 Romanian Biotechnological Letters Vol. 15, No.2, 2010 Copyright 2010 University of Bucharest Printed in Romania. All rights reserved ORIGINAL PAPER Genetic diversity and phylogenetic relationships of Romanian cattle breeds inferred from cytochrome b gene partial sequences. Received for publication, September 22, 2009 Accepted, April 05, 2010 THIEU PHAN XUAN 1, S. E. GEORGESCU 1, MARIA ADINA MANEA 1, ANCA OANA HERMENEAN 2, MARIETA COSTACHE 1 1. University of Bucharest, Molecular Biology Center Splaiul Independentei, 5 Bucharest, Romania, marietacostache@yahoo.com 2. Vasile Goldis Western University of Arad, Arad, Romania Abstract 5154 To determine the origin and genetic diversity of Romanian cattle breeds: Romanian Grey Steppe, Romanian Black Spotted, Romanian Brown and Montbeliarde, the partial Cyt b gene sequences (610bp) were analyzed. The average nucleotide frequencies of T, C, A and G were 27.3, 27.6, 30.9 and 14.2%, respectively. The nucleotide composition is rich in A/T nucleotides and shows a slightly higher A/T content (58.2%) than C/G content (41.8%). The nucleotide comparison also demonstrated a strong bias towards transition. A Neighbor-Joining tree was constructed and it revealed that the Romanian cattle breeds originated from Bos taurus and had no direct relationship with Bos indicus, Bos grunniens and Bos javanicus. Keywords: Cattle breeds, Cytochrome b gene, Genetic diversity, Phylogeny. Introduction Cattle are considered to have been one of the first animals domesticated by man for agricultural purposes. They were tamed in order to provide milk, meat and hides and for draft purposes. Today, over 800 breeds of cattle are recognized worldwide, some adapted to the local climate, others were bred by humans for specialized uses. Breeds are arranged into two main types, regarded as either two closely related species: Bos indicus (or Bos taurus indicus) cattle, also called zebu, are adapted to hot climates, and Bos taurus (or Bos taurus taurus) are the typical cattle of Europe, north-eastern Asia, and parts of Africa they are referred to in this list as "taurine" cattle, and many are adapted to cooler climates. The characterization of the genetic structure of populations, breeds and species provides information necessary for developing breeding program strategies, as it allows genetic variability studies, information that is also important for genetic conservation programs. The cytochrome b (Cyt b) gene contains abundant phylogenetic information among intra- and interspecies and it is considered to be a good marker to study the genetic differentiation and phylogenetic relationships among species within the same genus or the same family (Browers et al., 1994; Zardoya and Meyer, 1996). Cyt b gene is widely used in studies on origin, taxonomy and phylogeny of the subfamily Bovinae (Kikkawa et al., 1997; Birungi and Arctander, 2001; Hassanin and Ropiquet, 2004). In the present study, we analyzed partial sequences from the Cyt b gene of four Romanian cattle breeds in order to estimate genetic diversity and phylogenetic relationships. These data, combined with Cyt b sequences of other bovine species from GenBank, were used to perform phylogenetic analysis in order to explore the molecular phylogeny and to provide some molecular biological substance for evaluating and protecting genetic resource.

2 THIEU PHAN XUAN, S. E. GEORGESCU, MARIA ADINA MANEA, ANCA OANA HERMENEAN, MARIETA COSTACHE Materials and methods Sampling and DNA extraction Fresh blood samples were collected from cattle populations: Romanian Black Spotted (RBS), Romanian Brown (RB), Montbeliarde (M) and Romanian Grey Steppe (RGS). The individuals were chosen at random and we avoided closely related animals. The isolation of genomic DNA from fresh blood was performed with Wizard Genomic DNA Extraction Kit (Promega). The Cyt b gene sequences in Bovinae cited in GenBank for phylogenetic analysis were collected from cattle breeds of 6 bovine species including Bos taurus, Bos indicus, Bos grunniens, Bos javanicus, Bison bonasus and Bison bison. The Bos taurus sequences were obtained from: Asian cattle (GenBank Accession No. AY526085, DQ124389, AY and DQ186203), American cattle (GenBank Accession No. AY676860, AY and AY676866), European cattle (GenBank Accession No.V00654, AF492351, EU177834, DQ124413, GQ129208, EU177847, EU177852, EU177862, EU177867, EF693798, EU and GQ129207). The cited sequences of Bos indicus were obtained from GenBank Accession No. AF492350, AF531473, AY and AY The cited sequences of Bos grunniens were obtained from China and other regions (GenBank Accession No. AF091631, AY684273, AY955225, EF494177, EF494178, EF and NC_006380). The cited sequences of Bos javanicus were obtained from GenBank Accession No. AY689188, EF197952, D34636, D82889, DQ459558, DQ and two bison species that are Bison bonasus (Y15005) and Bison bison (AF036273). Amplification and Sequencing The partial Cyt b gene was amplified by using forward primer 5 / GAAAAA CCATCGTTGTCATTCA 3 / and reverse primer 5 / TGGATTGGGATTTTGTCTACG 3 /. PCR was performed in a 25μl reaction mixture containing 50ng of genomic DNA, 5X reaction buffer, 1.5mM MgCl 2, 0.8 pm of each dntps, 10 pmol of each primer and 0.2 Units of Taq polymerase. Thermal cycling was performed on GeneAmp 9700 System (AppliedBiosystems). The standard PCR conditions were as follows: 5min at 95 0 C; 40 cycles of denaturation/annealing/extension with 30s at 95 0 C for denaturation, 30s at 61 0 C for annealing, 60s at 72 0 C for extension and a final 7min extension at 72 0 C, before cooling to 4 0 C for 10min. PCR products were purified using a Wizard PCR preps DNA Purification System Kit (Promega) PCR sequencing was performed with 40 ng PCR products and the same primers were used for amplification by BigDye Terminator v3.1 Cycle Sequencing kit and then purified with BigDye XTerminator Purification Kit Protocol. Sequencing was run on ABI Prism 3130 Genetic Analyzer with DNA Sequencing Analysis 5.2 Software (AppliedBiosytems) Statistical analysis Cyt b partial sequences from Romanian cattle breeds were edited and aligned with 38 homologous fragments of Cyt b sequences cited in GenBank, (V00654 considered as a reference) using Clustal X (Thompson et al., 1997) with parameters set to default and the results were then checked manually. Pairwise comparisons of observed sequence differences, number of transitions and transversions, and nucleotide composition by codon position were analyzed using the computer program MEGA v4 (Kumar et al., 2007). The Neighbor Joining (NJ) tree based on 42 partial sequences of the cyt b gene (4 obtained by us and 38 from GenBank) was constructed using Kimura 2-parameter model in the MEGA package. The statistical confidence of each node in the tree was also estimated by 0 random bootstrap replications (Felsenstein, 1985). Romanian Biotechnological Letters, Vol. 15, No. 2,

3 Genetic diversity and phylogenetic relationships of Romanian cattle breeds inferred from cytochrome b gene partial sequences Results and Discussions Nucleotide composition of Cyt b partial sequences of Romanian cattle breeds After sequencing and alignment, a 610 bp fragment of cytb gene (positions in cattle cytb gene) was obtained from Romanian Black Spotted, Romanian Brown, Montbeliarde and Romanian Grey Steppe. No insertions/deletions were observed. The average nucleotide frequencies of T, C, A and G were 27.3, 27.6, 30.9 and 14.2%, respectively (Table 1). The nucleotide composition is rich in A/T nucleotides and shows a slightly higher A/T content (58.2%) than C/G content (41.8%). A remarkable imbalance in base usage was observed at the third positions, with infrequent use of G (3.8%) and a bias towards A+C (58.3%). The low number of G s (3.8%) and high number of A s (43.0%) at the third position indicates that the likelihood of an A to G transition is much lower than a G to A transition (Birungi and Arctander, 2001). Table 1: Nucleotide composition of Cyt b partial sequences of four cattle breeds. Nucleotide Average % First codon Second codon Third codon T C A G Nucleotide variations of Cyt b gene sequences in breeds and bovine species Combining with 19 Cyt b sequences of cattle breeds (Bos taurus) in GenBank, among 610 sites were compared with each other, a total of four variable sites (219, 234, 360, 393) (0.65% of all sites) were observed, of which only one site was a parsimony informative polymorphic site, and only one site (the 60 th site) was an amino acid substitution site. Of the 4 variable sites, the transition and transversion sites comprised 4 and 0, respectively. The transition/transversion ratio (R) was 4:0, showing a low transition bias (Irwin et al., 1991). From the 610 sites compared for 42 Cyt b sequences in Bovine breeds, a total of 94 variable sites (15.57% of all sites) were observed, of which 73 sites were parsimony informative polymorphic sites and 21 sites were singleton polymorphic sites. Of the 94 variable sites, the transition sites and transversion sites comprised 22 and 1, respectively. The transition/transversion ratio (R) was 22, showing a high transition bias (Irwin et al., 1991). Interestingly, the transitional rate between pyrimidines (T-C) was higher than between purines (A-G) with a ratio of 3:6, similar to the report of Tamura and Nei (1993). Phylogenetic analysis In this study, phylogenetic analysis was based on four Cyt b partial sequences (610 bp) of Romanian cattle breeds and 38 homologous fragments of Cyt b sequences cited in GenBank (above). The NJ phylogenetic tree of the Bovinae (Figure 1) was constructed with Bubalus bubalis (Accession No. D88635) as outgroup. Support for individual branch of NJ phylogenetic tree was assessed by Bootstrap Percentages (BP) computed after 0 replicates of the closest stepwise addition option. It can be seen from Figure 1 that bovine species were used to construct a NJ tree to reveal the origin of Romanian cattle breeds. The NJ tree showed six different mtdna lineages: Bos taurus, Bos indicus, Bos grunniens, Bos javanicus, Bison bonasus and Bison bison. The six distinct lineages could be interpreted as evidence for six separate maternal origins. The four Romanian cattle breeds were all clustered into the Bos taurus lineage with a high bootstrap probability (>50%) Romanian Biotechnological Letters, Vol. 15, No. 2, 2010

4 THIEU PHAN XUAN, S. E. GEORGESCU, MARIA ADINA MANEA, ANCA OANA HERMENEAN, MARIETA COSTACHE M AF AY EU EF EU GQ EU GQ RGS AY AY Bos taurus EU EU AY EU V RBS DQ AY DQ BR DQ AF AY AF AY Bos indicus Y15005 Bison bonasus 88 DQ D34636 AY D82889 Bos javanicus EF DQ AF Bison bison 98 AY NC AF EF EF AY EF D88635 Bos grunniens Outgroup 0.01 Figure 1. Neighbor Joining tree of Cyt b gene partial sequences of six bovine species (The bootstrap values of the branches). The phylogenetic tree also shows that the four Romanian cattle breeds were divided in two clusters. The first group consists of Romanian Grey Steppe, Romanian Black Spotted and Montbeliarde, in which Romanian Grey Steppe breed closely related to Ukrainain Grey (GQ129208), Hungarian Grey (GQ129207) and Hungarian Steppe (EU747736). This is absolutely logical because Romanian Grey Steppe is part of the Grey Steppe/Podolian group which originates in the Steppe of Ukraine from where it moved westward and immigrated into Italy in ancient times, where it formed the Podolian cattle group. Meanwhile, Romanian Black Spotted breed closely related to Holland Holstein-Friesian (DQ124413) and Montbeliarde breed with Fleckvieh (AF492351) as these breeds are the same group Holstein and Simmental, respectively. The Romanian Brown breed is clearly distinct from the other three cattle breeds. Romanian Brown breed was formed by absorption cross-breeding between the Schwyz breed in Switzerland and the local cattle breeds of the Grey Steppe and Mocanitsa type. Conclusions Our results indicated that there was low mitochondrial genetic diversity in Romanian breeds and that the four cattle breeds were all clustered into the Bos taurus lineage. In Romanian Biotechnological Letters, Vol. 15, No. 2,

5 Genetic diversity and phylogenetic relationships of Romanian cattle breeds inferred from cytochrome b gene partial sequences addition these data confirm that the Romanian cattle breeds are closely related to their originating ancestor breeds. References 1. BIRUNGI, J. AND P. ARCTANDER, Molecular systematics and phylogeny of the Reduncini (Artiodactyla:Bovidae) Inferred from the analysis of mitochondrial cytochrome b gene sequences. J. Mamm. Evol., 8: BROWERS, N., JR. STAUFFER AND T.D. KOCHER, Intra and interspecific mitochondrial DNA sequence variation within two species of rock-dwelling Cichlids (Teleostei: Cichlidae) from Lake Malawi, Africa. Mol. Phylogenet. Evol., 3: FELSENSTEIN, J., Confidence limits on phylogenies:an approach using the bootstrap. Evol., 39: HASSANIN, A. AND A. ROPIQUET, Molecular phylogeny of the tribe Bovini (Bovidae, Bovinae) and the taxonomic status of the Kouprey, Bos sauveli Urbain Mol. Phylogenet. Evol., 33: IRWIN, D.M., T.D. KOCHER AND A.C. WILSON, Evolution of the cytochrome b gene of mammals. J. Mol. Evol., 32: KIKKAWA, Y., H. YONEKAWA AND H. SUZUKI, Analysis of genetic diversity of domestic water buffaloes and anoas based on variations in the mitochondrial gene for cytochrome b. Anim. Genet., 28: TAMURA, K. AND M. NEI, Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol., 10: TAMURA K, DUDLEY J, NEI M & KUMAR S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol., 24: THOMPSON JD, GIBSON TJ, PLEWNIAK F, JEANMOUGIN F, HIGGENS DG (1997) The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tool. Nucleic Acids Res 25(24): ZARDOYA, R. AND A. MEYER, Phylogenetic performance mitochondrial protein coding genes in resolving relationship among vertebrate. Mol. Biol. Evol., 13: Romanian Biotechnological Letters, Vol. 15, No. 2, 2010