7. Troubleshooting Guidelines

Transcription

1 7. Troubleshooting Guidelines The Pyrosequencing TM technique provides the user with sequence information for several nucleotides 3 of the sequencing primer apart from the polymorphic site. This gives a major advantage compared to most other SNP-scoring techniques when it comes to result reliability and troubleshooting. The additional sequence information can be used to confirm data and to track any unspecific extension reactions taking place in the sample reaction. In sequence analysis, nucleotides are dispensed in a cyclic manner. Due to this, background peaks arising from e.g. shifts, template loops and primer dimers are more easily detected than in the SNP application. These spurious peaks can in some cases make it difficult to interpret the Pyrogram and determine the correct sequence. Any double-stranded DNA, which theoretically can serve as a starting site for the DNA polymerase to incorporate nucleotides, can give rise to background signals. It is therefore advisable to routinely include controls each time a new assay is set up. These controls generate useful information that can provide help to explain unexpected Pyrogram patterns and sort out background problems (Table 7-1). Some recommended controls to include are: sequencing primer only template only negative PCR (master mix without any genomic DNA template) negative PCR together with sequencing primer Unspecific priming of the sequencing primer to the template cannot be deduced by a simple control and has to be checked manually. The most straightforward solution to problems with background is to redesign PCR primers and/or the sequencing primer. In some cases, redesigning can be avoided by different tricks, see Section 7.1. Tips and Tricks. Additional basic troubleshooting guidelines can be found in Section 7.2. Troubleshooting overview. Table 7-1. Useful controls to include when setting up a new assay, and suggested action if background is observed Control: Putative cause of background: Comment: Template alone Template strand can form a If possible, redesign PCR primers to avoid secondary structure, which secondary structure. allows extension from the 3 end. Add single-stranded DNA-binding protein (SSB) to reaction. Sequence complementary strand. Sequencing primer alone Negative PCR sample Negative PCR + sequencing primer Primer dimer can form, resulting in stable 5 overhang with 3 terminal match, which can serve as template for extension. Biotinylated PCR primer forms primer dimer, resulting in stable 5 overhang with 3 terminal match, which can serve as template for extension. Sequencing primer + biotinylated primer form primer dimer, resulting in stable 5 overhang with 3 terminal match, which can serve as template for extension. If possible, redesign PCR primers to avoid primer dimer formation. Add SSB to reaction. Reduce the amount of sequencing primer. Optimize PCR so that primers are fully consumed and use as low primer concentration as possible in PCR reaction to avoid excess primer. Redesign PCR primers. Optimize PCR so that primers are fully consumed and use as low primer concentration as possible in PCR reaction to avoid excess primer. Redesign PCR and/or sequencing primers. 1

2 7.1 Tips and Tricks Alternative dispensation orders for SNP genotyping 1) In cases where the SNP position is located in a homopolymer, the pyrophosphate release from the incorporation of several nucleotides in a row can turn out to be somewhat non-linear, e.g., three Gs in a row do not give rise to three times as much pyrophosphate as a single G. This may cause problems when scoring the genotype. However, it is possible to facilitate the scoring by choosing a dispensation order that creates three informative peaks for a diallelic SNP instead of the standard two, thereby creating a more comprehensive pyrogram, see Figure 7-1. This is automatically done by the PSQ 96MA and PSQ HS 96(A) software for SNPs in homopolymers 3. Figure 7-1. In cases where the SNP position is located in a homopolymer, it may be difficult to distinguish between the genotypes. Here, the sequence to be analyzed is A/GGGCAGAT and the algorithm may have difficulties in differentiating between a double peak G, double and a half peak G, and triple peak G. However, genotype scoring in such cases can be facilitated by using a dispensation order that gives three informative peaks (left) instead of two (right) for the SNP position. Such a dispensation order is automatically chosen by the software for homopolymers larger than 3. 2

3 2) Dispensation orders can also be manipulated in cases where a background peak is interfering with the SNP position, see Figure 7-2. In this case the background signal is moved in order to avoid interference with the genotype determination. However, the sequence pattern generated will not correspond to the expected sequence pattern, which will affect the quality score. In such a case, it might be possible to exclude the background peak from the overall quality assessment by reducing the Quality window under Analysis criteria General, and/or removing (a) reference peak(s) by right-clicking in the Pyrogram and editing the reference peaks. A B C Figure 7-2. If background affects the SNP position it is in some cases possible to move the background by changing the dispensation order. Thereby, the genotype can be scored despite the background. (A), A heterozygous T/C sample run with the dispensation order suggested by the software. The SNP position is boxed. Background is seen in the T peak (arrow), which should be of the same height as the neighboring C peak. (B), An additional T dispensation is included in the dispensation order (arrow). Here, the background is moved from the SNP position making the genotype scoring easier. (C), Template only, run as a control explains the background Removing sequencing primer dimers causing unwanted background signals Sequencing primers forming dimers and other secondary structures with 5 overhangs, see Figure 7-3, can easily become starting sites for nucleotide incorporation by the DNA polymerase. In order to avoid this cause of background, it is always important to check for these possibilities when designing the sequencing primer. In cases where redesigning of the primer is impossible, another approach to solve the problem can be used. This approach involves an additional step in the sample preparation protocol for magnetic beads, included after annealing. Instead of placing the plate into the instrument, the beads are caught with the magnetic sample preparation tool once again and moved to 40 µl of fresh 1X Annealing buffer, or transferred back to the filter plate, washed and resuspended in fresh 1X Annealing buffer. The dimers causing background will be left behind/washed away, and will not interfere with the Pyrosequencing reaction, see Figure

4 5 ---GGCGGATCGATGACGAT TAGCAGTAGCTAGGCGG---5 Figure 7-3. Sequencing primers forming dimers with 5 overhangs can easily become starting sites for nucleotide incorporation by the DNA polymerase. A B Figure 7-4. Background caused by the sequencing primer can be avoided by including a simple additional step in the sample preparation. (A), Sample run without extra step. Background can be detected in dispensations indicated with black arrows. (B) Sample run after extra step, i.e., capturing the beads and releasing them in fresh 1X Annealing buffer after the sequencing primer annealing step. The background has disappeared, resulting in a more comprehensible pyrogram. (C) Sequencing primer only, run as control, showing the cause of background. C 4

5 7.1.3 Single-stranded DNA-binding protein Single-stranded DNA-binding protein (SSB) is a protein, which displaces secondary structures formed by the single-stranded DNA template or other mispriming events. SSB can in some cases be included in the Pyrosequencing reaction to decrease the signal strength of spurious peaks interfering with the correct Pyrogram pattern. In practice, 0.55 µg-2.2 µg of SSB is added to the sample after annealing of the sequencing primer. The SSB will then most probably loosen up the secondary structures impeding efficient nucleotide incorporation and displace unspecific binding by e.g. sequencing primers, thus diminishing the sources of background, see Figure 7-5. A B Figure 7-5. SSB can be included in the Pyrosequencing reaction in order to decrease the signal strength of spurious peaks. Here, the effect of SSB is clearly seen when comparing data from reactions lacking SSB (A), and those containing SSB (B). The background is markedly lower when SSB is included in the reaction. The same template was used for both reactions. 5

6 7.1.4 Sequencing in both directions (SQA) In some cases order it may be useful to run a Pyrosequencing reaction in both directions to gather complementary sequence information and further confirm the sequencing output, see Figure 7-6. Sequencing on the complementary strand can, for instance, be useful if it is difficult to call the correct sequence due to a high proportion of spurious peaks. Background peaks may be the result of secondary structures in the single-stranded DNA template, impeding an efficient incorporation of nucleotides. The complementary strand might not form this secondary structure to the same extent and might thus not interfere with the sequencing reaction, giving satisfactory results, see Figure 7-7. A Forward sequence: TATCAGCGTTGGGCTAATATGTTTGATATTT B Reverse sequence: ATATCAAACATATTAGCCCAACGCTGAT Figure 7-6. Pyrosequencing in both directions can be used to confirm the sequencing results. Here, a fragment has been analyzed both in forward (A) and reverse (B). The sequences obtained from both reactions agree perfectly with each other, indicating correct results. 6

7 A Forward sequence: ---ACATCATAAGCCTGATAATGAGCATAAT--- B Reverse sequence: ---ATTATGCTCATTATCATGGCTTATGATG--- Figure 7-7. Sequencing on the complementary strand can also be useful if it is difficult to call the correct sequence due to a high proportion of spurious peaks. Here, the same sequence has been analyzed on both strands. In (A), the forward sequence is clear with even peak heights and no spurious peaks. On the contrary in (B), showing the reverse sequence, a higher proportion of spurious peaks appears, indicated by arrows. Depending on the height of the spurious peaks, they can occasionally be interpreted as true peaks by the software, like the T highlighted and boxed in blue. This sequence also shows more uneven peak heights, as illustrated by the single peaks around dispensation 10 (boxed in black). 7

8 7.2 Troubleshooting overview Low peak signals in Pyrogram If the signal level is low throughout the entire Pyrogram, the problem is usually PCR-related or arises from the biotinylated primers. Putative cause: Template concentration too low. (PCR band on gel fairly weak.) Increase amount of template used for immobilization. 1 8 pmol template is recommended. Optimize PCR. Faulty buffer Make new buffers. Be sure to get correct salt concentration and ph. Biotinylated primer contains free biotin. Free biotin will compete with template for binding to streptavidin on beads. Make sure that your biotinylated primer is HPLC-purified or of equivalent purity. Biotinylated primers in excess in PCR set-up. Decrease primer concentration in PCR reaction. 5 pmol of Unincorporated biotinylated primer will each primer should be sufficient for a 25 µl PCR reaction. compete with template for the streptavidin Increase number of PCR cycles to to consume binding sites on the beads. excess PCR primers. Long template Redesign PCR primers to yield a fragment of 200 bp. Strong PCR product, but in addition strong primer dimer or other unspecific fragments. Redesign PCR primers. Optimize PCR. All beads are not transferred from the filter plate to the PSQ 96 plate. Single-stranded DNA-binding protein (SSB) has been used. Reagents incorrectly diluted or incorrectly stored. Make sure all beads are transferred to the PSQ 96 plate. When using filter plates, check that the vacuum manifold is not providing too much vacuum resulting in the beads sticking to the filter and not resuspending properly. Colored beads can be used to deduce if the bead transfer is efficient or not. When using the Vacuum Prep Tool, make sure beads are not left in the PCR plate used for immobilization. After releasing beads in the PSQ plate, check if beads are left in the PCR plate. In that case, add MilliQ water to the wells, capture the leftover beads and go through the protocol again. Decrease the amount of SSB Increase the amount of template. Enzyme and substrate should each be dissolved in 620 µl MilliQ water. Dissolved solutions are stable for 5 days if kept at +4 C. 8

9 7.2.2 Background peaks in Pyrogram Putative cause: Template strand can form secondary structures, which allow extension from the 3 end. Primer dimer formation resulting in stable 5 overhangs, which can serve as template for extension. Unspecific annealing of sequencing primer to template. Unspecific priming of biotinylated primer to template. Run template only as a control to deduce possible template background. If possible, redesign primers to avoid secondary structure. If template background interferes with SNP position, alter dispensation order and move template background, if possible. Run sequencing primer only, negative PCR sample, and sequencing primer + biotinylated primer as controls to detect possible background. If possible, redesign primers to avoid primer dimer formation. Sequencing primer dimers can be removed from the sequencing reaction by including an extra template preparation step. This is done by capturing the template strands with the sample prep tool after the annealing and moving to fresh 1X Annealing buffer before sequencing. Redesign primers. Use as low primer concentration as possible in PCR reaction to avoid excess primer. Redesign primers. Non-homogenous sample. Prepare new template Faulty reference pattern in Pyrogram Unexpected peaks in a Pyrogram can occur for the same reasons as background peaks (see above). In addition the following can cause an incorrect reference pattern: Putative cause: Faulty sequence to analyze entered in the SNP Samples can be saved and re-run by Entry, resulting in inappropriate dispensation repeating the sample preparation steps order. and starting a run with a new dispensation order. Signals will in this case be somewhat reduced. Unknown SNP position in fragment resulting in, Samples can be saved and re-run by for the sample, inappropriate dispensation repeating the sample preparation steps order. and starting a run with a new dispensation order. Signals will in this case be somewhat reduced. Secondary structure formation of the template. Use Single-Stranded DNA Binding protein (SSB). For SQA applications, use the SQA+ kits, which come with SSB included. 9

10 7.2.4 Dispensation problems Manifestation: Split peaks. Peaks appearing in between Cartridge needle is blocked. Clean cartridge. dispensations. Erroneous sequence pattern Cartridge needle is damaged. Replace cartridge. and peak heights, see Figure 7-8. Coating on cartridge is worn out causing a droplet to stick to the outside of the needle. Droplets can fall down at any time and result in faulty dispensation. Change cartridge. Cartridge needles are not completely dry after cleaning. Nucleotide droplets can be caught at tip of needle and might fall down at any time. Check needles for water droplets before use. Reagent cartridge cover not properly closed causing pressure leakage. Be sure to close cover carefully. Faulty reagent cartridge filling. Gasket is not tight causing pressure leakage. This results in faulty dispensation. Contact Pyrosequencing AB. Signals cease in the middle of a run. Cartridge needle is blocked or damaged, causing a dispensation error. Clean the cartridge. If very high signals (> 100 rlu) or substrate peaks are obtained the substrate may have been depleted at the end of the sequencing run. No signals in wells at bottom of plate (G and H rows; note that dispensation is done in a zigzag manner). Enzyme and/or substrate mix ran out at the end of the dispensation cycle. Incorrect Instrument parameters (pulse time settings) have been used, or reagents have been erroneously prepared. Use pulse time settings as indicated on the cartridge and be sure to use 620 µl of each mixture for a full plate. Avoid vigorous mixing of the solutions. Figure 7-8. Dispensation errors can result in erroneous Pyrogram patterns. Here, a C dispensation has failed, indicated by the arrow. This is clear since the next C dispensation generates a full peak without being preceded by any incorporation of either A, T or G. Thus, the sequence is waiting for a C in order to continue to elongate. 10

11 7.2.5 Wide peaks Putative cause: Too much template. Decrease amount of template used for immobilization. Secondary structures in template decrease performance of the DNA polymerase. Use single-stranded DNA-binding protein (SSB). For SQA applications, use the SQA+ kits, which come with SSB included. Too much beads Decrease the amount of beads. Faulty 1X Annealing buffer. (Gives low signals Make new buffer. Be sure to get correct salt and wide peaks.) concentration and ph. Reagents incorrectly diluted or incorrectly Enzyme and substrate should each be dissolved stored. in 620 µl MilliQ water. Dissolved solutions are stable 5 days if kept at +4 C Other problems Problem: High substrate peaks. Pyrophosphate or datp/atp contamination in sample or in buffer. PCR reaction generates large amounts of pyrophosphate, which might be carried over to the sequencing reaction. Use recommended sample preparation protocols. If buffer is the source of contamination (usually resulting in all samples giving high substrate peaks), make new buffer. Nucleotide contamination from sample. Will also result in un-synchronized primer extension. Use recommended sample preparation protocol. Note: This usually does not affect the quality of the results. Drifting baseline CCD camera temperature is not sufficiently stable. Let instrument warm up minutes. Large variation in ambient temperature. Make sure the ambient room temperature is within the range C. Peaks appearing in between High signal in a well, resulting in cross-talk between dispensations. neighboring wells. Mis-aligned camera. Camera calibration might be necessary. Contact Pyrosequencing AB. GLOBAL TECHNICAL SUPPORT: PHONE FAX techsupport.se@pyrosequencing.com US TECHNICAL SUPPORT: PHONE FAX techsupport.us@pyrosequencing.com PYROSEQUENCING AB VALLONGATAN 1, SE UPPSALA, SWEDEN PHONE , FAX