Supplementary Methods

Transcription

1 Supplementary Methods Generation of high-affinity DNA aptamers using an expanded genetic alphabet Michiko Kimoto 1,2, Rie Yamashige 1, Ken-ichiro Matsunaga 1, Shigeyuki Yokoyama 1, & Ichiro Hirao 1,2,* 1 RIKEN Systems and Structural Biology Center (SSBC), Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa , Japan. 2 TagCyx Biotechnologies, Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa , Japan. *Correspondence to: ihirao@riken.jp 1

2 Methods Chemical and enzymatic probing. For chemical and enzymatic probing, DNA aptamers, VGd1-2Ds-47 and IFd1-3Ds-49, were 5 -end labeled with 32 P by [γ- 32 P]ATP (Perkin Elmer) and T4 polynucleotide kinase (Takara), and were purified by gel electrophoresis. Each aptamer in phosphate buffer (1 PBS, Life Technologies, 1 mm KH 2 PO 4, 3 mm Na 2 HPO 4, 155 mm NaCl, ph 7.4) was denatured at 95ºC, cooled down slowly at room temperature, and placed on ice for at least 5 min. The DNA solution (43.2 µl) was mixed with 25 ng/ml Escherichia coli trna (10.8 µl) (Sigma-Aldrich) in PBS. The DNA solution (5.4 µl) was incubated with a target protein (3.6 µl, 1 µm VEGF-165 or 6 µm IFN-γ), for at least 10 min (for VEGF-165) or 1 h (for IFN-γ) at room temperature in 1 PBS, and then chemically and enzymatically probed as follows. For the DMS reaction, 1 µl of DMS (Nacalai Tesque, freshly diluted 200-fold with water) was added, and the mixture was incubated for 8 min at room temperature. For the KMnO 4 reaction, 1 µl of 1 mm KMnO 4 (Nacalai Tesque, 300 mm stock solution freshly diluted with water) was added, and the mixture was incubated for 1 min (for VEGF-165) or 8 min (for IFN-γ) at room temperature. For the G+A reaction (without a target protein only), 1 µl of 1 M piperidinium formate (ph 2.0) was added, and the mixture was incubated at 65ºC for 5 min. Each reaction was terminated by adding 30 µl of stop solution (1 M sodium acetate, 0.67 M 2-mercaptoethanol, and 1.67 ng/µl glycogen) and 90 µl of ethanol. After ethanol precipitation, each sample was dissolved in 50 µl of 1.1 M pyrrolidine, heated at 90 ºC for 10 min, and dried in a Speed-Vac. The sample was suspended in 25 µl of water and dried two more times. After the final drying step, the sample was dissolved in 23 µl of loading solution (1:1 mixture of 1 PBS and 10 M urea in 1 TBE, containing BPB tracking dye). For enzymatic probing, 9 µl of solution was mixed with 1 µl of 10 Mung Bean buffer (Takara) and 1 µl Mung Bean nuclease (Takara, 2 U/µl, diluted by water), and the mixture was incubated at room temperature for 30 min. The reaction was stopped by adding 0.5 µl of 0.5 M EDTA and 12.5 µl of 10 M urea in 1 TBE. The digested samples were fractionated on a 10% polyacrylamide gel containing 7 M urea, and the digested bands were detected with an FLA-7000 imager (Fujifilm). The intensities of the bands were quantitated, using the profile measure mode with the MultiGauge software (Fujifilm). 2

3 Supplementary Figure 1: SPR analysis of 57-mer DNA aptamers against VEGF-165. The sequences used in this study are shown in Supplementary Table 5. The DNA immobilization was performed by injecting 25 nm DNA solution for 1 min (a) and (b) or 0.5 nm DNA solution for about 1 min (c), at a flow rate of 5 µl min -1. SPR conditions for (a) and (b): flow rate = 30 µl/min, injection period of VEGF-165 = 300 sec, dissociation period for monitoring = 600 sec. SPR conditions for (c): flow rate = 100 µl/min, injection period of VEGF-165 = 150 sec, dissociation period for monitoring = 450 sec. 3

4 Supplementary Figure 2: SPR analysis of 57-mer DNA aptamers against IFN-γ. The sequences used in this study are shown in Supplementary Table 5. The DNA immobilization was performed by injecting 25 nm DNA solution for 1 min (a) and (c) or 0.5 nm DNA solution for 4 min (b), at a flow rate of 5 µl min -1. SPR conditions for (a) and (c): flow rate = 30 µl/min, injection period of IFN-γ (2.5, 5, 10, 20, 30, and 50 nm for IF7aDs-57; 2.5 to 30 nm for the others) = 300 sec, dissociation period for monitoring = 600 sec. SPR conditions for (b): flow rate = 100 µl/min, injection period of IFN-γ = 150 sec, dissociation period for monitoring = 450 sec. 4

5 Supplementary Figure 3: SPR analyses of 72-mer DNA aptamers against VEGF-165 and IFN-γ. The sequences used in this study are shown in Supplementary Table 8. The DNA immobilization was performed by injecting 25 nm DNA solution for 1 min (a) and (c) or 0.5 nm DNA solution for about 1 min (b) or 4 min (d), at a flow rate of 5 µl min -1. SPR conditions for (a) and (c): flow rate = 30 µl/min, injection period of VEGF-165 or IFN-γ = 300 sec, dissociation period for monitoring = 600 sec. SPR conditions for (b) and (d): flow rate = 100 µl/min, injection period of VEGF-165 or IFN-γ = 150 sec, dissociation period for monitoring = 450 sec. 5

6 Supplementary Figure 4: Sequences obtained in the doped second selection targeting VEGF-165, and predicted secondary structure of VGd1-2Ds-47. 6

7 (a) The sequences in the 45-nucleotide doped region, obtained after the 4th round of doped selection. Sequences 1 to 50, ranked by each count, are shown. The bases that differ from those in the VG20 sequence (blue letters) are colored (A: green, T: red, G: orange, C: blue). (b) The secondary structure of VGd1-2Ds-47 was predicted from the co-varied nucleobases in sequences obtained in the doped selection. Colored circles indicate the conservation percentage of each base in the total clone number. The lower-case bases belong to the 5 -primer region. The ratios of base pairs (in the putative stem region) or bases (in the putative loop region) are enclosed in boxes. The original base pairs or bases in VG20 are shown in bold. Ratios less than 1% are not shown. 7

8 Supplementary Figure 5: Sequences obtained in the doped second selection targeting IFN-γ, and predicted secondary structure of IFd1-3Ds-49. 8

9 (a) The sequences in the 45-nucleotide doped region, obtained after the 4th round of doped selection. Sequences 1 to 50, ranked by each count, are shown. The bases that differ from those of the IF07b sequence (blue letters) are colored (A: green, T: red, G: orange, C: blue). (b) The secondary structure of IFd1-3Ds-49 was predicted from the co-varied nucleobases in sequences obtained in the doped selection. Colored circles indicate the conservation percentage of each base in the total clone number. The lower-case bases belong to the 5 -primer region. The ratios of base pairs (in the putative stem region) or bases (in the putative loop region) are enclosed in boxes. The original base pairs or bases in IF07b are shown in bold. Ratios less than 1% are not shown. 9

10 Supplementary Figure 6: Chemical and enzymatic probing of VGd1-2Ds-47. Autoradiograph showing the reactivities of VGd1-2Ds-47 towards permanganate, DMS, and Mung Bean nuclease, in the presence and absence of VEGF-165, probed as described in the methods section. Lane 1: control, no probing with permanganate or DMS; lane 2: A/G sequence marker; lane 3: KMnO 4 probing without VEGF-165; lane 4: KMnO 4 probing with VEGF-165; lane 5: DMS probing without VEGF-165; lane 6: DMS probing with VEGF-165; lane 7: Mung Bean nuclease probing without VEGF-165; lane 8: Mung Bean nuclease probing with VEGF-165. The patterns of chemical modification with KMnO 4 and DMS and digestion with Mung Bean nuclease, in the absence and presence of each target protein, are mapped on the predicted secondary structure in Supplementary Figure 4b, by triangles and arrows as indicated. The chemical modification patterns of each position were classified into three groups depending on each band intensity with (I + ) or without (I ) VEGF-165, which was normalized to the band intensity indicated by the black arrow: reduced ([I + ] / [I ] < 0.84), no change (0.84 [I + ] / [I ] 1.5), and enhanced ([I + ] / [I ] >1.5). The sizes of the triangles and arrows reflect their reactivities in the absence of the proteins. 10

11 Supplementary Figure 7: Chemical and enzymatic probing of IFd1-3Ds-49. Autoradiograph showing the reactivities of IFd1-3Ds-49 towards permanganate, DMS, and Mung Bean nuclease, in the presence and absence of IFN-γ, probed as described in the methods section. Lane 1: control, no probing with permanganate or DMS; lane 2: A/G sequence marker; lane 3: KMnO 4 probing without IFN-γ; lane 4: KMnO 4 probing with IFN-γ; lane 5: DMS probing without IFN-γ; lane 6: DMS probing with IFN-γ; lane 7: Mung Bean nuclease probing without IFN-γ; lane 8: Mung Bean nuclease probing with IFN-γ. The patterns of chemical modification with KMnO 4 and DMS and digestion with Mung Bean nuclease, in the absence and presence of each target protein, are mapped on the predicted secondary structure in Supplementary Figure 5b, by triangles and arrows as indicated. The chemical modification patterns of each position were classified into three groups depending on each band intensity with (I + ) or without (I ) IFN-γ, which was normalized to the band intensity indicated by the black arrow: reduced ( [I + ] / [I ] < 0.84), no change (0.84 [I + ] / [I ] 1.5), and enhanced ([I + ] / [I ] >1.5). The sizes of the triangles and arrows reflect their reactivities in the absence of the proteins. 11

12 Supplementary Figure 8: SPR analysis of VGd1-2Ds-47 DNA aptamer and its variants against VEGF-165. The sequences used in this study are shown in Supplementary Table 9. The DNA immobilization was performed by injecting 25 nm DNA solution for 1 min (a) or 0.5 nm DNA solution for about 1 min (b), at a flow rate of 5 µl min -1. SPR conditions for (a): flow rate = 30 µl/min, injection period of VEGF-165 = 300 sec, dissociation period for monitoring = 600 sec. SPR conditions for (b): flow rate = 100 µl/min, injection period of VEGF-165 = 150 sec, dissociation period for monitoring = 450 sec. 12

13 Supplementary Figure 9: SPR analysis of IFd1-3Ds-49 DNA aptamer and its variants against IFN-γ. The sequences used in this study are shown in Supplementary Table 9. The DNA immobilization was performed by injecting 25 nm DNA solution for 1 min (a) or 0.5 nm DNA solution for 4 min (b), at a flow rate of 5 µl min -1. SPR conditions for (a): flow rate = 30 µl/min, injection period of IFN-γ = 300 sec, dissociation period for monitoring = 600 sec. SPR conditions for (b): flow rate = 100 µl/min, injection period of IFN-γ = 150 sec, dissociation period for monitoring = 450 sec. 13

14 Supplementary Figure 10: Thermal stabilities of DNA aptamers and their derivatives. UV melting profiles of VGd1-2Ds-47 (blue, solid line), VGd1-2A-47 (blue, dotted line), IFd1-3Ds-49 (violet, solid line), and IFd1-3A-49 (violet, dotted line) were recorded using a SHIMADZU UV-2450 spectrometer equipped with a temperature controller (TMSPC-8). The absorbance of each sample (2 µm in 1 mm KH 2 PO 4, 3 mm Na 2 HPO 4, and 155 mm NaCl, ph 7.4) was monitored at 260 nm from 5 to 90 C, at a heating rate of 0.5 C/min. Each melting temperature was calculated by the first derivatives of the melting curves, using the IGOR Pro software (WaveMetrics, Inc.). The melting profiles, normalized by the absorbance at 5 C (upper panels), and the first derivatives of absorbance (lower panels) are shown. 14

15 Supplementary Figure 11: Binding specificity of DNA aptamers to different proteins. The sequences used in this study are shown in Supplementary Tables 5, 7 and 8. The DNA immobilization was performed by injecting 25 nm DNA solution for 1 min, at a flow rate of 5 µl min -1. SPR conditions: flow rate = 30 µl/min, injection period of each protein = 300 sec, dissociation period for monitoring = 600 sec. 15

16 Supplementary Table 1: DNA sublibraries, PCR primers, and competitors used in SELEX. For the DNA sublibraries N43Ds-01 to N43Ds-22, each recognition tag sequence (underlined) and the randomized region containing Ds (red) at predetermined positions are shown. In each DNA sublibrary, the tag and the randomized region are flanked by the 5 -primer (5 -CTGTCAATCGATCGTATCAGTCCAC-3 ) and 3 -primer sequences (5 -GCATGACTCGAACGGATTAGTGACTAC- 3 ). The length of the library is 97- or 98 mer. Primers, 5 -fwd25 and 3 -T15-L-rev29, were used for asymmetric PCR amplification to prepare the selection library. For the synthesis of 3 -T15-L-rev29, Spacer C12 Phosphoramidite (Glen Research) was used. Primers 5 -fwd27 and 3 -rev29 were used to prepare the library for deep sequencing. contvg and contif are anti-vegf-165 and anti-ifn-γ DNA aptamers, respectively, and each was used as a competitor in SELEX. In the doped libraries, VGd-2Ds-96 and IFd-3Ds-94, the sequences shown in lower case comprised 55% of the original natural bases and 15% each of the other three natural bases, and those shown in upper case were constant sequences. Name N43Ds-01 N43Ds-02 N43Ds-03 N43Ds-04 N43Ds-05 N43Ds-06 N43Ds-07 N43Ds-08 N43Ds-09 N43Ds-10 N43Ds-11 N43Ds-12 N43Ds-13 N43Ds-14 N43Ds-15 N43Ds-16 N43Ds-17 N43Ds-18 N43Ds-19 N43Ds-20 N43Ds-21 Sequence 5 -AANNNNNNNNNNNNNDsNNNNNNNNNNNNNNNNNNNNNNNNNNNNN-3 5 -ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNDsNNNNNNNNNNNNNN-3 5 -AGNNNNNNNNNNNNNNNNDsNNNNNNNNNNNNNNNDsNNNNNNNNNN-3 5 -TANNNNNNNNNNDsNNNNNNNNNNNNNNNDsNNNNNNNNNNNNNNNN-3 5 -TTNNNNNNNNNNDsNNNNNNNDsNNNNNNNNNNNNNNNNNNNNNNNN-3 5 -TGNNNNNNNNNNNNNNNNNNNNNNNNDsNNNNNNNDsNNNNNNNNNN-3 5 -TCNNNNNNNNNNDsNNNNNNNNNNDsNNNNNNNNNNDsNNNNNNNNNN-3 5 -GANNNNNNNNNNNNNNNNNNDsNNNNNNNNNDsNNNNNNDsNNNNNNN-3 5 -GTNNNNNNNDsNNNNNNDsNNNNNNNNNDsNNNNNNNNNNNNNNNNNN-3 5 -CANNNNNNNNNNNDsNNNNNNNNNDsNNNNNNNNNNNNNDsNNNNNNN-3 5 -CTNNNNNNNNNNNDsNNNNNNNNNNNNNDsNNNNNNNNNDsNNNNNNN-3 5 -CAGNNNNNNNNNDsNNNNNNNNNNNNNNNNDsNNNNNNDsNNNNNNNNN-3 5 -CATNNNNNNNNNDsNNNNNNDsNNNNNNDsNNNNNNNNNNNNNNNNNNN-3 5 -TATNNNNNNNNNNNNNNNNDsNNNNNNDsNNNNNNDsNNNNNNNNNNNN-3 5 -TTANNNNNNNNNNNNNNNNDsNNNNNNDsNNNNNNNNNDsNNNNNNNNN-3 5 -GCTNNNNNNNNNNNNNNNNNNNNNNNDsNNNNDsNNNNNNNNNNNNNN-3 5 -CCANNNNNNNNNNNNNNNNNNNNNNDsNNNNNDsNNNNNNNNNNNNNN-3 5 -CCTNNNNNNNNNNNNNNNNNNNNNDsNNNNNNDsNNNNNNNNNNNNNN-3 5 -GGANNNNNNNNNNNNNNNNNNNNDsNNNNNNNDsNNNNNNNNNNNNNN-3 5 -GGTNNNNNNNNNNNNNNNNNNNDsNNNNNNNNDsNNNNNNNNNNNNNN-3 5 -CGANNNNNNNNNNNNNNNNNNDsNNNNNNNNNDsNNNNNNNNNNNNNN-3 16

17 N43Ds fwd27 3 -T15-L rev29 contvg contif VGd-2Ds-96 IFd-3Ds CGTNNNNNNNNNNNNNNNNNNDsNNNNNNNNNNDsNNNNNNNNNNNNN-3 5 -TTCTGTCAATCGATCGTATCAGTCCAC-3 5 -TTTTTTTTTTTTTTT-C12spacer-AAGTAGTCACTAATCCGTTCGAGTCATGC-3 5 -AAGTAGTCACTAATCCGTTCGAGTCATGC-3 5 -GCCCGTCTTCCAGACAAGAGTGCAGGGC-3 5 -GGGGTTGGTTGTGTTGGGTGTTGTGT-3 5 -CTGTCAATCGATCGTATCAGTCCACGgtaaactgagtccgaaggggcDstgcagtgaDscccgaatgggtccg GCATGACTCGAACGGATTAGTGACT-3 5 -TGTCAATCGATCGTATCAGTCCACtcgggtcgtttaDstaatgtaggtDstgggctaggcDsgctagtggat GCATGACTCGAACGGATTAGTGACT-3 17

18 Supplementary Table 2: In vitro selection conditions. The conditions for the first selection using DNA libraries containing Ds at predetermined positions, the selection using a DNA library comprising natural bases only, and the 2nd doped selection are summarized. Library Round [DNA] (nm) [Protein] (nm) [Competitor] (nm) Volume (ml) Number of washes Without urea With 3 M urea PCR cycle (the Ds-containing library) VEGF -165 IFN-γ PCR cycles (the natural base library) VEGF -165 Random Doped IFN-γ 18

19 Supplementary Table 3: Sequences of the tag and random regions of each clone selected after seven rounds of selection targeting VEGF-165, using the Ds-containing library. Total counts are the numbers of total reads obtained by deep sequencing. Extracted counts are the numbers obtained by subtracting the clones with incorrect lengths from the total counts. Each clone listed in the table appeared more than 100 times in the extracted sequences. X is the pre-determined Ds position. The sequence that was further optimized through the doped selection is highlighted in yellow. Selected clones Counts Recognition tag-n 43 sequences K D (pm) a X = Ds X = A Total 150,364 Extracted 92,613 N43Ds-02 43,717 at-n 28 -X-N 14 VG02a 10,570 atcgagcgtgaggtccgaaaggcgactcttxtaacatcaagtaat 2,640 n.d. b VG02b 1,299 atacgcgggggtgttgaagggttagtcggaxgtagtgtgtacaga N43Ds-01 36,833 aa-n 13-X-N 29 VG01 16,555 aaagtgctgggtccgxatggcggggggttaggcctctttggggcg aatcgcggttccgtgxtggcgggtgaaggttatggtttggtgtgg N43Ds-20 9,017 ggt-n 19-X-N 8-X-N 14 VG20 7,385 ggtaaactgagtccgaaggggcxtgcagtgaxcccgaatgggtccg ggtgaatccggcagagatcactxtacgcttgxtgcctctttaattc 121 ggtttaggcgtctttagggggtxgaggtcggxttttaccgcggtgt N43Ds-08 1,463 ga-n 18-X-N 9-X-N 6-X-N 7 VG gagatggatggtagtggccgxacgggggggxtggagaxgctggct 326 n.d. b N43Ds cga-n 18-X-N 9-X-N cgattccttatcctaggacttxtttccgcgcxcacgtgctcagatt 130 cgatttgggggtggggcggggxccgtgatggxgatgaaggtgggcg N43Ds cat-n 9-X-N 6-X-N 6-X-N catggagggccgxatggccxgacactxgaccgtgcgagatggttgg N43Ds tta-n 16-X-N 6-X-N 9-X-N ttatgcgggtgggagcaccxtcgacaxttgcgtccgxatggccaga a K D values were determined by SPR using the 57-mer oligonucleotides, listed in Supplementary Table 5. Their sensorgrams are shown in Supplementary Figure 1. b Not determined. 19

20 Supplementary Table 4: Sequences of the tag and random regions of each clone selected after seven rounds of selection targeting IFN-γ, using the Ds-containing library. Total counts are the numbers of total reads obtained by deep sequencing. Extracted counts are the numbers obtained by subtracting the clones with incorrect lengths from the total counts. Each clone listed in the table appeared more than 100 times in the extracted sequences. X is the pre-determined Ds position. The sequence that was further optimized through the doped selection is highlighted in yellow. Selected K D (nm) a Counts Recognition tag-n clones 43 sequences X = Ds X = A Total 51,461 Extracted 21,242 N43Ds-07 13,768 tc-n 10-X-N 10-X-N 10-X-N 10 IF07a 5,688 tccttctgtcatxgggcaggcgcxtttggtgtagxgtttatcttg IF07b 4,965 tcgggtcgtttaxtaatgtaggtxtgggctaggcxgctagtggat N43Ds-11 5,195 ct-n 11-X-N 13-X-N 9-X-N 7 IF11 4,508 ctatgtgggttggxtggggtgtatgttxgtagggctaxggaggtg N43Ds at-n 28 -X-N 14 IF attggacttagcccagcaagacaatctacgxtatgccagaagttg > 500 n.d. b N43Ds aa-n 13 -X-N aaagttagggactgaxccctttccgtgaagcgtggagggacgata 160 aatgcgaggtacgagxagggtttgggttggcggggccattgtagt N43Ds ta-n 10 -X-N 15 -X-N 16 IF taatcaggaagaxgatagggtttgtcttxtgttgccacgctggga > 500 n.d. b N43Ds ag-n 16 -X-N 15 -X-N aggctatcattcgcgttcxggtttgattggttctxggaggggtgg a K D values were determined by SPR using the 57-mer oligonucleotides, listed in Supplementary Table 5. Their sensorgrams are shown in Supplementary Figure 2. b Not determined. 20

21 Supplementary Table 5: Oligonucleotide sequences used in SPR for binding analysis of aptamers obtained from the Ds-containing library. The sequences derived from the primer regions are shown in lower case. The sequences of contvg and contif are italicized and underlined. The Ds positions and the substitutions from Ds to A are shown in red and blue, respectively. For the synthesis of 5 -biotinylated oligonucleotides, Biotin-dT phosphoramidite (Glen Research) was used. 3 - Biotinylated oligonucleotides were purchased from Invitrogen (Japan). Name VG02aDs-57 VG02aA-57 VG02bDs-57 VG02bA-57 VG01Ds-57 VG01A-57 VG20Ds-57 VG20A-57 VG08Ds-57 VG08A-57 IF07aDs-57 IF07aA-57 IF07bDs-57 IF07bA-57 IF11Ds-57 IF11A-57 IF02Ds-57 IF02A-57 IF04Ds-57 IF04A-57 contvg-57 contif-57 Random-57 contif-26 Sequence 5 -(biotin-dt)-atcagtccacatcgagcgtgaggtccgaaaggcgactcttdstaacatcaagtaatg-3 5 -(biotin-dt)-atcagtccacatcgagcgtgaggtccgaaaggcgactcttataacatcaagtaatg-3 5 -(biotin-dt)-atcagtccacatacgcgggggtgttgaagggttagtcggadsgtagtgtgtacagag-3 5 -(biotin-dt)-atcagtccacatacgcgggggtgttgaagggttagtcggaagtagtgtgtacagag-3 5 -(biotin-dt)-atcagtccacaaagtgctgggtccgdsatggcggggggttaggcctctttggggcgg-3 5 -(biotin-dt)-atcagtccacaaagtgctgggtccgaatggcggggggttaggcctctttggggcgg-3 5 -(biotin-dt)-tcagtccacggtaaactgagtccgaaggggcdstgcagtgadscccgaatgggtccgg-3 5 -(biotin-dt)-tcagtccacggtaaactgagtccgaaggggcatgcagtgaacccgaatgggtccgg-3 5 -(biotin-dt)-atcagtccacgagatggatggtagtggccgdsacgggggggdstggagadsgctggctg-3 5 -(biotin-dt)-atcagtccacgagatggatggtagtggccgaacgggggggatggagaagctggctg-3 5 -(biotin-dt)-atcagtccactccttctgtcatdsgggcaggcgcdstttggtgtagdsgtttatcttgg-3 5 -(biotin-dt)-atcagtccactccttctgtcatagggcaggcgcatttggtgtagagtttatcttgg-3 5 -(biotin-dt)-atcagtccactcgggtcgtttadstaatgtaggtdstgggctaggcdsgctagtggatg-3 5 -(biotin-dt)-atcagtccactcgggtcgtttaataatgtaggtatgggctaggcagctagtggatg-3 5 -(biotin-dt)-atcagtccacctatgtgggttggdstggggtgtatgttdsgtagggctadsggaggtgg-3 5 -(biotin-dt)-atcagtccacctatgtgggttggatggggtgtatgttagtagggctaaggaggtgg-3 5 -(biotin-dt)-atcagtccacattggacttagcccagcaagacaatctacgdstatgccagaagttgg-3 5 -(biotin-dt)-atcagtccacattggacttagcccagcaagacaatctacgatatgccagaagttgg-3 5 -(biotin-dt)-atcagtccactaatcaggaagadsgatagggtttgtcttdstgttgccacgctgggag-3 5 -(biotin-dt)-atcagtccactaatcaggaagaagatagggtttgtcttatgttgccacgctgggag-3 5 -(biotin-dt)-tctgtcaatcgatcgtatcagtccacaagcccgtcttccagacaagagtgcagggc-3 5 -(biotin-dt)-ttctgtcaatcgatcgtatcagtccacaatggggttggttgtgttgggtgttgtgt-3 5 -(biotin-dt)-atcagtccacaatgctagagcattgcgtagaagcttgatatgttgctggcccggac-3 5 -GGGGTTGGTTGTGTTGGGTGTTGTGT-biotin-3 21

22 Supplementary Table 6: Sequences of the tag and random regions of each clone selected after seven rounds of the selection targeting IFN-γ, using the Ds-containing library without a competitor. Total counts are the numbers of total reads obtained by deep sequencing. Extracted counts are the numbers obtained by subtracting the clones with incorrect lengths from the total counts. Each clone listed in the table appeared more than 1,000 times in the extracted sequences or in Supplementary Table 4. X is the pre-determined Ds position. Selected clones Counts Recognition tag-n 43 sequences Total 366,893 Extracted 219,378 N43Ds ,024 tc-n 10 -X-N 10 -X-N 10 -X-N 10 IF07a 124,034 tccttctgtcatxgggcaggcgcxtttggtgtagxgtttatcttg 15,992 tccttcagtcatxgggcaggcgcxtttggtgtagxgtttatcttg 1,409 tccgtctgtcatxgggcaggcgcxtttggtgtagxgtttatcttg IF07b 20,034 tcgggtcgtttaxtaatgtaggtxtgggctaggcxgctagtggat N43Ds-20 11,810 ggt-n 19 -X-N 8 -X-N 14 8,239 ggttagggcaagggttgtggcgxgtggaatgxatgtcagatgcgaa 1,631 ggttagggcatgggttgtggcgxgtggaatgxatgtcagatgcgaa N43Ds-11 9,773 ct-n 11 -X-N 13 -X-N 9 -X-N 7 IF11 7,904 ctatgtgggttggxtggggtgtatgttxgtagggctaxggaggtg N43Ds-01 16,253 aa-n 13 -X-N 29 IF01a 5,614 aaagttagggactgaxccctttccgtgaagcgtggagggacgata 3,073 aagcggggtgggggcxttggggtgggcgggctgaaggactgtggc Others listed in Supplementary Table 4 IF01b IF02 IF04 IF03 2,045 aagcggggtgggggcxttggggtgggcgggctgaaggactatggc 1,029 aagcggggtgggggcxttggggtgggtgggctgaaggactgtggc aatgcgaggtacgagxagggtttgggttggcggggccattgtagt attggacttagcccagcaagacaatctacgxtatgccagaagttg taatcaggaagaxgatagggtttgtcttxtgttgccacgctggga aggctatcattcgcgttcxggtttgattggttctxggaggggtgg 22

23 Supplementary Table 7: Sequences of the tag and random regions of each clone selected after seven rounds of selection targeting VEGF-165 and IFN-γ, using the natural base library. Total counts are the numbers of total reads obtained by deep sequencing. Extracted counts are the numbers obtained by subtracting the clones with incorrect lengths from the total counts. Each clone listed in the table appeared more than 100 times in the extracted sequences. Target Selected clones Counts Recognition tag (aa)-n 43 sequences VEGF-165 Total 159,458 Extracted 51,174 VGcont-n01a 23,595 aagattgagggtggtgtccggatgggggggtaggtatgagcttgt VGcontVG-n01b 22,649 aagattggagggtggtgtccggatggggggtaggtatgagcttgt VGcontVG-n01c 791 aagattgagggtggcgtccggatgggggggtaggtatgagcttgt VGcontVG-n01d 631 aaggattgagggtggtgtccggatggggggtaggtatgagcttgt VGcontVG-n01e 148 aatgattgagggtggtgtccggatggggggtaggtatgagcttgt VGcontVG-n05f 100 aagattgagggtggtggtccggatggggggtaggtatgagcttgt VGcont-n02 1,859 aaatttgtgggcggcttattttgggtccggatggcggtgggcttg VGcont-n aaacgggaccgcggggggggtgggtggtagtcggaggtctcatgt IFN-γ Total 187,210 Extracted 30,818 IFcont-n01a 20,107 aatgacgcaaggggcatgagtggacggttaggtgccctgtgttca IFcont-n01b 4,408 aatgacgcaagggggcatgagtggacggttaggtgcctgtgttca IFcont-n01c 1,737 aaagagacgaatgtcatcagtggacggtgaggtgccctgtgttca IFcont-n01d 188 aatgacgcaaggggcatgagtgggacggttaggtgcctgtgttca IFcont-n01e 141 aaagagaacgaatgtcatcagtggacggtgaggtgcctgtgttca IFcont-n01f 101 aatgacgcaagggggatgagtggacggttaggtgccctgtgttca IFcont-n aattgtgattcgacgataaatgttagggggttggttttgggttgg IFcont-n aagtaacactttgacattatcgatttcgttaggcgtatgatgaca IFcont-n aatccgatctgagtcattatatactaggggggtggttttgggctg IFcont-n aaggcggttgcagtcatgtgttgtcgggggctggggttgggtttg IFcont-n aaaggtttgagagtcatgcccggttggggagaggtgggtttgggt. 23

24 Supplementary Table 8: Oligonucleotide sequences used in SPR for binding analyses of aptamers obtained from the natural base library. The sequences derived from the primer regions are shown in lower case. For the synthesis of 5 - biotinylated oligonucleotides, Biotin-dT phosphoramidite (Glen Research) was used. Name VGcont-n01a-72 VGcont-n02-72 VGcont-n03-72 IFcont-n01a-72 IFcont-n02-72 IFcont-n03-72 Sequence 5 -(biotin-dt)- tgtcaatcgatcgtatcagtccacaagattgagggtggtgtccggatgggggggtaggtatgagcttgtgc-3 5 -(biotin-dt)- tcgtatcagtccacaaatttgtgggcggcttattttgggtccggatggcggtgggcttggcatgactcgaa-3 5 -(biotin-dt)- gatcgtatcagtccacaaacgggaccgcggggggggtgggtggtagtcggaggtctcatgtgcatgactcg-3 5 -(biotin-dt)- atcagtccacaatgacgcaaggggcatgagtggacggttaggtgccctgtgttcagcatgactcgaacgga-3 5 -(biotin-dt)- gtcaatcgatcgtatcagtccacaattgtgattcgacgataaatgttagggggttggttttgggttgggca-3 5 -(biotin-dt)- ctgtcaatcgatcgtatcagtccacaagtaacactttgacattatcgatttcgttaggcgtatgatgacag-3 24

25 Supplementary Table 9: Oligonucleotide sequences used in SPR for binding analyses of VG1d-2Ds-47 and IFd1-3Ds-49 aptamers and their derivatives. The sequences derived from the primer regions are shown in lower case. The sequence of contvg is italicized and underlined. The Ds positions and the substitutions from Ds to A are shown in red and blue, respectively. For the synthesis of 5 -biotinylated oligonucleotides, 5 -biotin phosphoramidite (Glen Research) was used. Name VGd1-2Ds-47 VGd1-2A-47 VGd1-DsA-47 VGd1-ADs-47 VG20Ds-47 VGd1-2Ds-45 VGd1-2Ds-41 VGd1-2Ds-36 VGd1-2Ds-41b VGd1-2Ds-36b contvg-47 IFd1-3Ds-49 IFd1-ADsDs-49 IFd1-DsADs-49 IFd1-DsDsA-49 IFd1-3A-49 IFd1-3Ds-45 IF07bDs-45 Random-49 Sequence 5 -biotin-cggtaaactgcgtccgaaggggcdstgcagtgadscccgaatgggtccg-3 5 -biotin-cggtaaactgcgtccgaaggggcatgcagtgaacccgaatgggtccg-3 5 -biotin-cggtaaactgcgtccgaaggggcdstgcagtgaacccgaatgggtccg-3 5 -biotin-cggtaaactgcgtccgaaggggcatgcagtgadscccgaatgggtccg-3 5 -biotin-cggtaaactgagtccgaaggggcdstgcagtgadscccgaatgggtccg-3 5 -biotin-gtaaactgcgtccgaaggggcdstgcagtgadscccgaatgggtccg-3 5 -biotin-actgcgtccgaaggggcdstgcagtgadscccgaatgggtccg-3 5 -biotin-gtccgaaggggcdstgcagtgadscccgaatgggtccg-3 5 -biotin-gtaaactgcgtccgaaggggcdstgcagtgadscccgaatggg-3 5 -biotin-gtaaactgcgtccgaaggggcdstgcagtgadscccga-3 5 -biotin-cgatcgtatcagtccacaagcccgtcttccagacaagagtgcagggc-3 5 -biotin-tccactcgggtcatttadstaatgtaggtdstgggctaggcdsgctagtgga-3 5 -biotin-tccatcgggtcatttaataatgtaggtdstgggctaggcdsgctagtggat-3 5 -biotin-tccatcgggtcatttadstaatgtaggtatgggctaggcdsgctagtggat-3 5 -biotin-tccatcgggtcatttadstaatgtaggtdstgggctaggcagctagtggat-3 5 -biotin-tccatcgggtcatttaataatgtaggtatgggctaggcagctagtggat-3 5 -biotin-tcgggtcatttadstaatgtaggtdstgggctaggcdsgctagtggat-3 5 -biotin-tcgggtcgtttadstaatgtaggtdstgggctaggcdsgctagtggat-3 5 -biotin-cacaatgctagagcattgcgtagaagcttgatatgttgctggcccggac-3 25