BSCI410-Liu/Spring 09/Feb 26 Exam #1 Your name:

Transcription

1 1. (20 points) Give the name of a mutagen that could cause the following damages to DNA: a) Thymidine dimers UV b) Breakage of DNA backbone X-Ray c) 2 bp insertion (frameshift mutation) proflavin, acridine orange, ethidium bromide d) Transition (C to T change) nitrous acid, EMS e) 8 bp insertion which is a repeat of adjacent endogenous sequence Ac/Ds transposon 2. (20 points) a) Describe steps in mutagenizing and identifying bacterial E. coli mutants defective in the synthesis of cytosine. 1) Mutagenize E. coli with EMS, X-ray, proflavin, etc 2) Grow on complete media 3) Replica onto a) minimal media -die b) minimal media + cytosine grow - mutants b) From this mutagenesis, five mutants (named c9, c10, c14, c18, c21) were identified and they each were found to mutate a different gene. Feeding experiments were done by growing each mutant on minimal medium supplemented by four different known precursors of cytosine (A-D). The results are summarized in the table (+: growth; -: no growth): Precursor/product Mutant A B C D Cytosine c c c c c Show a simple linear biochemical pathway of the four precursors and the end product (cytosine). Indicate which step is blocked by each of the five mutations. c18 c14 c9 c10 c21 _D_B_A_C_cytosine What precursor would accumulate in the following double mutants: c9, c10: B c10, c14: D 1

2 3. (20 points) How do plants tolerate increased temperatures in the summer heat? Amanda conducted an EMS mutagenesis screen of Arabidopsis plants and identified one mutant (named heat resistant (HR)) that showed increased resistance to heat stress (50 degree C) compared with wild type plants. She also identified one other mutant (named heat sensitive (HS)) that is more sensitive to heat than wild type plants. (a) Assuming hr and hs are loss-of-function mutations, are the wild type HR and HS genes involved in promoting or repressing plant's tolerance of heat? HR-repression HS-promotion (b) Using hs as an example, describe a genetic cross to determine whether hs is recessive or dominant. hshs x HSHS: F1 if sensitive to heat, hs is dominant - if WT-like, hs is recessive (c) The two mutations were found to be recessive loss-of-function, not allelic to each other, and appear to act in a linear regulatory pathway that ultimately activates the plant's ability to tolerate heat. The double mutant of hs; hr was found to be more sensitive to heat than wild type, which mutation is epistatic to which? hs is epistatic to hr Could you draw a linear regulatory pathway consisting of HR and HS, ending the pathway with "ability to tolerate heat"? (Use arrows to indicate positive/promoting effect, and use bar ( ) to indicate negative/repressing effect. HR HS_ability to tolerate heat 4. (52 points) Multiple choices. Some questions may have more than one correct answer. (A) Which of the following vectors contain(s) the largest insert? (a) Cosmid; (b) YAC; (c) BAC; (d) plasmid (B) Which of the following is/are required for a cloning vector? (a) DNA replication origin; (b) inverted repeats; (c) antibiotic resistance; (d) a-c 2

3 (C) During PCR amplification, which of the following is/are NOT required? (a) Reverse transcriptase; (b) dntp; (c) Taq polymerase; (d) primers (D) Sanger sequencing is based on: (a) Chemical cleavage; (b) Nucleotide substitution; (c) ddntp-based termination (E) To construct a cdna library, you will need to have: (a) A vector; (b) Reverse transcriptase; (c)mrna; (d) ligase (e) a-d (F) Which of the following mutation(s) is/are likely to cause the most severe damage to the function of the gene? (a) Nonsense mutation; (b) silent mutation; (c) mis-sense mutation (G) Competent cells are cells that are: (a) Capable of dividing; (b) infectious; (c) Able to take up DNA; (d) a-c - I accepted both (c alone) and (a and c) (H) Microsatellites are (a) mutation hot spots; (b) useful DNA polymorphisms to distinguish individuals; (c) repeats of 1-3 nucleotides; (d) all a-c (I) The personal genome project is about (a) sequencing the genomes of Chimps; (b) sequencing individual human DNA at a low cost; (c) Mapping the 500,000 SNPs for genetic diseases. (J) The human genome has (a) 125,000kb; (b) 6 billion bases; (c) 6 million bases; (d) 3,000,000kb (K) A Contig is: (a) Continuous string of DNA; (b) Overlapping pieces of DNA fragment; (c) random DNA pieces (L) T-DNA is: (a) A plant transposon; (b) a piece of DNA from agrobacteria Ti-plasmid; (c) a tool for introducing foreign DNA into plant cells 3

4 (M) Pyrosequencing requires the following basic components for its reaction: (a) Luciferase; (b) primer; (c) apyrase; (d) Taq polymerase; (e) all a-d. 5. (11 points) The following is a sequencing gel. What is the DNA sequence of the synthesized strand? Label 5 and 3. dda ddg ddc ddt (added to each sequencing reaction) 5 -cga tct ggc aca g-3 6. (24 points) You are learning to utilize different molecular tools to accomplish different research goals. Pick one of these techniques (colony screen with antibody, PCR, DNA sequencing, transformation, PCR followed by restriction map (finger printing), Northern blot, cloning) to accomplish each of following goals (some methods will not be used while others will be used more than once). (a) Get enough DNA from a fossil PCR (b) Introduce foreign DNA into E. coli transformation (c) Identify the specific bacterial clone that expresses human insulin protein colony screening with antibody (d) Match the DNA of a suspect with the blood found at the crime scene PCR followed by restriction map (fingerprinting) (e) Insert a piece of DNA into a vector cloning (f) Determine if someone has contracted HIV virus PCR 4

5 7. (24 points) Answer questions: (A) Briefly describe what a cdna library is and what a genomic DNA library is. Highlight the differences (at least 3). genomic: Library collectively containing all genomic pieces of an organism cdna: Library of bacterial cells collectively containing all expressed genes in a given tissue(s). Differences: cdna no introns/promoters, not all genes represented, some genes are represented more than others (proportional to its expression level), made from mrna and reverse transcribed to cdna (B) Explain why the Ds transposon is nonautonomous and why the Ac transposon is autonomous? Ac encodes for its own transposase, and so it can move itself around. Dc has a defective transposase (missing part of the open reading frame), so it can t move on its own. It needs transposase from a different source to move. (C) Briefly explain the biochemical/biological functions of reverse transcriptase and transposase? Which transposable element type encodes the respective enzyme? Reverse transcriptase: transcribes mrna template into cdna. It is encoded by retrotransposon. Transposase: recognizes the inverted repeats on the ends of a transposon, excises it, and inserts it elsewhere in the genome (cut and paste reaction). It is encoded by transposon. (D) What is an intragenic suppressor and what is an extragenic suppressor? Give an example for each type. Intragenic: the second site suppressor mutation occurs in the same gene as the first mutation, restoring the WT phenotype without changing the original mutation. Example: An insertion downstream of a deletion would restore the reading frame. Extragenic: the second site suppressor mutation occurs in a different gene from the first mutation, restoring the WT phenotype without changing the original mutation. Example: a trnamutation suppresses the nonsense mutation of another gene (informational suppressor) 8. (10 points) Translate the following mrna sequence: 5' UUGCAAUGGGCGCGAUAAUACCCCAAGCCUAUAAGUGAAAAUACCAAA3' Start stop Met-Gly-Ala-Ile-Ile-Pro-Gln-Ala-Tyr-Lys 5

6 9. (9 points) A family is undergoing a genetic test. Both mom (lane 1) and dad (lane 2) are carriers (ie. heterozygous) for a genetic disease named "X-syndrome". They have one healthy child (lane 3) and are expecting triplets (lane 4, 5, and 6). It is known that the disease causing allele is associated with a SNP that can be distinguished by restriction enzyme E cori digestion. The DNA from each individual is amplified by PCR with primers that flank the X-syndrome gene. The amplified PCR product is digested with E. cori and then analyzed by electrophoresis. An image of the result is shown. Indicate each of the three new born (4, 5, 6) as carrier, completely healthy, or will suffer from the disease? M suffer from disease, 5-healty, 6-carrier 10. (10 points) The following mutations (a1 to a4) all caused white eyes in Drosophila (wild type has red eyes). The following pairwise crosses (ie homozygous a1 mutant crossed to homozygous a1, a2, a3...) have been performed, and the eye color of F1 progeny is summarized in the table: a1 a2 a3 a4/ a1 White eye White eye Red eye White eye a2/ White eye Red eye White eye a3 White eye Red eye a4 White eye These four mutations belong to (ie affect) how many genes? Which mutant alleles belong to the same complementation group? 2 genes are represented a1, a2, a4 1 gene a3-1 gene 6

7 Honor Code (rewrite, sign, and date below on dotted line) I, (fill in your name), pledge on my honor that I have neither given nor received any unauthorized assistance on this exam. Signature Date 7