Multilocus Sequence Typing - MLST. Characterisation of bacteria. Hospital outbreak of resistant bacteria. Community outbreak of diarrhoea

Transcription

1 Multilocus Sequence Typing - MLST Slides from Andreas Petersen Slide 1 Characterisation of bacteria Hospital outbreak of resistant bacteria Community outbreak of diarrhoea Global spread of respiratory pathogens Distinguishing genetic variations ACCTGATGCCGATAGCCCTATCAGCTAGCTAGCGGCTATCAGCT ACCTGATGCCGATAGCCCTATTAGCTAGCTAGCGGCTATCAGCT Slide 2 1

2 Molecular tools Accurate, portable data Epidemiology Evolution and population biology Slide 3 Population genetics of prokaryotes Selection (Factors: host, vaccination, medication, disinfectants, environmental tolerance, nutrients etc.) Mutation (point mutation and horizontal gene transfer) Evolution Genetic drift (limit 10 8 cells?) Migration (potential for horizontal gene transfer and change in allelic frequency) Slide 4 2

3 M ethod 2: reduced resolution Isolate Host Disease 1 A X 2 A X 3 A 4 A 5 B Y 6 B Y 7 B 8 A and B Host A Host B other species Disease X Disease Y Population 1 (isolates 1,2,3,4) Population 3 (isolates 5,6) Population 4 (isolate 7) Population 5 (isolate 8) Method 1: used to define populations M ethod 3: increased resolution Host A Host B Disease X Disease Y Population 1 (isolates 1,2) Population 2 (isolates 3,4) Population 3 (isolates 5,6) Population 4 (isolate 7) Host A Host B Disease X Disease Y Population 1 (isolate 2) Population 1 (iso la te 1) Population 2 (iso la te 3) Population 2 (isolate 4) Population 3 (isolates 5,6) Population 4 (iso late 7) Population 5 (iso la te 8) Population 5 (isolate 8) other species M ethod 4: loss of accuracy other species Host A Disease X Population 1 (isolates 1,2) Population 2 (isolates 3,4) Host B Disease Y Disease Y P o p u la tio n 3 (isolates 5) Population 4 (iso late 6, 7) Slide 5 other species Population 5 (iso late 8) Approach Variations in house-keeping genes (MLEE) Slow accumulation Multiple, un-linked chromosomal locations Avoid genes under selection pressure Slide 6 3

4 MLST Slide 7 Allele numbering and sequence type (ST) Locus 1 Locus 2 Locus 3 Locus 4 Locus 5 Locus 6 Locus 7 ST Slide 8 4

5 MLST Nucleotide sequence of gene fragments (~ bp) Easily validated and shared electronically All unique sequences at a locus is given an allele number No weigthing of number of nucleotide differences The combination of allele numbers (7) gives a Sequence Type (ST) Closely related isolates have the same ST or differ in one or two alleles (genes) Slide 9 Isolate collection DNA isolation Data collection and analysis PCR amplification Nucleotide sequence determination Allele sequence interrogation and ST identification Central database Multilocus sequence analysis Population structure Population studies Evolutionary analysis Epidemiological studies Disease outbreaks National and global trends Slide 10 5

6 Population structure eburst (Based Upon Related Sequence Types) Inferring patterns of evolutionary descent Clusters of related bacterial genotypes eburst groups and clonal complexes Single locus variants (SLV), double locus variants (DLV) Slide 11 eburst graph Staphylococcus aureus, MLST database, partial SLV DLV Subgroup founder Primary founder Slide 12 6

7 eburst graph Staphylococcus aureus, MLST database, total Slide 13 Tools Websites MLST home page: PubMLST: Basic and advanced facilities for querying databases and data analysis tools for drawing trees, graphs and maps etc and statistical analysis Slide 14 7

8 Databases (no isolates/st) Bacillus cereus Burkholderia pseudomallei Candida albicans Candida glabrata Candida tropicalis Campylobacter jejuni (5503/3784) Escherichia coli Enterococcus faecalis (350/161) Enterococcus faecium Haemphilus influenzae (-/551) Helicobacter pylori Moraxella catarrhalis Neisseria meningitidis (11686/6988) Salmonella enterica Staphylococcus aureus (-/1267) Staphylococcus epidermidis Streptococcus agalactiae Streptococcus pneumoniae Streptococcus pyogenes Streptococcus suis Vibrio vulnificus Slide 15 Close to completion: Propionibacterium acnes, Pasteurella multocida, Xylella fastidiosa, Leptospira interrogans, Clamydia tracheomatis, Mannheimia haemolytica In progress: Acinetobacter baumanii Bacillus species Borrelia burgdorferi sensu lato Burkholderia cepacia Klebsiella pneumoniae Listeria monocytogenes Streptococcus uberis Bordetella pertussis, parapertussis and bronchiseptica Vibrio sp. Streptococcus mutans Chlamydia trachomatis Wolbachia spp. Microcystis aeruginosa Wigglesworthia glossinidia Cryptococcus neoformans Batrachochytrium dendrobatidis Penicillium marneffei Legionella pneumophila Sphingomonas [Sphingobium] sp. Porpyhromonas gingivalis Corynebacterium diphtheria Corynebacterium pseudotuberculosis Corynebacterium ulcerans Corynebacterium bovis Aspergillus fumigatus Candida dubliniensis Candida krusei Slide 16 8

9 Applications Emergence of antimicrobial-resistant variants Association of genotypes with virulence Global spread of new variants Evolutionary and population analyses Estimation of recombination and mutation rates Evolutionary relationships within a genus Epidemiological surveillance of food-borne infections Isolate characterisation and species identification Slide 17 PFGE, MLST, AFLP Staphylococcus aureus Damian C. Mellesa et al Journal of Microbiological Methods 69 (2): Slide 18 9

10 Example: Enterococcus faecium Leavis HL et al CURRENT OPINION IN MICROBIOLOGY 9 (5): Slide 19 Development of a MLST scheme for Mannheimia haemolytica M. haemolytica is a pathogen affecting ruminants Eleven serovars recognised. A1 seems to be adapted to cattle while A2 is adapted to sheep Previous typing methods include MLEE Aim was to define a MLST typing scheme Slide 20 10

11 M. haemolytica MLST Seven house-keeping genes chosen: adk, aroe, deod, gapdh, gnd, mdh and zwf Search for these protein sequences in published protein sequences of Haemophilus influenzae and Pasteurella multocida (BLAST) Protein and nucleotide sequences were subsequently located in published contigs of M. haemolytica genome project Primers were designed using primer3 ( Statistical analysis with START2 ( Slide 21 M. haemolytica MLST Gene Mean G+C content d N /d S ratio Simpson s index of diversity (D) adk aroe deod gapdh gnd mdh zwf Slide 22 11

12 M. haemolytica MLST Primarily ovine isolates Isolates from the French alps Primarily bovine isolates Slide 23 12