Genetic diversity of Taro (Colocasia esculenta (L.) Schott) assessed by SSR markers.

Transcription

1 Genetic diversity of Taro (Colocasia esculenta (L.) Schott) assessed by SSR markers. J.L. Noyer 1, C. Billot 1, A. Weber 1, P. Brottier 2, J. Quero-Garcia 3 and V. Lebot 3 1 CIRAD, TA 40/03, Montpellier, France 2 Genoscope, CNS, CP 5706, Evry, France 3 CIRAD, PO Box 946, Port Vila, Vanuatu Keywords : Microsatellites, genetic distances, heterozygosity. ABSTRACT Following the screening of 96 clones picked from a microsatellite-enriched library, 49 sequences containing repeat motifs were isolated. Fifteen primer pairs were designed. All of them exhibited polymorphism on a subset of 5 taro accessions with a number of alleles ranging from 2 to 8. Seven primer pairs were used to study the genetic diversity of 105 accessions and 100 alleles were revealed. The sample was constituted in order to cover the genetic diversity of Colocasia esculenta as previously described within TANSAO, using AFLP markers. Dendrograms were constructed using the NJTree method based on a similarity matrix computed with a Dice index. Heterozygosity levels were calculated despite of the presence of diploid and triploid accessions. The results are presented and discussed. INTRODUCTION Taro, a vegetatively propagated root crop species, is grown in the humid tropical regions and is of considerable socio-economic importance in Southeast Asia and Oceania. Breeding programmes have been initiated with national collections sharing a narrow genetic base. Breeders are now attempting to broaden their working populations and morpho-agronomic characterisation has to be followed by molecular analyses in order to provide an accurate picture of the diversity within cultivars as well as in the wild genepool. The use of biochemical and molecular markers for taro germplasm characterization is quite recent but is expensive when thousands of accessions have to be analyzed. The first isozyme studies (Lebot and Aradhya, 1991) covering a wide geographical region included 1417 cultivars and wild forms from South East Asia and Oceania. They revealed the existence of two genepools, one in Southeast Asia and the second in Melanesia, indicating the possibility of two independent domestication processes. Only 48 cultivars from Indonesia were sampled but they appeared to be the most diverse, with 80 % of dissimilarity. Within the Pacific countries, Papua New Guinea and the Solomon Islands were the most diverse, followed by Vanuatu and Fiji. Polynesian countries showed the narrowest genetic base, with most cultivars corresponding to a single zymotype. Isozymes were however, unable to differentiate the tremendous morphological variation found within this region. It was also impossible to make correlations with ploidy levels or germplasm types (wild vs. cultivated). A second study including many more cultivars from Southeast Asia (Lebot et al., 2000), along with cultivars from Papua New Guinea and Vanuatu, confirmed the original hypothesis of two distinct genepools. The genetic base of the majority of the cultivars found within this vast geographical area was found to be rather narrow since only 21 out of 319 zymotypes represented two thirds of the total number of accessions. Molecular markers (RAPD) have been used more recently to analyze a subset of 44 accessions from diverse origins (Irwin et al., 1998) but no clear geographical or morphological structure was obtained. A combination of isozymes and RAPDs was also used 1

2 to study Asian taros (Ochiai et al., 1999) and the differentiation of the studied regions (Nepal, Yunnan, Japan) was obvious although the relationships between the different populations was far from being evident. Interestingly, their data gave support to an autopolyploid origin of the triploids. More reliable dominant markers (AFLP), have been used to study the diversity of a core sample including 255 accessions from seven countries (Kreike et al., 2003). Most accessions could be clearly differentiated by using three primer pairs and few duplicates were found. A differentiation between Southeast Asian and Melanesian taros was obtained, confirming the isozyme results. Thirty-eight wild genotypes were analysed and only those from Thailand (16 acc.) showed a significantly higher genetic diversity as compared to the cultivars. For Indonesia and Malaysia, cultivated and wild genotypes were not clearly differentiated, indicating a possible feral origin of some wild genotypes. Triploids were not associated to diploids and their origin remains unknown. In fact, two clusters of triploids were identified, indicating the possibility of different polyploidisation processes. In Vanuatu, AFLPs were used on a core sample (40 acc.) aiming at validating a stratification approach for germplasm collections. No correspondence was found between the structure of the dendrogram produced and the major morpho-agronomic traits (Quero Garcia, 2000). Mace and Godwin (2002) have developed a microsatellite-enriched library following the hybridization method described by Edwards (1996). These microsatellite markers were tested on a sample (17 acc.) from several Pacific countries. They proved to be a valuable tool for the identification of duplicates although the geographical structure produced was not very informative, probably due to the small size of the sample. Another microsatellite-enriched library was constructed (Bastide, 2000) following a hybridisation-based capture methodology using biotin-labelled microsatellite oligoprobes and streptavidin-coated magnetic beads (Billote et al., 1999). This second source of microsatellite markers was used in order to analyze a subset of the sample previously characterized by Kreike et al. (2003). The approach presented and discussed hereafter, might be of interest to breeders because it takes into consideration heterozygosity levels. MATERIAL AND METHODS Plant material Plant DNA was obtained from N. Kreike (Kreike et al., 2003). Each DNA sample was diluted to a final concentration of 5ng/µl. A subsample (Table 1) was defined in order to cover both the widest genetic diversity and the largest geographical area. The amount of available DNA was the final criteria. Five additional accessions of Xanthosoma sagittifolium were added to the sample in order to get an external reference but no scorable products were obtained. Microsatellite analysis From the microsatellite-enriched library (Bastide, 2000), 96 clones were sequenced at the Genoscope, (Centre National de Séquençage) according to Artiguenave et al. (2000). Fortynine sequences containing repeat motifs were identified. Fifteen primer pairs were designed using Primer3 (www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). All of them revealed polymorphism on a subset of 5 taro accessions with a number of alleles ranging from 2 to 8. Seven primer pairs revealing more than 10 alleles each were finally retained (Table 2). IR-fluorescent PCR reactions were performed using the following strategy. One of the PCR primers had a 19 base extension at its 5' end with the sequence 5'- CACGACGTTGTAAAACGAC-3'. This sequence is identical to an IR-labelled universal M13 Forward (-29) primer, which is included in the reaction. During the PCR, the tailed primer generates a complementary sequence to the M13 primer which is subsequently utilized for priming in the amplification reaction thereby generating IR-labelled PCR products. All 2

3 PCR were produced in 10 µl containing 20 ng of DNA, 1 µl 10x PCR buffer (200 mm Tris- HCl (ph 8.4), 500 mm KCl), 200 mm of each datp, dctp, dgtp, dttp, 2 mm of MgCl 2, 0.05 mm of each the M13-tailed primer, 0.1 µm of the other primer, 0.1 µm of the IRlabelled (with IR700 or IR800) M13 primer and 1U of Taq DNA Polymerase (Eurobio). Primers were synthesized by Eurogentec (France) and the IR-labelled M13 primer by Biolegio (The Netherlands). Table 1: Accessions used in this study (according to Kreike et al., 2003). 3

4 Internal # Acc. number Country Ploïdy Group Internal # Acc. number Country Ploïdy Group 6 BC 753 Papua New Guinea 2 cv 104 MAL 50 Malaysia 2 cv 9 BC 772 Papua New Guinea 2 cv 108 MAL 110 Malaysia nc w 10 BC 773 Papua New Guinea 2 cv 109 MAL 131 Malaysia 2 cv 11 BC 776 Papua New Guinea 2 cv 110 MAL 136 Malaysia 2 cv 12 BC 781 Papua New Guinea 2 cv 111 MAL 144 Malaysia 2 w 13 BC 786 Papua New Guinea 2 cv 117 PNG ABVC Papua New Guinea nc 16 BC 793 Papua New Guinea 2 cv 118 PRG 5 The Philippines 2 cv 18 BC 803 Papua New Guinea 2 cv 119 PRG 42 The Philippines 2 cv 19 BC 813 Papua New Guinea 2 cv 120 PRG 66 The Philippines nc cv 20 BC 814 Papua New Guinea 2 cv 121 PRG 68 The Philippines nc cv 21 BC 825 Papua New Guinea 2 cv 123 PRG 80 The Philippines nc cv 23 BC 828 Papua New Guinea 2 cv 124 PRG 92 The Philippines nc cv 25 BC 843 Papua New Guinea 2 cv 125 VN 134 Vietnam 3 cv 26 BC 847 Papua New Guinea 2 cv 128 PRG 235 The Philippines nc cv 27 BC 851 Papua New Guinea 2 cv 129 PRG 244 The Philippines nc cv 29 BC 859 Papua New Guinea 2 cv 131 PRG 337 The Philippines nc cv 33 BC 883 Papua New Guinea 2 cv 132 PRG 640 The Philippines nc cv 35 BC Bolba Papua New Guinea 2 cv 133 PRG 651 The Philippines nc cv 36 Wild Green a nc nc w 134 VN T3 b Vietnam nc w 37 BC Singel Papua New Guinea nc cv 135 PRG 686 The Philippines nc cv 40 Dark Wild nc nc w 137 PRG 734 The Philippines nc cv 41 GO 104 The Philippines 2 cv 138 THA 07 Thailand 2 cv 42 GO 49 The Philippines 2 cv 139 THA 10 Thailand 2 cv 44 GS 377 The Philippines 2 cv 141 IND 517 Indonesia 3 cv 45 GS 382 The Philippines 2 cv 145 THA 48 Thailand 2 cv 46 IND 2M Indonesia 2 cv 147 THA 71 Thailand 2 cv 47 IND 3M Indonesia 2 cv 148 THA 91 Thailand 2 cv 48 IND 8M Indonesia nc nc 149 THA 92 Thailand 2 cv 50 VN T3 a Vietnam nc w 150 THA 98 Thailand 2 cv 56 IND 217 Indonesia 2 cv 151 THA 101 Thailand 2 cv 57 IND 218 Indonesia 2 cv 152 THA 108 Thailand 2 cv 61 IND 235 Indonesia 3 cv 153 THA 138 Thailand 2 cv 63 IND 265 Indonesia 2 cv 154 THA 144 Thailand 2 cv 68 IND 311 Indonesia 2 cv 156 THA 160 Thailand 2 cv 69 IND 315 Indonesia nc w 157 THA 242 Thailand nc w 70 IND 316 Indonesia 3 cv 158 THA 245 Thailand nc w 73 IND 33 Indonesia 2 cv 162 Wild Green b nc nc w 74 IND 331 Indonesia 2 cv 164 VN 50 Vietnam 3 cv 75 IND 350 Indonesia 2 cv 165 VN 115 Vietnam 3 cv 77 IND 383 Indonesia 2 cv 167 VN 121 Vietnam 3 cv 79 IND 399 Indonesia 2 cv 169 VN 126 Vietnam 3 cv 81 IND 411 Indonesia 2 cv 173 VN 276 Vietnam 3 cv 83 IND 453 Indonesia 2 cv 177 VN 45 Vietnam 2 cv 85 IND 497 Indonesia 3 cv 180 VN 80 Vietnam 3 cv 90 IND 518 Indonesia 3 cv 181 VN 89 Vietnam 3 cv 91 IND 519 Indonesia 2 cv 182 VN 94 Vietnam 3 cv 93 IND 526 Indonesia 2 cv 185 VN T3 c Vietnam nc w 94 IND 54 Indonesia 2 w 186 VN T5 Vietnam nc w 95 IND 548 Indonesia 2 cv 189 Vu 56 Vanuatu 2 cv 96 IND 555 Indonesia 2 cv 191 Vu 66 Vanuatu 2 cv 97 IND 561 Indonesia 2 cv 193 Vu 191 Vanuatu 2 cv 98 IND 61 Indonesia 2 cv 195 Vu 221 Vanuatu nc cv 102 MAL 30 Malaysia 2 cv 4

5 Table 2: Description of the 7 primer pairs used in this study (Exp. Size: expected size, based on the sequenced allele; All. Nbr: number of alleles per locus ; He : observed heterozygocity Locus Primers Pattern Exp. size All. Nbr. He Ces-1A06 L-M13 CACGACGTTGTAAAACGACGCTTGTCGGATCTATTGT (CT) R GGAATCAGTAGCCACATC Ces-1A08 L-M13 CACGACGTTGTAAAACGACCATTGAGTGTTGGAAAAG (CT)21(CA) R TGGGAAGTCATAATCTCA Ces-1B02 L-M13 CACGACGTTGTAAAACGACGCACGTTAGACTATTGGA (GA)9, (GA) R GTGCTTAGATGGTTGAGA Ces-1B03 L-M13 CACGACGTTGTAAAACGACTTGCTTGGTGTGAATG (TA)3(GATA)3(GA) R CTAGCTGTGTATGCAGTGT Ces-1B09 L-M13 CACGACGTTGTAAAACGACAACACTCCCAGAAGAACC (AG) R CGTCTTTCAAACTGATCG Ces-1C03 L-M13 CACGACGTTGTAAAACGACTGTTGGGAAAGAGGG (CT) R GGGGAATAACCAGAGAA Ces-1C06 L-M13 CACGACGTTGTAAAACGACCCAGAAGAGACGTTACAGA R ACGACTTTGGACGGA (CT) Cycling conditions consisted of an initial denaturing step of 4 min at 94ºC, followed by 24 cycles of touchdown PCR consisting of 30s at 94ºC, 45s at 64ºC (reduced by 0.5ºC each subsequent cycle), and 45s at 72ºC, 10 additional cycles consisting of 30s at 94ºC, 45s at 50ºC and 45s at 72ºC, and a final elongation step at 72ºC for 10 min. All PCR reactions were performed on a Dyad 384 MJResearch thermocycler. Gel electrophoresis and visualization of the STR alleles were accomplished using a LI-COR IR 2 Model 4200 automated DNA sequencer (LI-COR, Inc., Lincoln, NE). Gels were 18 cm in length, 0.25 mm in thickness and composed of 6.5% KB+ acrylamide, 7M urea (LI-COR). Runs were performed in 1X TBE buffer, at 48 C and 40 W constant. A standard size ladder obtained from amplification of known band sizes was loaded regularly. The raw data depicting the STR alleles is displayed as an autoradiogram-like image on the computer and analyzed as it. Data analysis Presence or absence of one allele at one locus was scored respectively as 1 and 0. Due to the presence of triploids and diploids in the same analysis, all present fragments are not always detected and a simultaneous fragment absence becomes significant. Therefore, the absence and presence modalities must be considered of equal weight. Considering this, we chose to calculate the genetic similarities between accessions i and j (d i-j ) using the Sokal and Michener index, as: d i-j = (n 11 + n 00 )/( n 11 + n 10 + n 01 + n 00 ), where n 11 is the number of shared alleles between i and j, n 10 and n 01 the number of alleles present for one accession and absent for the other, and n 00 the number of simultaneously absent alleles. The matrix of pairwise d i-j values between individuals was used to construct a NJTree with the unweighted Neighbor- Joining method (Saitou and Nei, 1987). This analysis was performed with the Darwin 4.2 software (Perrier et al., 1999). Heterozygocity levels were calculated according to the hypothesis that only one locus is revealed by each primer pair. Consequently, each individual presenting more than one band level is considered as heterozygous. RESULTS One hundred alleles were identified ranging from 12 to 17 per locus with an average of 14.3 (Table 2). No correlation can be observed between the nature or the length of the repeat motif and the number of alleles. Except for IND497, which presents 4 band levels at the locus 1C06, not more than 3 alleles were scored for the triploid accessions. Accessions IDN217, 218, 331 and 453 were supposed to be diploids but presented 3 alleles at different loci. No accessions revealed a triploid pattern for the locus 1B02. The heterozygosity level is ranging from 41.2 to 86.7 (Table 2) with an average of Again, no relation can be observed between this heterozygosity level neither with the size nor with the structure of the repeat motif. If true allelic frequency cannot be calculated due to the presence of triploids in the sample, the band level distribution for each locus (Table 5

6 3) can be analyzed. The situation is extreme for locus 1C06 but no locus presents a normal distribution. Table 3: Band level distribution per locus (Nbr: occurence number of one band). Loc./band level Nbr Loc./band level Nbr Loc./band level Nbr Loc./band level Nbr Loc./band level Nbr Loc./band level Nbr Loc./band level Nbr 1B B B A CO CO A B B B A CO CO A B B B A CO CO A B B B A CO CO A B B B A CO CO A B B B A CO CO A B B B A CO CO A B B B A CO CO A B B B A CO CO A B B B A CO CO A B B B A CO CO A B B B A CO CO A B B A CO CO A B A CO CO A B A A A A Figure 1: distribution of the similarity values (Sokal and Michener index). The similarity values are very low (Figure 1) with an average of and a maximum of This is summarized by the distance scale on the NJTree (Figure 2) as well as by the frequent null bootstrap values frequently observed. This observation indicates that the global meaning and the stability of this NJTtree should be taken cautiously. Nevertheless, some clusters can be identified. Accessions from Thailand are grouped and well differentiated from other origins. Accessions from Papua New Guinea (BC) and more widely from Melanesia (BC, VU) are also clustering together. New lines and cultivars (GO, GS, PRG) from The Philippines are grouped. A fourth cluster can be observed which links wild types and all triploid accessions but except for three of them (IND517, VN50 and VN276). Triploids are associated to IDN217, 218, 331 and 453, the diploid cultivars which presented triploid patterns as mentioned above. The NJTree stands global comparison with the UPGMA dendrogram of Kreike et al. (2003) based on AFLP data. Minor modifications can be observed. In the AFLP dendrogram, VN50 and VN276, mentioned above, were grouped with other Vietnamese accessions from which they are isolated here. In the NJTree only one major Indonesian group is defined instead of three with AFLP data, meanwhile remaining accessions are spread in both cases. Identical conclusions were obtained with microsatellite data analyzed by a UPGMA dendrogram based on a Dice index (data not shown). 6

7 THA 10 (2) PRG 337 THA 71 (2) THA 92 (2) THA 101 (2) THA 98 (2) THA 160 (2) THA 138 (2) THA 91 (2) THA 108 (2) 70 THA 144 (2) THA 07 (2) VN 45 (2) 93 THA 48 (2) VN 276 (3) VN 50 (3) PRG 244 IND 561 (2) IND 555 (2) Vu 221 Vu 191 (2) Vu 66 (2) BC Singel PNG ABVC BC Bolba (2) BC 843 (2) BC 772 (2) BC 883 (2) BC 828 (2) BC 859 (2) BC 847 (2) BC 781 (2) BC 851 (2) BC 793 (2) BC 776 (2) 93 BC 753 (2) BC 786 (2) BC 773 (2) Vu 56 (2) MAL 30 (2) BC 813 (2) 100 BC 803 (2) PRG 734 IND 548 (2) BC 825 (2) PRG 640 PRG 92 IND 519 (2) IND 526 (2) PRG 235 IND 33 (2) PRG 80 PRG 66 PRG 68 GO 49 (2) GO 104 (2) PRG 651 MAL 136 (2) MAL 131 (2) GS 382 (2) GS 377 (2) MAL 110 (w) IND 350 (2) 50 VN 94 (3) 50 VN 126 (3) VN 80 (3) IND 518 (3) VN 89 (3) 72 IND 316 (3) 100 Wild Green b 68 WildGreen a IND 497 (3) IND 235 (3) IND 315 (w) IND 217 (2) Dark Wild VN T3 b (w) 100 VN T3 a (w) VN T3 c (w) THA 245 (w) THA 242 (w) PRG 686 VN 121 (3) VN 115 (3) VN 134 (3) IND 453 (2) IND 331 (2) IND 218 (2) VN T5 (w) IND 8M 77 IND 2M (2) MAL 144 (2) IND 3M (2) MAL 50 (2) IND 411 (2) IND 383 (2) IND 311 (2) IND 61 (2) IND 399 (2) IND 517 (3) IND 265 (2) BC 814 (2) IND 54 (2) PRG 42 (2) PRG 5 (2) Figure 2: NJTree representation of the genetic relationships of 105 acc. based on a similarity matrix involving 100 alleles (Sokal and Michener index, Bootstrap values >50 are indicated). DISCUSSION Despite some changes, like the clustering of new and old accessions from The Philippines, the the NJTree based on microsatellite loci and the UPGMA dendrogram based on AFLP data 7

8 (Kreike et al., 2003) give consistent results. A differentiation between Southeast Asian and Melanesian taros is observed, confirming AFLP and isozyme results. Accessions from Thailand are grouped but Indonesian accessions show a large distribution confirming again AFLP results. This similarity between AFLP and microsatellite results was not fully expected. Indeed, AFLPs are scored as dominant markers with two allelic modalities at each locus. More alleles can be detected at a single locus with microsatellites (in fact, more than with other molecular markers presently used), and this results in an average index of similarity between individuals which is generally much lower. This may explain the low correlation between this technique and others, especially when individuals are not closely related. According to Powell et al., (1996), the correlation between AFLPs and SSR is not significant (r = 0.14). In our study, however, the similarity average value of is ranging in the same order than the values obtained with the Nei and Li index (Dice index) by Kreike et al. (2003). Similarity of organization and of index values could be explained by the fact that the accessions of the whole sample are closely related whatever may be their origin. With an average of 14.3 alleles per locus, a very high level of polymorphism is observed. Considering that the number of alleles scored for each accession do not exceed their ploidy level (except for IND497 which presents 4 band levels at the locus 1C06 and for IND217, 218, 331 and 453 clustered with the triploids), we can assume: 1- that the microsatellite markers used in this study are locus specific and, 2- that no frequent events of locus duplication disrupt the analysis. Nevertheless, our purpose was to analyze simultaneously the genetic diversity of both diploids and triploids. The Nei distance index, the most widely used for such analysis, is based on allelic frequency which calculation is biased when a triploid exhibits two alleles. As this case occurs in our study and we thus preferred to avoid the calculation of genetic distances between and within populations or geographic groups. The analysis of the band levels distribution, which can be done without restriction, gives, however, an unexpected information. Even with a high average of 14.5 alleles/locus, we observe a few (1 to 4) very common band levels and many rare ones at each locus. Even the Indonesian sample that was considered as being the most diverse (Lebot and Arahdya, 1991; Kreike et al., 2003) follows the same distribution without covering all the band levels possibilities (data not shown). Added to the high level of heterozygosity, these observations let us assume that the sample could be considered as a population issued from a narrow genetic base which would not be in a panmictic situation. This last point is, of course, in agreement with the vegetative propagation of taro and this situation confirms that the sample is far from covering the whole diversity of C. esculenta. In the very next future, we will increase the number of accessions involved in this study to cover the complete TANSAO core sample (170 acc.). Increasing the number of wild types will be also a major objective in order to elucidate their relationships with cultivars. Genetic distances between and within diploids and triploids will have to be analyzed independently, then together, in order to evaluate the bias introduced by the unknown allelic distribution induced by the presence of two band levels at one locus for a triploid. The number of microsatellite loci will also be increased. Ten loci are generally admitted as being adequate to assess all the parameters of population genetics. The following step will be to identify the natural or breeding populations within which these parameters will be studied. Their choice will be directed by the results obtained in the present study and according to the needs of the breeders. Acknowledgements: This study would not have been possible without the support of the Taro Network for Southeast Asia and Oceania (TANSAO), a project funded by the INCO programme of the European Union (DG XII) (grant no. ERBIC18CT970205). 8

9 REFERENCES Artiguenave, F., Wincker P., Brottier P., Duprat S., Jovelin F., Scarpelli C., Verdier J., Vico V., Weissenbach J. and W. Saurin (2000). Genomic exploration of the hemiascomycetous yeasts: 2. Data generation and processing. FEBS Letter 487: (1),13-6 Bastide, C. (2000). Création de banques microsatellites pour l'igname (Dioscorea alata, Dioscorea praehensilis et Dioscorea abyssinica) et le taro (Colocasia esculenta). Mémoire de DUT, Dépt Génie Biologique Option Agronomie. IUT de Perpignan, France. 13p. Billotte, N., Lagoda P.J.L., Risterucci A.M. and F.C. Baurens (1999). Microsatellite-enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits 54: Edwards, K.J., Barker J.H.A., Daly A., Jones C. and A. Karp (1996). Microsatellite libraries enriched for several microsatellite sequences in plants. BioTechniques 20, Irwin, S.V., Kaufuis P., Banks K., de la Peña R. and J.J. Cho. (1998) Molecular characterization of taro (Colocasia esculenta) using RAPD markers. Euphytica 99: (3), Kreike, N., VanEck H and V. Lebot (2003). Genetic diversity in taro (Colocasia esculenta (L.) Schott) from South East Asia and Oceania. Theoretical and Applied Genetics, in press. Lebot, V. and M. Aradhya. (1991). Isozyme variation in taro (Colocasia esculenta) from Asia and Oceania. Euphytica 56, Lebot, V., Hartati S., Hue N.T., Viet N.V., Nghia N.H., Okpul T., Pardales J., Prana M.S., Prana T.K., Thongjiem M., Kreike C. M., H. VanEck, Yap T.C. and A. Ivancic. (2000). Genetic variation in taro (Colocasia esculenta) in South East Asia and Oceania. Twelfth Symposium of the ISTRC. Potential of root crops for food and industrial resources. Sept , 2000, Tsukuba, Japan, pp: Mace E. S., and I Godwin. (2002). Development and characterization of polymorphic microsatellite markers in taro (Colocasia esculenta). Genome 45, Ochiai T., Nguyen V.X., Tahara M. and H. Yoshino. (2001) Geographical differentiation of Asian taro, Colocasia esculenta (L.) Schott, detected by RAPD and isozyme analyses. Euphytica, 122, Perrier, X., A. Flori, and F. Bonnot Les méthodes d'analyse des données. In :P. Hamon et al. (eds) Diversité génétique des plantes tropicales cultivées. Cirad, collection repères, Montpellier, France, pp Powell W., Morgante M., Andre C., Hanafey M., Vogel J., Tingey S. and A. Rafalski. (1996). The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Molecular Breeding 2, Quero-Garcia, J. (2000). Etude de la structuration de la variabilité génétique du taro, Mémoire de DEA : Biologie, diversité et adaptation des plantes cultivées : INAPG, Paris, France. Saitou N. and M. Nei. (1987). The neighbor joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4: (4),