The Pennsylvania State University. The Graduate School. Intercollege Graduate Degree Program in Genetics

Transcription

1 The Pennsylvania State University The Graduate School Intercollege Graduate Degree Program in Genetics IDENTIFICATION AND MAPPING OF NEW TOMATO LATE BLIGHT RESISTANCE GENES IN AN ACCESSION OF THE WILD TOMATO SPECIES, Solanum pimpinellifolium A Dissertation in Genetics by Heather Lynn Merk 2010 Heather Lynn Merk Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2010

2 The dissertation of Heather Lynn Merk was reviewed and approved* by the following: Majid R. Foolad Professor of Plant Genetics Dissertation Advisor Mark J. Guiltinan Professor of Plant Molecular Biology Chair of Committee Surinder Chopra Associate Professor of Maize Genetics Beth K. Gugino Assistant Professor of Plant Pathology David R. Huff Associate Professor of Turfgrass Genetics Seogchan Kang Professor of Plant Pathology Richard W. Ordway Associate Professor of Biology Chair of the Intercollege Graduate Degree Program in Genetics *Signatures are on file in the Graduate School

3 iii ABSTRACT Late blight (LB), caused by the oomycete Phytophthora infestans (Mont.) de Bary, is one of the most potentially destructive and devastating diseases of tomato. Previously, LB was relatively well-controlled through heavy fungicide application, cultural practices, and growing semi-resistant potato cultivars. However, there have never been tomato cultivars with adequate levels of resistance and newer, more aggressive isolates of P. infestans have been reported. To regain adequate control of LB, new sources of genetic resistance in wild species are being identified and characterized. An LB outbreak in summer 2004 in the northeastern U.S. with considerable impact on The Pennsylvania State University s tomato breeding program prompted research to identify new sources of LB resistance with the intent of transferring the resistance to breeding material to provide adequate protection against future infections. Previous field, high tunnel, greenhouse and growth chamber evaluations of approximately 70 S. pimpinellifolium accessions led to identification of several with LB resistance. One of these highly resistant accessions, PSLP153, was selected for further evaluation and genetic characterization as described in this Ph.D. thesis. PSLP153 was hybridized with NCEBR-2, a S. lycopersicum breeding line and F 1 and F 2 populations were previously developed. As an initial step in genetic characterization of the LB resistance, a large F 2 population (n=986) was grown and evaluated for LB resistance. Heritability (h 2 ) for LB resistance conferred by PSLP153 was estimated to be 0.68 and 0.76 based on disease severity scores of selected resistant and susceptible F 2 individuals and their self (F 3 ) progeny using the parent-progeny method in two replicated experiments. The moderately-high h 2 values indicate that reasonable selection progress for increasing LB resistance can be achieved. As a result, breeding efforts have been undertaken to introduce the LB resistance conferred by PSLP153 to material in The Pennsylvania State University tomato breeding program. Selected resistant and susceptible F 2 individuals were genotyped with 153 molecular

4 iv markers to develop a genetic map and for trait-based analysis (TBA) to identify regions of the tomato genome associated with LB resistance. Employing TBA, a 23.0 cm region on the long arm of chromosome 1 and a region at the distal end of chromosome 10 were identified as associated with LB resistance. This was the first research to identify LB resistance on chromosome 1. The LB resistance region on chromosome 10 may coincide with a previously identified tomato LB resistance gene, Ph-2. Two further filial populations (F 3 and F 4 ), four backcross populations (F 4 BC 1, F 4 BC 2, F 4 BC 3, F 4 BC 4 ) and an F 4 BC 3 S 1 population were developed with objectives of confirming the resistance regions, estimating LB resistance gene effects, and making progress toward developing near isogenic lines to delineate and fine map the LB resistance genes. The chromosome 10 region was confirmed in F 4 BC 4, and F 4 BC 3 S 1 populations. QTL analysis in the F 4 BC 3 S 1 generation indicated that the region on chromosome 10 explained 50.7% of the phenotypic variation of LB response. In addition, this region had additive genetic effects of 35.7% and dominant genetic effects of 5.2%. The large effect of this region suggests that it can be extremely useful for breeding purposes. To fully exploit the utility of this LB resistance for use in marker-assisted selection, the region must be further delineated in a large population containing additional DNA markers. Unfortunately, the region on chromosome 1 associated with LB resistance could not be confirmed. Further experiments need to be conducted to recover the resistance. The eventual fine-mapping and possible cloning of these LB resistance genes will be useful to plant breeders for developing commercial cultivars with improved levels of LB resistance. Efforts to pyramid these genes with other LB resistance genes may provide more durable resistance against LB, which is a continual threat to the tomato industry worldwide.

5 v TABLE OF CONTENTS LIST OF FIGURES... viii LIST OF TABLES... xii ACKNOWLEDGEMENTS... xv Chapter 1 Introduction... 1 Significance of the Tomato... 1 Tomato Genetic Diversity... 2 Genetic Mapping in Tomato... 3 Tomato Genome Sequencing... 6 Significance of Late Blight... 7 Phytophthora infestans Life Cycles Genome Sequencing Disease Dynamics Qualitative and Quantitative Disease Resistance Pathogen Host Interactions Phytophthora infestans Effectors Late Blight Control Late Blight Genetic Resistance Late Blight Resistance in Potato Late Blight Resistance in Tomato Background to Thesis Research Thesis Research Objectives References Chapter 2 Parent-offspring correlation estimate of the heritability for late blight resistance conferred by an accession of the tomato wild species, Solanum pimpinellifolium Abstract Introduction Materials and Methods Plant Materials Inoculum Preparation Inoculation and Screening of the F 2 population Screening of the F 3 Families Data Analysis Results Discussion References Chapter 3 Identification and F 2 mapping of new genes conferring late blight resistance in the tomato wild species, Solanum pimpinellifolium Abstract... 75

6 Introduction Significance of the Tomato Tomato Genome Sequencing Molecular Markers and Genetic Maps in Tomato Significance of Late Blight Genetic Resistance Late Blight Resistance in Tomato Prior Research Identifying and Mapping New Late Blight Resistance Genes Research Objectives Materials and Methods Plant Materials Inoculum Preparation Inoculation and Screening of the F 2 Population DNA Extraction Parental Survey Selection of F 2 individuals and Genotyping Genetic Map Construction Statistical Analysis Trait-Based Analysis Results Screening of the F 2 Population Selection of F 2 Individuals for Genetic Mapping and Trait-Based Analysis Parental Survey Genotyping of Selected F 2 individuals and Genetic Map Construction Discussion References Chapter 4 Confirmation of New Tomato Late Blight Resistance Genes and Progress Toward Developing Near Isogenic Lines Abstract Introduction Significance of the Tomato The Use of Related Wild Tomato Species Significance of Late Blight Late Blight Resistance in Tomato Prior Research Confirmation of the Late Blight Resistance Segments and Progress Toward Development of Near Isogenic Lines Research Objectives Materials and Methods Plant Materials Population Development F 3 Families F 4 Families F 4 BC 1 Population F 4 BC 2 Population F 4 BC 3 Population vi

7 F 4 BC 4 and F 4 BC 3 S 1 Populations Results F 3 Families F 4 Families F 4 BC 1 Population F 4 BC 2 Population F 4 BC 3 Population F 4 BC 3 S 1 Populations F 4 BC 4 Populations Discussion References Chapter 5 Summary, Conclusions, and Future Research References vii

8 viii LIST OF FIGURES Figure 2-1. Frequency distribution of the F 2 population disease severity (n=986). Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions Figure 2-2. Frequency distribution of the disease severity for the selected resistant (n=50) and susceptible individuals (n=44) in the F 2 parental generation Figure 2-3. Frequency distribution of the mean disease severity of the 94 F 3 progeny families in experiment I (2006) Figure 2-4. Frequency distribution of the mean disease severity for the 94 F3 progeny families in experiment II (2007) Figure 3-1. Frequency distribution of the F 2 population disease severity (n=986). Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions Figure 3-2. Frequency distribution of disease severity for the F 2 selected late blight resistant and susceptible individuals to be used for marker genotyping and traitbased analysis. The late blight disease screening was conducted using whole plants in a controlled greenhouse Figure 3-3. F 2 genetic linkage map based on 153 DNA markers genotyped in 25 selected late blight resistant individuals and 31 selected late blight susceptible individuals. The individuals were selected from a large F 2 population (n=986) developed from hybridizations between S. lycopersicum inbred breeding line NCEBR-2 and S. pimpinellifolium accession PSLP Figure 3-4. Graphical genotypes of chromosome 1 for the F 2 selected late blight resistant and susceptible individuals. The navy blue segments indicate homozygous for PSLP153, the red regions indicate homozygosity for NCEBR-2, the light blue regions indicate heterozygosity, and the green regions indicate unknown or missing data. The resistant individuals are labeled R1-25 and the susceptible individuals are labeled S1-S32. The yellow box outlines the region associated with late blight resistance Figure 3-5. Graphical genotypes of chromosome 10 for the F 2 selected late blight resistant and susceptible individuals. The navy blue segments indicate homozygous for PSLP153, the red regions indicate homozygosity for NCEBR-2, the light blue regions indicate heterozygosity, and the green regions indicate unknown or missing data. The resistant individuals are labeled R1-25 and the susceptible individuals are labeled S1-S32. The yellow box outlines the region associated with late blight resistance

9 Figure 4-1. Graphical genotype of the F 4 BC 2 individual selected for further backcrossing to NCEBR-2. The red segments of the chromosomes indicate homozygosity for NCEBR-2, the light blue segments of the chromosomes indicate heterozygosity, and the green segments of the chromosomes indicate that the genotype is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The purple boxes indicate segments of the genome associated with late blight resistance and the black boxes indicate background regions that are heterozygous Figure 4-2. Chromosome 1 graphical genotypes of the three F 4 BC 3 individuals selected for further backcrossing to NCEBR-2 and for self-pollination. The red segments indicate homozygosity for NCEBR-2, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment Figure 4-3. Chromosome 10 graphical genotypes of the three F 4 BC 3 individuals selected for further backcrossing to NCEBR-2 and for self-pollination. The red segments indicate homozygosity for NCEBR-2, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment Figure 4-4. Frequency distribution of LB disease severity of F 4 BC 3 S 1-28/113 individuals (n=406) evaluated for LB resistance in January Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions Figure 4-5. Frequency distribution of LB disease severity of F 4 BC 3 S individuals (n=206) evaluated for LB resistance in March Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions Figure 4-6. Chromosome 1 graphical genotypes of F 4 BC 3 S individuals with late blight disease severity 10% or less. The red segments indicate homozygosity for NCEBR-2, the navy segments indicate homozygosity for PSLP153, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment Figure 4-7. Chromosome 10 graphical genotypes of the F 4 BC 3 S individuals with disease severity 10% or less. The red segments indicate homozygosity for NCEBR- 2, the navy segments indicate homozygosity for PSLP153, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only ix

10 x genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment Figure 4-8. Chromosome 1 graphical genotypes of F 4 BC 3 S individuals with late blight disease severity 100%. The red segments indicate homozygosity for NCEBR- 2, the navy segments indicate homozygosity for PSLP153, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment Figure 4-9. Chromosome 10 graphical genotypes of F 4 BC 3 S individuals with disease severity 100%. The red segments indicate homozygosity for NCEBR-2, the navy segments indicate homozygosity for PSLP153, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment Figure Disease severity (percent defoliation) of F 4 BC 3 S individuals separated by genotype at the SSR74/SSR223 marker loci on chromosome Figure Frequency distribution of LB disease severity of F 4 BC 4-28/113 individuals (n=277) evaluated for LB resistance in January Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions Figure Frequency distribution of LB disease severity of F 4 BC individuals (n=39) evaluated for LB resistance in March Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions Figure Disease severity (percent defoliation) of F 4 BC individuals separated by genotype at the SSR74/SSR223 marker loci on chromosome 10. A indicates that individuals were homozygous for NCEBR-2 and H indicates that individuals were heterozygous Figure Graphical genotypes of the F 4 BC individuals for chromosome 1. The individuals are organized from lowest to highest disease severity. The red segments indicate homozygosity for NCEBR-2, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment Figure Graphical genotypes of the F 4 BC individuals for chromosome 10. The individuals are organized from lowest to highest disease severity. The red segments indicate homozygosity for NCEBR-2, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either

11 because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment xi

12 xii LIST OF TABLES Table 2-1. Late blight (LB) disease severity (final percent defoliation ± SD/SE) for the parental lines, F 1, F 2, and F 3 generations, as well as estimates of heritability Table 3-1. Number of DNA markers surveyed for polymorphism between the parental lines, NCEBR-2 and PSLP Table 3-2. Simple sequence repeat (SSR) markers surveyed for polymorphism between the parental lines, S. lycopersicum inbred line NCEBR-2 and S. pimpinellifolium accession PSLP153. The marker sources are listed in the approximate order in which the markers were surveyed Table 3-3. Forward and reverse PCR primers for SSR markers designed from BAC sequences for parental survey Table 3-4. Forward and reverse PCR primers for SSR markers designed from preliminary whole genome shotgun sequence for parental survey Table 3-5. Forward and reverse primers designed to amplify ESTs for sequencing in the parental lines, NCEBR-2 and PSLP Table 3-6. Disease severity of the parental lines and resistant and susceptible controls. Ph-1 indicates that the line has late blight (LB) resistance conferred by Ph-1, Ph-2 indicates that the line has LB resistance conferred by Ph-2, and Ph-3 indicates that the line has LB resistance conferred by Ph Table 3-7. Number and percentage of markers that were polymorphic between NCEBR-2 and PSLP Table 3-8. CAPS markers polymorphic between NCEBR-2 and PSLP153 by marker source. SGN indicates that the markers were found on the Sol Genomics Network ( 125 Table 3-9. SSR markers polymorphic between NCEBR-2 and PSLP153 by marker source. SGN indicates that the markers were found on the Sol Genomics Network ( Tomatomap.net indicates that the markers were found on the tomatomap.net website, Solanaceae Genomic indicates that the markers were found on the Solanaceae Genomic Resources website ( ), BMC bioinformatics indicates that the markers were identified by Tang et al. (2008), Molecular Breeding indicates that the markers were mapped by Ohyama et al. (2009), Tomato BACs indicates that the markers were designed based on tomato BAC sequence ( and Whole Genome indicates that the markers were designed based on tomato whole genome shotgun sequence ( 125 Table Restriction enzymes used for the polymorphic CAPS markers organized by chromosome

13 Table Monogenic segregation of DNA markers genotyped in the F 2 population (combined LB resistant and susceptible individuals) derived from a cross between S. lycopersicum and S. pimpinellifolium. Marker loci which exhibited significant deviation from the expected 1:2:1 Mendelian segregation ratio are shown in bold xiii Table S. pimpinellifolium allele frequency difference between the 25 selected F 2 resistant individuals (q 1 ) and the 31 selected F 2 susceptible individuals (q 2 ) for 153 DNA markers. Markers are listed in order by chromosome. Allele frequency differences greater than three standard errors of the allele frequency difference were considered significant. Significant differences are bolded and italicized. The standard error was calculated using the formula SE = (p 1 q 1 /2N 1 + p 2 q 2 /2N 2 ) ½, where p 1 is the NCEBR-2 allele frequency in the resistant class, q 1 is the PSLP153 allele frequency in the resistant class, p 2 is the NCEBR-2 allele frequency in the susceptible class and q 2 is the PSLP153 allele frequency in the susceptible class Table Monogenic segregation of DNA markers in selected LB resistant and susceptible F 2 individuals derived from a cross between S. lycopersicum and S. pimpinellifolium. Allele freq. diff. is the difference in allele frequency calculated between resistant and susceptible groups (table 3-12) Table Z calculation of the distance from each marker associated with late blight (LB) resistance to a resistance gene. Parental Resis is the number of LB resistant individuals with the parental genotype and phenotype. Parent Sus is the number of LB susceptible individuals with a recombination event between the genotype and phenotype. Recomb Resis is the number of LB resistant individuals with a recombination event between the genotype and phenotype. Recomb Sus is the number of LB susceptible individuals with a recombination event between the genotype and phenotype. Total is the total number of individuals. Z was calculated as the product of the numbers of recombinant individuals divided by the product of the numbers of parental individuals. RF is the recombination fraction Table 4-1. SSR and CAPS background markers genotyped in resistant F 4 BC 2 individuals that were heterozygous at four foreground loci. Markers were assigned as foreground or background markers using a selective genotyping approach in an F 2 population Table 4-2. Background SSR markers that were genotyped in the F 4 BC 2 individuals that were selected for backcrossing to NCEBR-2. Markers were assigned as foreground or background markers using a selective genotyping approach in an F 2 population Table 4-3. Background SSR markers that were genotyped in the resistant F 4 BC 3 individuals Table 4-4. Additional SSR markers that were genotyped in the three F 4 BC 3 individuals that were selected for backcrossing to NCEBR-2. F indicates that a marker was located in the foreground and B indicates that a marker was located in the background

14 Table 4-5. Chi-square calculations to test 1:1 gene segregation pattern for U and SSR74/SSR223. U is located on chromosome 1 and SSR74 and SSR223 are located on chromosome 10. NC represents NCEBR Table 4-6. Genotypic data at the foreground loci for the F 4 BC 3 individuals and phenotype with respect to LB resistance. U is located on chromosome 1 and SSR74 and SSR223 are located on chromosome 10. NC represents NCEBR xiv

15 xv ACKNOWLEDGEMENTS I would like to first thank my thesis adviser, Dr. Majid Foolad, for helping develop my interest and excitement in plant breeding and for encouraging me to explore new and exciting opportunities throughout my career as a graduate student. I would like to thank my thesis committee chair, Dr. Mark Guiltinan, for his continued support and understanding. I would also like to thank Drs. Surinder Chopra, Dave Huff, and Seogchan Kang for their creative and thoughtful ideas. In addition, I would like to thank Dr. Beth Gugino for sharing her practical knowledge of vegetable production. Dr. Rick Ordway, chair of the genetics graduate program, has provided me with support and encouragement throughout my graduate career. I would like to thank Dr. Hamid Ashrafi for helping me adjust to life as a graduate student and for his help and patience as I developed my laboratory skills. I would also like to thank Matt Kinkade for his practical and thoughtful ideas. Many undergraduate students have assisted with this research, including Matt Dommel, James Cross, Adam Seitz, Brandon Bugay and Greg Crews. I am greatly indebted to my family members. My parents, Jill and Ed Merk, have been a source of strength and support throughout my academic career. My brother, Jeff Merk, has always encouraged me to fight for what I want and what I believe in. My best friend, K. Elizabeth McDonald, has been by my side encouraging me and has always believed in me. Finally, I would like to express thanks to my late grandfather, Mike Worley, for sharing his love for the natural world and his love for learning.

16 Chapter 1 Introduction Significance of the Tomato The cultivated tomato, Solanum lycopersicum L. (formerly Lycopersicum esculentum Mill.), is the second most commonly consumed vegetable crop worldwide (after the potato) and the second most economically important vegetable crop in the U.S. (after the potato) with a farm value greater than $3 billion (FAOSTAT 2005; USDA 2010). Although the tomato does not rank highly in overall nutritional value, it ranks highly in its nutritional contribution to the U.S. diet due to the large volume of fresh tomatoes and processed tomato products consumed (FOOLAD 2007). In addition to the tomato s importance as a vegetable crop, the tomato serves as a model plant for basic and applied research, including disease resistance and fruit shape, size, development, and ripening (GUPTA et al. 2009). Reasons for the tomato s utility as a model plant include: ease of growing, short life cycle, ease of hybridization, ease of transformation, high reproductive potential, and relatively small genome size as discussed in detail by Foolad (2007). There is also a wealth of publicly available genetic information about the tomato, including cytological, genetic and physical maps, expressed sequence tags (ESTs), bacterial artificial chromosome (BAC) libraries, and partial genome sequence (FOOLAD 2007; GUPTA et al. 2009). Once available, the completed tomato genome sequence and annotation will add even more value to the species as a model system. The tomato is a particularly important model system within the Solanaceae family. In addition to the tomato, the Solanaceae family contains over 3000 species, many of them valuable crop species, including potato, eggplant, pepper, petunia, and nicotiana. Among the Solanaceae

17 2 family, the tomato has the smallest haploid genome size at 953 MB and the genome encodes approximately genes (VAN DER HOEVEN et al. 2002). Members of the Solanaceae family have a high degree of synteny, as demonstrated by the fact that there are only five chromosomal inversions differentiating tomato and potato and their most recent common ancestor is believed to be only 7.3 million years old (BONIERBALE et al. 1988; TANKSLEY et al. 1992; WU and TANKSLEY 2010). Furthermore, 28 genome rearrangements (23 paracentric inversions and five translocations) differentiate tomato and eggplant (DOGANLAR et al. 2002a). In addition, five translocations, ten paracentric inversions, two pericentric inversions, and four disassociations/associations differentiate tomato, potato, and pepper (LIVINGSTONE et al. 1999). Thus, information gained about the tomato is highly applicable to other members of the Solanaceae. For example, the aforementioned genome structure studies were possible because restriction fragment length polymorphism (RFLP) markers developed for tomato could be mapped in potato and pepper and vice-versa. Tomato Genetic Diversity The economic and dietary importance of the tomato makes breeding high quality tomatoes essential. Abiotic stresses, biotic stresses, changes to these stresses, as well as changes in consumer and producer preference make development of new tomato cultivars a constant priority. However, within the cultivated tomato (S. lycopersicum), there is little genetic diversity. Rick (1982) purports that this narrow germplasm base is due in part to genetic bottlenecks that occurred when the tomato was exported northward from the Andes to Mexico and Central America, where it was domesticated, then to Europe and back to the new world. Furthermore, many modern cultivars were derived from European ancestors, which had already undergone at least one genetic bottleneck event (RICK 1976). In fact, S. lycopersicum is estimated to contain a

18 3 mere five percent of the genetic diversity within tomato species (MILLER and TANKSLEY 1990). This lack of genetic variation within the cultivated tomato has meant that breeders often cannot find a desired trait within S. lycopersicum, thereby forcing breeders to search for traits of interest in wild tomato species (RICK 1982). Incorporating traits from wild species can vastly increase the length of a breeding project due to linkage drag and often several generations of pre-breeding. The tomato s close wild relatives are S. pimpinellifolium, S. galapagense, S. cheesmanii, S. chmielewskii, S. peruvianum, S. habrochaites, and S. pennellii (MILLER and TANKSLEY 1990; RODRIGUEZ et al. 2009). The precise evolutionary relationships are still debated, however, it is generally agreed that S. pimpinellifolium is the closet relative of the cultivated tomato (RODRIGUEZ et al. 2009). Like S. lycopersicum, and unlike most other tomato wild relatives, S. pimpinellifolium is a red-fruited species. These qualities and additional characteristics make S. pimpinellifolium a desirable species from which to introduce new alleles. However, the close evolutionary relationship between S. lycopersicum and S. pimpinellifolium means there are relatively few genetic differences between the species, which hampers genetic analyses such as genetic mapping and gene isolation. Genetic Mapping in Tomato Genetic mapping plays an extremely important role in genetic analyses, including germplasm characterization, gene mapping and tagging, gene introgression, marker-assisted selection, and map-based cloning (BERNATZKY and TANKSLEY 1986c; GRANDILLO and TANKSLEY 1996). Botstein et al. (1980) proposed the use of RFLP markers, the first DNA markers. They used these markers to develop a genetic linkage map based on DNA sequences in humans. Six years later, the first tomato linkage map based on DNA markers (as opposed to morphological and isozyme markers) was developed (BERNATZKY and TANKSLEY 1986c). The

19 4 map was constructed using isozyme and RFLP marker data from 46 F 2 progeny derived from hybridizations between the S. lycopersicum inbred line LA1500 and S. pennellii accession LA716 (BERNATZKY and TANKSLEY 1986c). The map included 18 isozyme markers and 94 RFLP markers (BERNATZKY and TANKSLEY 1986c). This was a landmark moment not only in tomato genetics, but also in plant genetics. Bernatzky and Tanksley (1986c) tout the utility of genetic linkage maps to increase efficiency in introgression of desirable traits from wild species into cultivated crop plants by reducing linkage drag. Since the publication of Bernatzky and Tanksley s first genetic map, more than 25 linkage maps have been constructed using S. lycopersicum as one of the parents (FOOLAD 2007). To date, the majority of genetic maps have been constructed using distantly related wild species, such as S. pennellii. In addition, the high-density tomato linkage map was developed using S. pennellii accession LA716. The first high-density linkage map was constructed based on data from 67 F 2 individuals genotyped with over 1000 molecular markers (TANKSLEY et al. 1992). Since then, the marker density has increased substantially. The high-density map now includes over 2500 molecular markers (MUELLER et al. 2005a). Despite the plethora of polymorphic molecular markers identified between distantly related tomato species, there are a limited number of molecular markers that detect polymorphism within S. lycopersicum or between S. lycopersicum and its closest wild relative, S. pimpinellifolium (BRETO et al. 1993; LABATE and BALDO 2005; MILLER and TANKSLEY 1990; YANG et al. 2004). To date, seven linkage maps based on hybridizations between S. lycopersicum and S. pimpinellifolium have been developed. However, only three S. pimpinellifolium accessions (LA722, LA1589, and LA2093) have been used to develop these linkage maps. LA1589 was used to develop four of the seven maps. Furthermore, LA1589 was selected based on phenotypic differences in fruit quality, growth habit, and availability of DNA markers that were polymorphic between this accession and S. lycopersicum, not potential breeding utility (DOGANLAR et al.

20 5 2002b). As such, genetic maps developed using LA1589 as a parent have been useful only in the realm of basic science. Grandillo and Tanksley (1996) were the first to construct a genetic map of a population derived from hybridizations between S. lycopersicum and S. pimpinellifolium. The map was constructed in a BC 1 population with LA1589 as the S. pimpinellifolium parent (GRANDILLO and TANKSLEY 1996). This map was primarily based on RFLP markers and was in agreement with the first high-density tomato map (GRANDILLO and TANKSLEY 1996; TANKSLEY et al. 1992). Although there was no difference in the overall recombination level between maps, there were differences in the distribution of recombination (GRANDILLO and TANKSLEY 1996). Lippman and Tanksley (2001) subsequently developed an F 2 map with S. lycopersicum and S. pimpinellifolium accession LA1589 as the parents. They used this map to identify and analyze quantitative trait loci (QTLs) contributing to extremely large fruit size (LIPPMAN and TANKSLEY 2001). Similarly, van der Knaap et al. (2002) developed another F 2 map with S. lycopersicum and S. pimpinellifolium accession LA1589 as parents to identify QTLs contributing to fruit shape so that they could better understand fruit morphology. Doganlar et al. (2002b) developed a series of inbred backcross lines (IBLs) that originated from hybridizations between S. lycopersicum and LA1589. Using these lines, they identified 71 QTLs that contributed to fruit quality, flowering, and plant growth and development (DOGANLAR et al. 2002b). Chen and Foolad (1999) were the first to create a genetic map using a different S. pimpinellifolium accession as a parent. They developed a BC 1 map using S. pimpinellifolium accession LA722 (CHEN and FOOLAD 1999). LA722 is highly valuable agriculturally due to its salt tolerance, disease resistance, and fruit quality (CHEN and FOOLAD 1999). The map includes 151 RFLP markers that were genotyped in 119 individuals (CHEN and FOOLAD 1999). Sharma et al. (2008) developed an F 2 map using S. pimpinellifolium accession LA2093 as a parent. LA2093 is also valuable agriculturally due to its salt tolerance, early blight resistance, and fruit quality (ASHRAFI et al. 2009; SHARMA et al. 2008). The map includes 250 molecular markers (mainly RFLPs) that were genotyped in 172

21 6 individuals (SHARMA et al. 2008). More recently, a RIL map was developed based on the same initial cross (ASHRAFI et al. 2009). The RIL map includes 294 molecular markers (mainly RFLPs) that were genotyped in 170 individuals (ASHRAFI et al. 2009). Although these maps have increased the population sizes and number of molecular markers used to develop the maps, the majority of mapped DNA markers are still RFLP-based. RFLP markers are undesirable for reasons including high cost, labor intensity, speed of genotyping, high demand for plant tissue and good quality DNA. Recently, there has been a shift towards incorporating more polymerase chain reaction (PCR) based markers due to reduced costs, the ease of PCR, the speed of genotyping, and the low demand for plant tissue. In 2005, Frary et al. added 152 PCR-based markers to the high-density tomato map (FRARY et al. 2005; TANKSLEY et al. 1992). In addition to the PCR-based markers that have been mapped, there is a plethora of unmapped PCR-based markers. For example, Van Deynze et al. (2007) analyzed tomato EST sequences conserved between tomato and Arabidopsis. They identified 785 single nucleotide polymorphisms (SNPs) among 12 tomato cultivars (VAN DEYNZE et al. 2007). The conserved nature of the EST sequences analyzed allows the SNPs to be assayed in other Solanaceous species. In addition, the increasing public availability of DNA sequence greatly increases the potential to develop new DNA markers. Tomato Genome Sequencing The availability of tomato genome sequence will be of great assistance to genetic mapping and cloning. Mining the genome sequence will allow rapid development of large numbers of new PCR-based markers. For example, Feltus et al. (2004) aligned draft genome sequences of the Oryza subspecies indica and japonica and predicted over potentially polymorphic SNPs and insertions or deletions (Indels) using an in silico approach. Direct

22 7 sequencing evidence suggests that approximately 80% of the polymorphisms were real (FELTUS et al. 2004). Crop plants with sequenced genomes include rice, Oryza sativa L. (GOFF et al. 2002; YU et al. 2002) and maize, Zea mays L. (SCHNABLE et al. 2009). Draft genome sequences are available, or will soon be available, for a number of other crop species, including tomato and potato (MUELLER et al. 2009; VISSER et al. 2009). The international tomato genome sequencing project focuses on sequencing the tomato euchromatin using a map-based, BAC-by-BAC approach (MUELLER et al. 2009; MUELLER et al. 2005b). The tomato euchromatin was selected for sequencing as it comprises less than 25% of the genome, but is predicted to contain close to 90% of the predicted tomato genes (MUELLER et al. 2009; MUELLER et al. 2005b; VAN DER HOEVEN et al. 2002; WANG et al. 2006). To complement the BAC genome sequence, preliminary shotgun whole genome sequence is available (MUELLER et al. 2009). The same approach is being used to sequence the potato genome (VISSER et al. 2009). Advances in knowledge of genetic diversity, molecular markers, and genetic mapping are crucial to breeding efforts for crop improvement. Along with increased yield and fruit quality, increased disease resistance is a key focus of crop improvement. Significance of Late Blight Diseases are a primary concern in the tomato industry, with late blight (LB) ranked as the 8 th most important disease in the U.S. based on weighted crop loss per acre (FOOLAD et al. 2008). Annual costs of LB control and losses attributed to LB in potato and tomato have been estimated in excess of $5 billion (JUDELSON and BLANCO 2005; LOKOSSOU et al. 2009). In addition to affecting tomatoes and potatoes, LB can also affect other members of the Solanaceae family, including eggplant, pepper, nightshade species, and petunia (BECKTELL et al. 2006). Late blight

23 8 can quickly destroy potato and tomato plants, with infection occurring at any time during the plant s life cycle. Late blight can attack any above-ground portion of the plant as well as potato tubers. Leaf infection typically begins at leaflet margins with the appearance of necrotic black or dark brown water-soaked lesions. These lesions may have pale yellow/green borders that blend into healthy tissue. Under moist conditions, white, fluffy sporangia may develop on the leaf s abaxial side. Eventually leaflets shrivel and die, and the plant may completely defoliate due to disease. Stem lesions caused by LB typically first appear at the plant s apex or at leaf nodes. The dark brown, soft lesions may subsequently spread down the rest of the stem (SEAMAN et al. 2010). Tomato fruit infected by LB develop brown and greasy lesions at the stem-end and sides of green fruit, rendering the fruit unmarketable. In potato, infected potato tubers have dry rot and brown or purple depressed lesions, rendering them unmarketable (SEAMAN et al. 2010). Late blight s precise geographic origin remains unknown, with competing theories purporting that it originated in the South American Andes or Central Mexico s Toluca valley (ANDRIVON 1996; BOURKE 1964; GOMEZ-ALPIZAR et al. 2007; GRUNWALD and FLIER 2005). debary (1876) proposed the Andean theory shortly after the 19 th century Irish potato famine, arguing that LB must have originated in the same region as its Solanaceous hosts. The Andean theory has been disputed and the Central Mexico theory has been supported as early as 1939 based on three lines of evidence (REDDICK 1939). First, wild potato species grow outside of the Andes. Second, wild potato species resistant to LB have been found in Central Mexico. Third, Solanaceous species other than the potato can serve as hosts for P. infestans. Tooley et al. (1989) provided genetic evidence that P. infestans could have been introduced to Europe from the Andean region. However, their results support the Central Mexico theory of P. infestans origin (TOOLEY et al. 1989). DNA fingerprinting provided further support of a Central Mexican theory of origin (GOODWIN et al. 1994). The evidence provided by Tooley et al. (1989) and Goodwin et al. (1994) is based on the assumption that a species center of diversity is also its center of origin,

24 9 which may not be correct (HARLAN 1971). More recent sequence analysis based on two nuclear genes and three mitochondrial genes support the Andean theory of origin (GOMEZ-ALPIZAR et al. 2007). Late blight was first detected outside of Central and South America in 1843, when it was reported in the northeastern U.S. (ANDRIVON 1996; FRY and GOODWIN 1997a). In Europe, LB was first detected in Belgium in June 1845 (BOURKE 1964). By September 1845, LB had been reported in the Netherlands, France, and Northern Ireland, marking the beginning of the infamous Irish potato famine (BOURKE 1964). The Irish potato famine led to the death of more than a million people and the emigration of a similar number, the majority of whom settled in the northeastern U.S. (FRY and GOODWIN 1997b). Though infamous for its role in the Irish potato famine, LB has been reported in all regions of the world, including Canada and the U.S. (DEAHL et al. 1991), Ecuador (KROMANN et al. 2008), Hungary (BAKONYI et al. 2002), Isreal (COHEN 2002), Nepal (GHIMIRE et al. 2003), Peru (TOOLEY et al. 1989), Switzerland (HOHL and ISELIN 1984), Taiwan (DEAHL et al. 2002), and Uganda (OCHWO et al. 2002). These studies indicate that P. infestans populations are diverse and they have changed over time. Recent changes in P. infestans populations are likely due to sexual reproduction as discussed below (RUBIN and COHEN 2004). Late blight is a notorious and devastating plant disease due to four characteristics of its causal pathogen, P. infestans. These characteristics are discussed by Fry and Goodwin (1997b) and Foolad et al. (2008). To begin with, low levels of the disease are difficult to detect. Thus growers may be initially unaware their crops are infected. In addition, once LB is detected, it may be too late to save the crop using fungicides, as there is wide-spread and rapidly evolving systemic fungicide resistance. Nearly all P. infestans isolates are resistant to the systemic metalaxyl fungicides, which are fungicides that were in widespread use in the 1970s (GISI and COHEN 1996). In addition to difficulties to detecting LB and fungicide resistance, P. infestans can

25 10 complete its asexual disease life cycle within five days. Finally, each LB lesion has the potential to produce hundreds of thousands of infection-causing sporangia per day. The rapid progression of the disease cycle combined with the high potential for dispersal gives P. infestans the potential to destroy crops within seven to ten days of infection. P. infestans potential to rapidly and uncontrollably cause disease and spread disease makes adequate crop protection essential. Until the late 1970s, LB was well managed through the use of cultural practices, frequent and timely fungicide application, and growing moderately-resistant potato cultivars (FOOLAD et al. 2008). Late blight re-emerged as an important plant disease in Europe in the early 1980s and North America in the late 1980s. Fry and Goodwin (1997a) discuss two major reasons why LB s re-emergence is of great concern. First, prior to the 1980s, only the A1 mating type of P. infestans was found outside of Mexico (GALLEGLY and GALINDO 1958). As a heterothallic organism, P. infestans requires the A1 and A2 mating types to be present in order for sexual reproduction to occur (JUDELSON 1997). The A2 mating type was identified in Europe in 1981 and North America in 1991 (DEAHL et al. 1991; HOHL and ISELIN 1984). The presence of the A1 and A2 mating types together outside of Mexico created the opportunity for sexual reproduction to occur and for the generation of new, more aggressive P. infestans isolates. This situation was realized in 1993 with the appearance of the sexually derived US-11 clonal lineage (GAVINO et al. 2000). US-11 was extremely aggressive on tomato crops in the Pacific Northwest, the Northeast, and California (GAVINO et al. 2000). The emergence of new and aggressive P. infestans isolates makes disease control essential. In addition to creating new isolates, sexual reproduction in P. infestans produces oospores, which can overwinter in fields, unlike the zoospores produced during asexual reproduction (FOOLAD et al. 2008). If oospores overwinter, they are a source of inoculum for the following growing season (GAVINO et al. 2000). McDonald and Linde (2002) theorized that the

26 11 widespread potential for sexual reproduction in P. infestans greatly increased the risk of host resistance breakdown. The second concern associated with LB s re-emergence is the appearance of metalaxyl resistant isolates. Although the appearance of metalaxyl resistance nearly coincided with the appearance of the A2 mating type outside of Mexico, there does not appear to be a genetic relationship between the two events (GISI and COHEN 1996). Metalaxyl resistance was of great concern to tomato and potato growers because metalaxyl fungicides were the only systemic fungicides available to control LB (GISI and COHEN 1996). Systemic fungicides slow or inhibit disease progress once disease symptoms are apparent. The problems associated with fungicide resistance have made the use of cultivars with genetic LB resistance more attractive and appealing (FOOLAD et al. 2008). Phytophthora infestans Historically classified as a fungus, P. infestans (Mont.) de Bary belongs to the oomycetes, a group that includes water moulds and plant, animal and microbial pathogens. P. infestans and fungi both grow via production of mycelia and propagate by producing spores (GOVERS and GIJZEN 2006). Furthermore, they both generate appressoria and haustoria and produce cell-wall degrading enzymes to aid in invasion (GOVERS and GIJZEN 2006; JUDELSON and BLANCO 2005). However, differences in physiology, biochemistry, and genetics separate P. infestans and fungi (GOVERS and GIJZEN 2006). Recent DNA sequence analyses provide further confirmation that fungi and oomycetes are only distantly related (BURKI et al. 2007). P. infestans has been classified into clonal lineages, which are defined as the asexual descendents of different genotypes (FRY and GOODWIN 1997a). These classifications are based on mating type (A1 or A2) and genotypes for isozyme and RFLP markers (GOODWIN S. B. et al.

27 ; GOODWIN et al. 1994). US-1 (A1 mating type) was the first clonal lineage described and was likely the only lineage present outside of Mexico until the late 1970s, when additional clonal lineages, including those with A2 mating type appeared (GOODWIN et al. 1994). By 1993, US-1 represented less than eight percent of the P. infestans North American population (GOODWIN et al. 1998). US-1 has been replaced by more than a dozen clonal lineages, the most important of which are US-7, US-8, US-11, and US-17 (GAVINO et al. 2000). US-8 has been particularly aggressive on potato foliage and tubers, leading to its widespread use in potato disease screening and breeding programs (CHEN et al. 2003; DOUCHES et al. 2001; DOUCHES et al. 1997; KIRK et al. 2001). Conversely, US-11 and US-17 have been particularly devastating to tomatoes (DAAYF and PLATT 2003; GAVINO et al. 2000). Life Cycles The characteristics of P. infestans asexual and sexual life cycles play an important role in its potential to cause disease. P. infestans asexual cycle of rapid reproduction is conducive to disease propagation. Conversely, P. infestans sexual cycle can create new isolates of the pathogen. P. infestans asexual life cycle (the disease cycle) was first described over 130 years ago by Anton debary (1876). For a thorough review of the asexual and sexual life cycles, see Judelson (1997). Cool, humid and foggy or rainy conditions favor disease development. The disease cycle begins when sporangia (spore-containing structures) land on moist plant tissue. The next stage of the disease cycle is temperature-dependent. When the temperature is above 21 C, sporangia germinate on host tissue in a process that lasts between eight and forty-eight hours. Below 21 C, and therefore under temperatures most conducive to disease development, up to eight biflagellate zoospores are released from the sporangia. The zoospores penetrate through the moisture on top

28 13 of the host tissue, lose their flagella, encyst, and release adhesive glycoproteins within one minute (JUDELSON et al. 2008). After two hours, germ tubes extend out of the encysted zoospores. The germ tubes swell and differentiate into appressoria. Appressoria release hydrolytic enzymes that allow P. infestans to invade the host tissue using a penetration peg. This process is aided by the physical pressure exerted by the appressoria. Inside the host, the penetration peg develops into intercellular hyphae. The hyphae travel between host cells and use haustoria to feed in the host mesophyll. Haustoria formation and maturation takes up to 15 hours (AVROVA et al. 2008). Hyphae and haustoria are required for successful host colonization (AVROVA et al. 2008) and furthermore, both release effectors, which eventually lead to gross disease symptoms (WHISSON et al. 2007). Host colonization occurs optimally between 21 and 24 C and disease symptoms typically develop between five and ten days post-inoculation. Soon after initial the appearance of disease symptoms, sporangiophores emerge from the host stomata and subsequent sporulation occurs to produce sporangia. The sporangia release zoospores, allowing for aerial disease transmission and spread of disease. If the temperature rises above 35 C, the disease cycle halts. However, P. infestans can survive in living host tissue until conditions favorable for disease progress return. As previously alluded to, the sexual life cycle requires that the two P. infestans mating types, A1 and A2, interact (GALLEGLY and GALINDO 1958). A1 and A2 are compatibility types determined by mating hormones (reviewed by (JUDELSON 1997). Diploid mycelia of the two mating types interact and mating hormones induce formation of the haploid gametangia (antheridia and oogonia). Gametangia formation occurs optimally between 15 and 18 C (SHEN et al. 1983). An antheridium fuses with an oogonium to produce a diploid oospore. Under favorable conditions, oospores release diploid progeny that have either the A1 or A2 mating type. Unlike the fragile, airborne, biotrophic zoospores produced during asexual reproduction, oospores produced during sexual reproduction can survive harsh conditions outside a living plant host.

29 14 Thus, sexual reproduction in P. infestans creates new genotypes and allows the pathogen to persist in the environment. P. infestans potential to rapidly reproduce, produce hardy oospores, and generate new genotypes makes P. infestans a potentially devastating plant pathogen when conditions are cool and damp. Understanding P. infestans life cycles is important and essential to controlling LB. Knowledge of P. infestans life cycles can be useful in fungicide development and searching for host resistance. Fungicide application and host resistance are essential disease control and prevention measures. In addition, knowledge of a pathogen s life cycle is essential for assessing the potential for resistance breakdown. Using population genetics theory, McDonald and Linde (2002) propose that the combination of P. infestans rapid disease cycle and the potential for occasional sexual reproduction has greatly increased the risk for host resistance breakdown. Genome Sequencing The first Phytophthora genome sequences were reported in 2006 (TYLER et al.), though the genome sequence of P. infestans was not reported until 2009 (HAAS et al. 2009). The P. infestans genome is 240 MB, the largest reported for an oomycete (TYLER et al. 2006). Reportedly, 74% of the P. infestans genome contains repetitive DNA (HAAS et al. 2009). The three-fold expansion of the P. infestans genome is due to dynamic transposon activity, particularly in the genomic regions with highly repetitive sequences and genes coding for secreted effector proteins and genes expressed during infection (GIJZEN 2009; HAAS et al. 2009; JIANG et al. 2005). Analysis of the P. infestans genome resulted in identification of more than 550 RXLR-EER effectors in the P. infestans genome (HAAS et al. 2009). Haas et al. (2009) hypothesized that transposon activity in the highly repetitive genomic regions may allow for recombination events, leading to high rates of gain and loss of effector gene function. Therefore,

30 P. infestans genome expansion is believed to play an important role in the pathogen s ability to rapidly overcome host resistance (HAAS et al. 2009). 15 Disease Dynamics Qualitative and Quantitative Disease Resistance It is widely theorized that pathogens and hosts continually battle in an evolutionary arms race for survival. Flor (1955) observed that disease response in flax, Linum usitatissimum L., depended on factors present in flax and flax rust, Melamspora lini (Pers.) Lev. These observations led Flor to propose the gene-for-gene model (FLOR 1955). According to the genefor-gene model, the host s resistance gene product (known as an R gene product) interacts with the pathogen s pathogenicity product (known as an avirulence gene product). Resistance to bacterial speck in tomato, caused by Pseudomonas syringae pv. tomato, is a classic example of a gene-for-gene interaction. In this gene-for-gene interaction, the tomato resistance gene product, Pto, interacts with P. syringae avirulence gene product AvrPto (MARTIN et al. 1993). This type of resistance is known as race-specific resistance, qualitative resistance, single gene resistance, or vertical resistance. As the name implies, race-specific resistance typically confers disease resistance to one, or a few, races of a pathogen. Subsequently, racespecific resistance is typically ineffective, or broken down, when new races of the pathogen emerge. Numerous genes conferring race-specific resistance to tomato pathogens have been incorporated into tomato breeding material. These diseases include Fusarium oxysporum, Verticillium dahliae, Stemphylum, Tomato mosaic virus, and Tomato spotted wilt virus (SCOTT 2005).

31 16 Conversely, race non-specific resistance, which is also known as quantitative resistance, polygenic resistance, field resistance, or horizontal resistance, typically confers partial disease resistance to multiple races of a pathogen. Race non-specific resistance often slows, but does not stop, disease progress. Race non-specific resistance has been reported for several plant diseases, including maize gray leaf spot, Cercospora zeae-maydis (YOUNG 1996), rice blast fungus, Pyricularia oryzae (YOUNG 1996), tomato bacterial wilt, Ralstonia solanacearum (CARMEILLE et al. 2006), and tomato early blight, Alternaria tomatophila Simmons (FOOLAD et al. 2002b; ZHANG et al. 2003). Although more desirable to breeders due to its potential durability, race nonspecific resistance s multi-genic nature makes the resistance more difficult to breed for. Pathogen Host Interactions To defend against pathogens, plants have evolved three major layers of defense. To overcome or evade host plant defenses, pathogens secrete molecules called effectors. Recently, P. infestans has been used as a model pathogen to study the molecular co-evolution of hosts and aerial pathogens causing foliar infection. This is evidenced by the large number of recent reviews on the subject (see (HEIN et al. 2009; SCHORNACK et al. 2009; TYLER 2009). Studies have focused on identifying effectors, the roles of effectors, and effector targets. In an integrated fashion, this section will discuss the levels of plant host defense and mechanisms evolved by pathogens to try to overcome the host s defenses. The first layer of plant defense includes the cuticle and cell wall, which are preformed physical barriers that pathogens must overcome to infect hosts. There is limited knowledge with respect to molecular interactions between pathogens and hosts at this level. Polysaccharides in host cell walls have been purported to play a role in disease resistance (VORWERK et al. 2004). However, few studies have identified genetic differences in cell wall components within a

32 17 species. When differences have been identified, there has been no way to isolate the effects of host cell wall components (VORWERK et al. 2004). The second layer of plant defense is induced by conserved molecules secreted by pathogens, or conserved molecules displayed on the pathogen s surface, called pathogenassociated molecular patterns (PAMPs). Characterized PAMPs include bacterial flagella, coldshock proteins, lipopolysaccharides, elongation factor Tu, chitin, beta glucans, and ergosterol (HEIN et al. 2009). In oomycetes, most PAMPs are secreted proteins. Some oomycete PAMPs have characteristics of enzymes or protein toxins (HEIN et al. 2009). A 2003 computational study of over 2100 P. infestans ESTs led to identification of two necrosis-inducing proteins crn1 and crn2 (TORTO et al. 2003). Crn2 was shown to induce tomato defense response genes and was suggested to act as a PAMP. Plant defense to counter PAMPS is referred to as PAMP-triggered immunity (PTI). The role of PTI is to prevent pathogen colonization and infection, though PTI does not affect the growth of the pathogen (BIRCH et al. 2009; INGLE et al. 2006). In oomycete hosts, PTI responses include: ion fluxes, mitogen-activated protein kinase (MAPK) cascades, production of reactive oxygen species (ROS), cell wall reinforcement, and rapid defense gene induction (HEIN et al. 2009). PAMP binding triggers downstream signaling events and eventually leads to host basal resistance induction (INGLE et al. 2006). Pathogens, including P. infestans, secrete molecules called effectors to evade PTI and aid in host evasion and successful host colonization. Effector-triggered immunity (ETI) is the third and most specialized layer of plant defense. During ETI, plant resistance proteins (R proteins) detect P. infestans effectors. Effectortriggered immunity often results in the hypersensitive response to control the spread of the pathogen (INGLE et al. 2006). During the hypersensitive response, the plant host induces localized cell death of the infected plant tissue. If the pathogen requires living host tissue, the hypersensitive response can be effective means of defense. Effectors can be detected directly or

33 18 indirectly. Direct interaction is hypothesized to occur in a gene-for-gene manner as described in the host-pathogen interactions section. Conversely, indirect interaction is hypothesized to follow the Guard Hypothesis (BIRCH et al. 2009). The Guard Hypothesis purports that R proteins continually survey host defense proteins for alterations caused by effectors (BIRCH et al. 2009). A detected effector is referred to as an avirulence protein (avr protein). Recently, several P. infestans effectors have been studied in detail and will be discussed below. Phytophthora infestans Effectors Broadly defined, effectors are secreted molecules that alter host cell structure or influence disease response (KAMOUN 2006). Effectors may be apoplastic or cytoplasmic depending on where they are targeted. Apoplastic effectors are targeted outside host cells. Conversely, cytoplasmic effectors are targeted to the host cytoplasm. Two sets of studies have identified hydrolases as apoplastic effectors in P. infestans. Damasceno et al. (2008) studied four glucanase inhibitor proteins, which are apoplastic effectors in P. infestans. The glucanase inhibitors target plant glucanases, which break down glucans in oomycete cell walls (DAMASCENO et al. 2008). Several studies led by Tian have focused on the Kazal family of serine protease inhibitors that target interactions between P. infestans and tomato (TIAN et al. 2005; TIAN et al. 2004; TIAN et al. 2007). Studies in 2004 and 2005 identified two serine protease inhibitors that target a tomato protease (TIAN et al. 2005; TIAN et al. 2004). The 2007 study identified two additional P. infestans protease inhibitors that belong to the cystatin class of glucanases (TIAN et al. 2007). All of the aforementioned apoplastic effectors share an N-terminal peptide for secretion and a C- terminal effector module, but no other host targeting signal (SCHORNACK et al. 2009). Although studies of apoplastic effectors are limited, they have provided some insight into P. infestans apoplastic effectors.

34 19 Many more studies have identified and studied P. infestans cytoplasmic effectors. All oomycete cytoplasmic effectors identified to date belong to the RX-LEER family of effectors (ARMSTRONG et al. 2005; SCHORNACK et al. 2009). The RXLR portion of the N terminal region, important for host targeting, appears conserved across Phytophthora species and the distantly related malaria parasite, Plasmodium falciparum (BHATTACHARJEE et al. 2006). This suggests that the N terminal region may be widely conserved in the effectors of eukaryotic pathogens. As discussed in the P. infestans genome sequencing section, more than 550 RXLR-EER effectors have been identified in the P. infestans genome (HAAS et al. 2009). Prior to the sequencing of the P. infestans genome, potential secreted effector proteins in P. infestans were screened on a large scale using the yeast secretion trap and analysis of EST libraries. These searches were greatly facilitated by such knowledge by validation of the concept that oomycete effectors must be secreted because such effectors typically contain signal peptides that can be detected through computational analyses (KAMOUN 2006). To identify P. infestans secreted proteins on a large scale, Lee et al. (2006) employed the yeast secretion trap technique. Interestingly, the majority of P. infestans secreted proteins did not correspond to genes with known function. In addition, these proteins were detected only during pathogenesis. The secreted proteins with known function included an extracellular metallopeptides, a cutinase and an elicitor of the hypersensitive response. A 2003 EST mining approach to identify effector proteins in P. infestans led to identification of 147 potential effector genes in P. infestans (TORTO et al. 2003). With the advent of cloning LB resistance genes in potato, P. infestans genes that interact with specific potato LB resistance genes have been identified and analyzed. Using an association genetics approach, Armstrong et al. (2005) demonstrated that one of the ESTs identified by Torto et al. (2003) was Avr3a. Avr3a is recognized in the cytoplasm by the S. demissum LB resistance gene, R3a, which will be discussed in the LB resistance genes section (ARMSTRONG et al. 2005). Furthermore, recognition triggers the hypersensitive response (ARMSTRONG et al. 2005). In a

35 20 further study, Bos et al. (2006) concluded that only the C terminal half of Avr3a was required to trigger the hypersensitive response. This led to the assertion that the RxLR-EER N terminus is required for effector secretion and targeting (BOS et al. 2006). Whisson et al. (2007) further studied Avr3a-R3 interactions and found that the RxLR-EER motif is not required for effector secretion from the haustoria, but is required for translocation. This result was confirmed by Grouffaud et al. (2008). Whisson et al. (2007) also found that RxLR-EER genes are up-regulated during infection. A second effector protein recognized by a S. demissum LB resistance gene protein has been studied. Using a combination of genetic mapping, transcriptional profiling, and BAC marker landing, PiAvr4 was isolated (VAN POPPEL et al. 2008). PiAvr4 and the S. demissum LB resistance gene interact in a gene-for-gene manner. Two motifs in the C terminal domain are responsible for triggering the hypersensitive response (VAN POPPEL et al. 2009). Although PiAvr4 contains an RxLR-dEER motif, van Poppel et al. (2008) could not determine whether or not PiAvr4 is an apoplastic or a cytoplasmic effector due to conflicting experimental results and the absence of an isolated R4 gene. They suggested that further studies are necessary to explore the possibility that PiAvr4 is an abnormal avirulence gene. Based on the knowledge that a large number of effectors contain RXLR motifs, Vleeshouwers et al. (2008) hypothesized that genes coding for RXLR motifs were candidate Avr genes. Using expression analyses with candidate Avr genes, Vleeshouwers et al. (2008) identified an avirulence gene that corresponded to an LB resistance gene in S. bulbocastanum named RB (for Resistance to Bulbocastanum). Independently, Oh et al. (2009) identified and isolated the avirulence genes. Vleeshouwers et al. (2008) named the avirulence gene Avr-blb1. Avr-blb1 is a group of at least 16 variants belonging to a small family of rapidly evolving genes (CHAMPOURET et al. 2009; VLEESHOUWERS et al. 2008). Although many of these variants elicited a hypersensitive response when co-expressed with RB, at least one variant did not (CHAMPOURET

36 21 et al. 2009; OH et al. 2009). These results suggested that at least one Avr-blb1 gene has evolved to evade host detection (HALTERMAN et al. 2010). Vleeshouwers et al. (2008) also suggested that R genes identified in S. papita (Rpi-pap1) and S. stoloniferum (Rpi-sto1) recognized Avr-blb1. To identify and characterize additional P. infestans effectors Oh et al. (2009) employed an allele mining strategy in combination with an In planta assay. Beginning with 62 nonredundant RXLR effectors, Oh et al. (2009) identified Avr-blb2, a P. infestans effector that corresponded to the S. bulbocastanum R gene, Rpi-blb2. Avr-blb2 has an RXLR motif, though it lacks a deer motif at its N terminus (OH et al. 2009). This was contrary to previous evidence, which indicated that the deer motif was necessary for host translocation (BHATTACHARJEE et al. 2006; OH et al. 2009; WHISSON et al. 2007). To address this contradiction, Oh et al. (2009) hypothesized that the motif adjacent to the RXLR motif may play a similar role to the deer motif. In summary, the reported P. infestans effectors contain a conserved N terminal domain important for host targeting. In general, the effectors appear to interact in a gene-for-gene manner and trigger the hypersensitive response. Late Blight Control Worldwide, the costs associated with LB control and losses due to LB exceed $5 billion annually (JUDELSON and BLANCO 2005; LOKOSSOU et al. 2009). In the U.S., estimated costs of fungicides and crop losses due to LB exceed $210 million annually (GUENTHNER et al. 2001). In addition to fungicides, cultural practices and genetic resistance play important roles in LB control. Cultural practices, fungicide application, and genetic resistance approaches to controlling LB will be discussed in turn.

37 22 Cultural practices have four aims: to minimize inoculum buildup, prevent inoculum introduction from nearby potato cull piles or tomato transplants, minimize infection rate, and generate environmental conditions that are unfavorable to disease development and spread (FOOLAD et al. 2008). The specific actions to meet the aims of cultural control include crop rotation and fallow, eliminating volunteer plants, planting non-infected transplants and tubers, and eliminating potato cull piles (FOOLAD et al. 2008). Eliminating potato cull piles is of particular importance, as cull piles can serve as an overwintering host for P. infestans mycelia. If mycelia overwinter, they can serve as a source of inoculum that has the potential to destroy the following year s crop. Until the re-emergence of LB in the late 1970s, cultural practices and fungicide application effectively controlled LB. Fungicides belong to one of two categories: protectant and systemic fungicides. Growers now rely on protectant fungicides that are applied prior to inoculum arrival based on potential threat of LB. Application of these fungicides is most effective when guided by blight forecasts. Blight forecasts incorporate weather and epidemiological data to try to predict when the disease might occur and the most effective times to apply fungicide (RAPOSO et al. 1993). Conversely, systemic fungicides are applied after disease symptoms have been identified. They attempt to stop or slow the progress of disease symptoms. In the mid-to-late 1970s, metalaxyl fungicides were the primary systemic fungicides used to control LB (GISI and COHEN 1996). Resistance to metalaxyl fungicides was reported as early as two years after introduction of the fungicide (GISI and COHEN 1996). To address this problem, metalaxyl fungicides were only made available in combination with at least one other fungicide with a different mode of action, such as mancozeb or chlorothalonil (RUSSELL 2005). In addition, metalaxyl has been replaced by metalaxyl-m (mefenoxam), an optical isomer (RUSSELL 2005). Additional fungicides have also been recommended to help reduce the appearance of fungicide resistance. For example, in 2009, the Northeastern Integrated Pest Management Center

38 23 recommended rotating the use of the following systemic fungicides to control tomato LB: famoxadone and cymoxanil, cyazofamid, zoxamide and mancozeb, propamocarb HCL, and dimethomorph (WYENANDT et al. 2009). In addition to the development of fungicide resistance, frequent fungicide application is undesirable due to high costs and potential hazards to the environment and to the individuals applying the fungicide. The negative effects associated with fungicide application as well as the potential for new P. infestans isolates make LB control that solely relies on heavy fungicide application undesirable and unsustainable. Using cultivars that are at least partially LB resistant can significantly reduce the number of fungicide applications and the rate of fungicide application (KIRK et al. 2001; SHTIENBERG et al. 1994). In addition, the greater the genetic resistance, the greater the potential to reduce reliance on fungicides (NAERSTAD et al. 2007). Late Blight Genetic Resistance Genetic resistance to LB has been studied much more widely in potato when compared with tomato. However, the high degree of synteny between potato and tomato makes knowledge gained from potato highly applicable to tomato. Thus, in the case of LB resistance, potato may be considered a model for tomato. Therefore, genetic sources of LB resistance will be discussed in potato and tomato. Late Blight Resistance in Potato Potato genes conferring resistance to LB have been reported since 1953 (NIEDERHAUSER and MILLS 1953). The first LB resistance genes were discovered in S. demissum using potato differential lines (MALCOLMSON and BLACK 1966; NIEDERHAUSER and MILLS 1953). Many of

39 24 these genes have since been mapped using traditional genetic mapping approaches. Over the past three years, approaches that take advantage of knowledge of comparative genomics and conserved resistance motifs have led to rapid identification and cloning of new LB resistance genes. The discussion of potato LB resistance will include identification and mapping of resistance genes and QTLs, cloning of resistance genes, and interactions between host and pathogen. The majority of potato LB resistance studies have been conducted using the wild Solanum species S. demissum and S. bulbocastanum. Resistance to LB in these species will be discussed first, followed by other Solanum species. Late Blight Resistance found in Solanum demissum The first 11 LB resistance genes identified in potato belonged to the Mexican hexaploid species S. demissum (nightshade) (NIEDERHAUSER and MILLS 1953). All these genes confer racespecific resistance and exhibit the hypersensitive response (MALCOLMSON and BLACK 1966; NIEDERHAUSER and MILLS 1953). Resistance conferred by S. demissum was introduced to potato cultivars, however, all of these R genes have been overcome by different races of the pathogen (EL-KHARBOTLY et al. 1994; GEBHARDT and VALKONEN 2001; MALCOLMSON 1969; MALCOLMSON 1976; NIEDERHAUSER and MILLS 1953). Seven of the eleven R genes from S. demissum have been mapped to potato chromosomes. R1, the first R gene identified in S. demissum, confers resistance to LB foliar and tuber infection (PARK et al. 2005a). R1 was mapped to chromosome 5, is associated with the potato genomic clones GP21 and GP179, and its location is close to the potato virus X resistance gene (EL-KHARBOTLY et al. 1994; LEONARDS-SCHIPPERS et al. 1992). Subsequently, QTLs conferring LB resistance have also been identified in this region (KUANG et al. 2005; OBERHAGEMANN et al. 1999). This region of potato and tomato chromosome 5 has since been

40 25 identified as a resistance hotspot (ACHENBACH et al. 2010). R1 was also the first LB resistance gene cloned. It was fine-mapped using the map-based cloning approach combined with the candidate gene approach (BALLVORA et al. 2002). Like many other plant disease resistance genes, R1 has a coiled-coil (CC) domain, a putative nucleotide binding domain (NBS), and a leucine rich repeat (LRR) domain (BALLVORA et al. 2002). R2 has been mapped to chromosome 4 through mapping of three tightly linked amplified fragment length polymorphism (AFLP) markers identified using bulked segregant analysis (BSA) (LI et al. 1998). R2 was cloned using a candidate gene allele-mining approach with transient complementation in Nicotiana benthomiana (LOKOSSOU et al. 2009). R2 also contains CC, NBS, and LRR domains (LOKOSSOU et al. 2009). R3 was mapped to the distal end of chromosome 11 and was associated with three RFLP clones in this region; tomato genomic clone TG105a and potato genomic clones GP185 and GP250a (EL-KHARBOTLY et al. 1994). Subsequently, R6 and R7 were associated with GP185 and GP250a, thus R6 and R7 map to the same region of chromosome 11 (EL-KHARBOTLY et al. 1996). This led to the proposal that R3, R6, and R7 were alleles of the same gene or were members of the same resistance gene family (EL-KHARBOTLY et al. 1996). Combining finemapping and accurate disease screening, Huang et al. (2004) determined that R3 was made up of two genes (R3a and R3b), located 0.4 cm apart. R10 and R11 also mapped to the distal region of chromosome 11 (BRADSHAW et al. 2006a). It has been suggested that R10 and R11 are alleles of R3, with R11 acting like a QTL explaining 57% of the LB resistance (BRADSHAW et al. 2006a). R3a was cloned using a comparative genomics approach, where tomato was used as a model Solanaceous species (HUANG et al. 2005). Similar to R1 and R2, R3a has CC, NBS, and LRR domains (HUANG et al. 2005). R4 has proven much more difficult to study. van Poppel et al. (2009) began to resolve this situation with their discovery that the two sets of potato differential lines purported to contain R4 did not recognize the same P. infestans isolates. However, R4 remains unmapped.

41 26 The presence of the NBS-LRR domains in R1, R2, and R3a indicated that these three R genes belong to the intracellular NBS-LRR protein class (HUANG et al. 2005). The presence of this domain suggested that the interaction between R and avr proteins occurs in the plant host cytoplasm (HUANG et al. 2005). Late Blight Resistance found in Solanum bulbocastanum Late blight resistance conferred by the diploid species S. bulbocastanum is unlike the LB resistance conferred by S. demissum LB resistance genes. The resistance, conferred by a single locus named RB, seems to confer resistance more similar to quantitative resistance than qualitative resistance (NAESS et al. 2000; SONG et al. 2003). For example, RB slows disease progress when confronted with a range of P. infestans isolates (NAESS et al. 2000; SONG et al. 2003). However, the LB resistance conferred by RB can be overcome by some existing P. infestans isolates (CHAMPOURET et al. 2009). RB was mapped to chromosome 8 using RAPD and RFLP markers (NAESS et al. 2000; SONG et al. 2003). A physical map was constructed and RB was subsequently cloned using the map-based cloning approach (BRADEEN et al. 2003; SONG et al. 2003). Simultaneously, RB was identified, mapped, and cloned by another group, who named the gene Rpi-blb1 (VAN DER VOSSEN et al. 2003). In addition to genetic mapping and cloning experiments, research has been conducted to study the gene(s) response for the LB resistance conferred by RB. Using an RNA silencing approach (e.g. RNA interference, RNAi), Bhaskar et al. (2008) evaluated the role of RarI and SgtI, two genes known to affect R gene expression (SHIRASU et al. 1999) (HUBERT et al. 2003). RarI and SgtI can interact in-vivo and are hypothesized to play a role in forming or stabilizing R- protein associated recognition complexes (HUBERT et al. 2003). Bhaskar et al. (2008) found that silencing RarI did not impact LB resistance conferred by RB. Conversely, silencing SgtI resulted

42 27 in susceptibility to LB, thereby demonstrating that SgtI is required for LB resistance conferred by RB (BHASKAR et al. 2008). Research has also been conducted to introduce LB resistance conferred by RB to potato breeding material. A PCR-based marker has been developed for RB, allowing for marker-assisted selection (MAS) (COLTON et al. 2006). Furthermore, transgenic lines containing RB have been developed (HALTERMAN et al. 2008). Variability of resistance level within a series of plants of the same cultivar transformed with RB led to studies to ascertain the effect of copy number and transcript number on resistance. Independent studies demonstrated that LB resistance in transformed plants increased as RB copy number or transcript number increased (BRADEEN et al. 2009; KRAMER et al. 2009). A second LB resistance gene, named Rpi-blb2 was subsequently identified in S. bulbocastanum. Rpi-blb2 was originally identified and mapped in complex tetraploid ABPT populations (VAN DER VOSSEN et al. 2005). Because the diploid S. bulbocastanum cannot be directly hybridized with the tetraploid cultivated potato, complex tetraploid hybrids called ABPT were derived from S. acaule, S. bulbocastanum, S. phureja, and S. tuberosum to serve as a bridge species (HERMSEN and RAMANNA 1973). Rpi-blb2 was mapped to chromosome 6 using AFLP markers converted to CAPS markers (VAN DER VOSSEN et al. 2005). The map position was subsequently confirmed using RFLP markers converted to CAPS markers (VAN DER VOSSEN et al. 2005). Rpi-blb2 is a homolog of the tomato gene Mi-1, which confers resistance to root knot nematode, potato aphid, and whiteflies (VAN DER VOSSEN et al. 2005). In addition, the Rpi-blb2 protein and the Mi-1 protein share 82% amino acid sequence similarity (VAN DER VOSSEN et al. 2005). In addition to Rpi-blb1 and Rpi-blb2, a third LB resistance gene has been identified in S. bulbocastanum. Rpi-blb3 was mapped to a 0.94 cm segment of chromosome 4 (PARK et al. 2005b).

43 28 Park et al. (2005c) identified a second LB resistance gene derived from ABPT. They named this gene Rpi-abpt and mapped it to a 0.5 cm interval on chromosome 4 that is part of a gene family. Although Park et al. (2005c) could not definitively determine what species Rpi-abpt originated in, they hypothesized that the gene originated in S. bulbocastanum. Examining marker order and allelic conservation led Park et al. (2005b) to hypothesize that Rpi-blb3, Rpi-abpt, R2, and R2-like are located in the same R gene cluster and may be members of the same gene family. Late Blight Resistance Genes Identified in Other Wild Potato Species Late blight resistance genes have also been identified in the wild potato species S. berhaultii, S. mochiquense, S. phureja, and S. pinnasectum. In S. berthaultii, Ewing et al. (2000) identified and mapped an LB resistance gene 4.8 cm from the tomato genomic clone TG63 on chromosome 10. This LB resistance gene is located in the same region as the tomato LB resistance gene, Ph-2, which will be discussed in the Late Blight Resistance in Tomato section. In the same study, at least five QTLs conferring LB resistance were also identified (EWING et al. 2000). In the diploid desert species S. mochiquense, Smilde et al. (2005) identified and mapped an LB resistance gene they named Rpi-moch1. Rpi-moch1 was mapped to the distal region of chromosome 9, in a similar location to the tomato LB resistance gene Ph-3, which will be discussed in the Late Blight Resistance in Tomato section (SMILDE et al. 2005). In addition to Rpi-moch1, a LB resistance gene conferring broad-spectrum leaf and tuber resistance was mapped to chromosome 9 (SLIWKA et al. 2006). The LB resistance gene, named Rpi-phu, originated in S. phureja and is more proximal of Ph-3 than Rpi-moch1 (SLIWKA et al. 2006). In S. pinnasectum, Kuhl et al. (2001) identified and mapped an LB resistance gene to chromosome 7. They named the gene Rpi1, though it was later discovered that Rpi1 may correspond to the

44 previously identified S. demissum LB resistance gene R9 because the P. infestans isolate used in disease evaluation contained avr9 (KUHL et al. 2001). 29 Recent Rapid Identification and Cloning of New Late Blight Resistance Genes Knowledge of effector and R gene motifs has led to rapid identification and cloning of new LB resistance genes in the wild Solanum species S. stoloniferum, S. papita, S. venturri, S. verrucosum, S. schenckii, and S. capsicibaccatum. Vleeshouwers et al. (2008) used effector genes computationally predicted in the P. infestans genome to identify 54 potential effectors based on the presence of the RXLR-motif. Using this approach, they identified an effector that corresponded to the S. bulbocastanum LB resistance gene, RB. This high-throughput genomics approach was employed to clone two new RB homologs in S. stoloniferum (Rpi-sto1) and S. papita (Rpi-pta1) (VLEESHOUWERS et al. 2008). These homologs may be more easily introduced into the cultivated potato, S. tuberosum, as S. stoloniferum can be directly hybridized and S. bulbocastanum cannot (VLEESHOUWERS et al. 2008). Pel et al. (2009) rapidly identified and cloned two LB resistance genes (Rpi-vnt1.1 and Rpi-vtn1.3) from S. venturri. Based on the knowledge that all cloned potato R genes at the time had a common CC-NBS-LRR domain, Pel et al. (2009) used an allele mining strategy known as NBS profiling to clone new LB resistance genes. NBS profiling exploits the conserved NBS motif found in R genes to develop new molecular markers with the NBS motif that are tightly linked to resistance genes and resistance gene analogs (VAN DER LINDEN et al. 2004). Pel et al. (2009) combined NBS profiling with BSA to identify and map the new LB resistance genes Rpivnt1.1 and Rpi-vnt1.3 to chromosome 9. Pel et al. (2009) subsequently isolated these LB resistance genes. Simultaneously, Foster et al. (2009) cloned Rpi-vnt1.1, Rpi-vnt1.3, and a third LB resistance gene from S. venturri (Rpi-vnt1.2) using the map-based cloning approach. Rpi-

45 30 vnt1.1 is identical to the S. phureja LB resistance gene Rpi-phu1, suggesting that these genes were present in a common ancestor or that S. venturri and S. phureja have exchanged genetic material (FOSTER et al. 2009). Jacobs et al. (2010) subsequently employed the NBS profiling method combined with BSA to identify new LB resistance genes in S. verrucosum, S. schenckii, and S. capsicibaccatum, three Solanum species not previously known to harbor LB resistance. These genes were mapped to chromosomes 6, 4, and 11, respectively (JACOBS et al. 2010). Lokossou et al. (2009) also exploited knowledge of effector and R genes to clone four LB resistance genes on chromosome 4. Lokossou et al. (2009) used the map-based cloning approach to clone Rpi-blb3 and Rpi-abpt. They subsequently employed a candidate gene allele-mining approach to clone R2 and R2-like (LOKOSSOU et al. 2009). All four of these genes recognized the same P. infestans effector (LOKOSSOU et al. 2009). The modern approaches taken to identify, map, and clone LB resistance genes in potato have not yet been extended to tomato. However, the potential threat of LB in tomato warrants the use of such high-throughput and efficient methods. QTLs conferring Late Blight Resistance The rapid breakdown of the S. demissum R genes encouraged research to identify quantitative resistance for LB with the hope that the quantitative resistance would not break down as easily. The first study to identify QTLs conferring LB resistance was conducted by Leonards- Schippers et al. (1994). They identified eleven QTLs on nine potato chromosomes, some of which mapped to regions of the potato genome known to harbor major resistance genes (LEONARDS-SCHIPPERS et al. 1994). Studies to identify QTLs conferring LB resistance have since been conducted in numerous wild Solanum species, including S. berthaulti (EWING et al.

46 ), S. microdontum (BISOGNIN et al. 2005; SANDBRINK et al. 2000), S. paucissectum (VILLAMON et al. 2005), S. phureja (BRADSHAW et al. 2006b; GHISLAIN et al. 2001) and S. vernei (SORENSEN et al. 2006). However, this approach has not proven as fruitful as hoped. First, quantitative LB resistance is often associated with late maturity (COLLINS et al. 1999; EWING et al. 2000; OBERHAGEMANN et al. 1999; SIMKO et al. 2006; VISKER et al. 2005). Second, there has been evidence that quantitative LB resistance has been at least partially broken down (FLIER et al. 2003). Third, major QTLs conferring LB resistance sometimes co-localize with qualitative resistance genes as discussed by Leonards-Schippers et al. (1994). In addition, Oberhagemann et al. (1999) identified QTLs conferring LB resistance that co-localized with R1 and R3, R6, and R7. Some QTLs conferring LB resistance have been shown to act more like major genes than QTLs. For example, some of the QTLs conferring LB resistance identified by Leonards-Schippers et al. (1994) conferred race-specific resistance. Furthermore, Gebhardt (1994) hypothesized that R genes that display the hypersensitive response may be extreme alleles of quantitative resistance loci. Although research to identify QTLs conferring LB resistance in potato have been less successful than desired, work to identify new sources of LB resistance is highly valued in the potato community. This is demonstrated by the large number of studies conducted and the use of modern and high-throughput techniques to identify, map, and clone new genes conferring LB resistance. Unfortunately, research to study LB in tomato is more recent and much less advanced, even though LB poses a significant threat to tomato. Late Blight Resistance in Tomato Prior to a 1946 LB outbreak of tomato and potato in the U.S., concern for LB s devastating effects focused on potato. Because the 1946 outbreak also affected tomato,

47 32 researchers were prompted to shift their focus to include tomato, which led to identification of S. pimpinellifolium accessions with varying levels of LB resistance (ANDRUS 1946; GALLEGLY and MARVEL 1955). More recent research has led to mapping of major LB resistance genes and QTLs within S. pimpinellifolium, S. habrochaites, and S. pennellii using traditional mapping approaches. Ph-1, the first reported tomato LB resistance gene, was discovered in S. pimpinellifolium accessions West Virginia 19 and 731 (BONDE and MURPHY 1952; GALLEGLY and MARVEL 1955). Ph-1, originally known as Ph, is a completely dominant gene that confers resistance to P. infestans race T-0, but is susceptible to P. infestans race T-1 (GALLEGLY and MARVEL 1955; PEIRCE 1971; WALTER and CONOVER 1952). In 1962, the LB resistant Rockingham cultivar, containing Ph-1, was released (RICH et al. 1962). Rockingham was subsequently used to map Ph- 1 to the distal end of chromosome 7 using morphological markers (PEIRCE 1971). Currently, P. infestans race T-1 predominates, rendering the LB resistance conferred by Ph-1 of little value in breeding material (FOOLAD et al. 2008). Unlike Ph-1, the second LB resistance gene identified, Ph-2, confers resistance to P. infesatns race T-1. Ph-2 was discovered in S. pimpinellifolium accession West Virginia 700 (GALLEGLY and MARVEL 1955). Ph-2 confers partial LB resistance and slows, but does not stop, disease progress (MOREAU et al. 1998). In addition, the LB resistance conferred by Ph-2 often fails upon exposure to aggressive P. infestans isolates (FOOLAD et al. 2008). The dependence of the resistance on environmental conditions, plant physiological stage, plant organ, and P. infestans isolate has made characterization of Ph-2 difficult (MOREAU et al. 1998). With that said, Ph-2 was mapped to an 8.4 cm interval on the long arm of chromosome 10 between RFLP markers CP105 and TG233 (MOREAU et al. 1998). Although there have been no recent efforts to fine-map or clone Ph-2, it has been introduced into a variety of breeding material (N. Grimsley, CRNS-INRA, pers. comm.)(foolad et al. 2008).

48 33 Following observations that LB resistance conferred by Ph-1 and Ph-2 was overcome by new P. infestans isolates in Taiwan, Nepal, Indonesia, and the Philippines, further germplasm screenings of S. pimpinellifolium accessions were conducted. These screenings led to identification of S. pimpinellifolium accession L3708 (a.k.a. LA1269 and PI365957) as a new source of LB resistance conferred by a partially dominant gene, Ph-3 (CHUNWONGSE et al. 2002). L3708 conferred resistance against P. infestans isolates that could overcome Ph-1 and Ph-2. Bulked segregant analysis (BSA) was used with AFLPs to identify markers associated with resistance conferred by Ph-3 (CHUNWONGSE et al. 2002). Subsequently, the AFLP markers associated with resistance were mapped to the long arm of chromosome 9 near the RFLP marker TG591a using the tomato introgression lines (ILs) developed from a cross between S. lycopersicum cv. M82 and S. pennellii Correl accession LA716 (CHUNWONGSE et al. 2002) (ESHED and ZAMIR 1995). A co-dominant, PCR-based CAPS marker has been developed for use in marker-assisted breeding for Ph-3 (Martha Mutschler, Cornell University, pers. comm.). In addition, Ph-3 has been incorporated into fresh market and processing tomato breeding material in public breeding programs, including Cornell, North Carolina State University, and The Pennsylvania State University (FOOLAD et al. 2008). While developing processing material with Ph-3, Kim and Mutschler (2005) discovered that resistance must be conferred by additional gene(s) and that their breeding material lacked these genes. Furthermore, P. infestans isolates that overcome Ph-3 were reported as early as 2002 (CHUNWONGSE et al. 2002) and thereafter (Randy Gardner, NC State, pers. comm.). In addition to major gene race-specific resistance, race non-specific LB resistance conferred by major genes has been reported. Irzhansky and Cohen (2006) found evidence that S. pimpinellifolium accession L3707 (PI365951) possesses race non-specific LB resistance conferred by two epistatic genes that are non-allelic to Ph-1, Ph-2, and Ph-3. To date, no genes or

49 34 QTLs for LB resistance have been identified or mapped in this accession (IRZHANSKY and COHEN 2006). Although all major genes conferring LB resistance were identified in S. pimpinellifolium, QTLs conferring LB resistance have been reported in S. habrochaites and S. pennellii. QTLs conferring LB resistance in S. habrochaites accession LA2099 were identified on all 12 tomato chromosomes using composite interval mapping (BROUWER et al. 2004). Using RFLPs common between tomato and potato, Brouwer et al. (2004) compared QTLs detected in their research with previously reported QTLs conferring LB resistance in potato. They identified common QTLs on chromosomes 3 and 4. Three of the most consistently detected QTLs detected on chromosomes 4, 5, and 11 were selected and near isogenic lines (NILs) and subnils were developed to fine-map the QTLs (BROUWER and ST.CLAIR 2004). The initial QTLs ranged from 28 to 47 cm in length and were narrowed to 6.9, 8.8, and 15.1 cm, respectively (BROUWER and ST.CLAIR 2004). The segments containing the QTLs also contained undesirable alleles for plant shape, canopy density, maturity, fruit yield, and fruit size, therefore, severe linkage drag prevented the QTLs conferring LB resistance from being useful in breeding applications (BROUWER and ST.CLAIR 2004). Another study of LB resistance conferred by S. habrochaites accession BGH6902 indicated that 28 genes played a role in conferring LB resistance, however, no genes were mapped (ABREU et al. 2008). A QTL conferring LB resistance from S. pennellii accession LA716 has been mapped to chromosome 6 (SMART et al. 2007). The presence of the QTL was confirmed in the tomato ILs (SMART et al. 2007). The value of this QTL is questionable as in this study resistance was defined not as the absence of disease, rather as a relative measure compared to highly susceptible plants. Despite the considerable time and effort invested into identifying LB resistant material, mapping LB resistance genes, and transferring LB resistance genes to breeding materials, few commercially available tomato cultivars have sufficient levels of LB resistance. In 2009, two

50 35 fresh market cultivars, Mountain Magic (cherry tomato) and Plum Regal (plum tomtato) were released by the NC State Tomato Breeding Program (R. Gardner, pers. comm.). However, the Ph- 1, Ph-2, and Ph-3 LB resistance genes have been overcome by new and aggressive P. infestans isolates and the identified QTLs are of little breeding value. In addition, the potential for sexual reproduction to create new P. infestans isolates and the rapid asexual disease cycle give P. infestans a high probability of overcoming LB resistance genes. These issues emphasize the need for new, strong, and durable sources of tomato LB resistance and their introgression into commercial tomato lines and cultivars Background to Thesis Research An LB outbreak in summer 2004 with considerable impact on The Pennsylvania State University s tomato breeding program prompted research to identify new sources of LB resistance with the intent of transferring the resistance to breeding material to provide adequate protection against future infections. Approximately 70 S. pimpinellifolium accessions with desirable horticultural characteristics were screened under field conditions in summer 2004 during a natural LB infestation. Subsequently, the accessions were screened for LB resistance under high tunnel, greenhouse, and growth chamber conditions. Screenings in high tunnels and the greenhouse were conducted using whole plants, while growth chamber screenings were conducted using detached leaflets. Replicated evaluations using seven P. infestans isolates were conducted under greenhouse and growth chamber conditions. The isolates, all of mating type 2, included the US-8, US-13, US-14, and US-15 genotypes. These evaluations led to identification of several S. pimpinellifolium accessions with LB resistance. One of the highly resistant accessions, PSLP153, was selected for further evaluation and genetic characterization as described in this Ph.D. thesis.

51 36 Further evaluation and genetic characterization of the LB resistance conferred by PSLP153 include an estimate of the heritability (Chapter 2), identification and mapping of segments of the tomato genome conferring LB resistance (Chapter 3), and confirmation of the LB resistance segments in advanced populations (Chapter 4). The importance of genetic LB resistance to the tomato industry and the strong nature of the LB resistance conferred by PSLP153 make this thesis research highly valuable. Specifically, the tomato industry will benefit from this research as it will help guide decisions as to whether or not to invest in breeding for LB resistance conferred by PSLP153 through heritability estimates, it will provide PCR-based markers linked to the resistance for use in marker-assisted breeding through genetic mapping, and it will work toward isolation of the LB resistance in a cultivated background through development of NILs. Thesis Research Objectives 1. Determine the heritability of the LB resistance conferred by S. pimpinellifolium accession PSLP153 (Chapter 2). 2. Identify and map the genomic segments conferring LB resistance in S. pimpinellifolium accession PSLP153 (Chapter 3). 3. Confirm the LB resistance segments in advanced populations (Chapter 4).

52 37 References ABREU, F. B., D. J. H. DA SILVA, C. D. CRUZ and E. S. G. MIZUBUTI, 2008 Inheritance of resistance to Phytophthora infestans (Peronosporales, Pythiaceae) in a new source of resistance in tomato (Solanum sp (formerly Lycopersicon sp.), Solanales, Solanaceae). Genetics and Molecular Biology 31: ACHENBACH, U. C., X. M. TANG, A. BALLVORA, H. DE JONG and C. GEBHARDT, 2010 Comparison of the chromosome maps around a resistance hot spot on chromosome 5 of potato and tomato using BAC-FISH painting. Genome 53: ANDRIVON, D., 1996 The origin of Phytophthora infestans populations present in Europe in the 1840s: A critical review of historical and scientific evidence. Plant Pathology 45: ANDRUS, C. F., 1946 Resistance of tomato varieties to late blight in south carolina. The Plant Disease Reporter 30: ARMSTRONG, M. R., S. C. WHISSON, L. PRITCHARD, J. I. B. BOS, E. VENTER et al., 2005 An ancestral oomycete locus contains late blight avirulence gene Avr3a, encoding a protein that is recognized in the host cytoplasm. Proceedings of the National Academy of Science 102: ASHRAFI, H., M. KINKADE and M. R. FOOLAD, 2009 A new genetic linkage map of tomato based on a Solanum lycopersicum x S. pimpinellifolium RIL population displaying locations of candidate pathogen response genes. Genome 52: AVROVA, A. O., P. C. BOEVINK, V. YOUNG, L. J. GRENVILLE-BRIGGS, P. VAN WEST et al., 2008 A novel Phytophthora infestans haustorium-specific membrane protein is required for infection of potato. Cellular Microbiology 10: BAKONYI, J., M. LADAY, T. DULA and T. ERSEK, 2002 Characterisation of isolates of Phytophthora infestans from Hungary. European Journal of Plant Pathology 108: BALLVORA, A., M. R. ERCOLANO, J. WEISS, K. MEKSEM, C. A. BORMANN et al., 2002 The R1 gene for potato resistance to late blight (Phytophthora infestans) belongs to the leucine zipper/nbs/lrr class of plant resistance genes. The Plant Journal 30: BECKTELL, M. C., C. A. SMART, C. H. HANEY and W. E. FRY, 2006 Host-pathogen interactions between Phytophthora infestans and the Solanaceous hosts Calibrachoa x Hybridus, Petunia x hybrida, and Nicotiana benthamiana. Plant Disease 90: BERNATZKY, R., and S. D. TANKSLEY, 1986c Toward a saturated linkage map in tomato based on isozymes and random cdna sequences. Genetics 112: BHASKAR, P. B., J. A. RAASCH, L. C. KRAMER, P. NEUMANN, S. M. WIELGUS et al., 2008 SgtI, but not RarI, is essential for the RB-mediated broad-spectrum resistance to potato late blight. BMC Plant Biology 8. BHATTACHARJEE, S., N. L. HILLER, K. LIOLIOS, J. WIN, T. D. KANNEGANTI et al., 2006 The malarial host-targeting signal is conserved in the Irish potato famine pathogen. Plos Pathogens 2:

53 BIRCH, P. R. J., M. ARMSTRONG, J. BOS, P. BOEVINK, E. M. GILROY et al., 2009 Towards understanding the virulence functions of RXLR effectors of the oomycete plant pathogen Phytophthora infestans. Journal of Experimental Botany 60: BISOGNIN, D. A., D. S. DOUCHES, L. BUSZKA, G. BRYAN and D. WANG, 2005 Mapping late blight resistance in Solanum microdontum Bitter. Crop Science 45: BONDE, R., and E. F. MURPHY, 1952 Resistance of certain tomato varieties and crosses to late blight. Maine Agricultural Experiment Station Bulletin 497: BONIERBALE, M. W., R. L. PLAISTED and S. D. TANKSLEY, 1988 RFLP maps based on a common set of clones reveal modes of chromosomal evolution in potato and tomato. Genetics 120: BOS, J. I. B., T. D. KANNEGANTI, C. YOUNG, C. CAKIR, E. HUITEMA et al., 2006 The C-terminal half of Phytophthora infestans RXLR effector AVR3a is sufficient to trigger R3amediated hypersensitivity and suppress INF1-induced cell death in Nicotiana benthamiana. Plant Journal 48: BOTSTEIN, D., R. L. WHITE, M. SKOLNICK and R. W. DAVIS, 1980 Construction of a Genetic- Linkage Map in Man Using Restriction Fragment Length Polymorphisms. American Journal of Human Genetics 32: BOURKE, P. M. A., 1964 Emergence of Potato Blight Nature 203: BRADEEN, J. M., M. IORIZZO, D. S. MOLLOV, J. RAASCH, L. C. KRAMER et al., 2009 Higher copy numbers of the potato RB transgene correspond to enhanced transcript and late blight resistance levels. Molecular Plant-Microbe Interactions 22: BRADEEN, J. M., S. K. NAESS, J. SONG, G. T. HABERLACH, S. M. WIELGUS et al., 2003 Concomitant reiterative BAC walking and fine genetic mapping enable physical map development for the broad-spectrum late blight resistance region, RB. Molecular Genetics and Genomics 269: BRADSHAW, J. E., G. J. BRYAN, A. K. LEES, K. MCLEAN and R. M. SOLOMON-BLACKBURN, 2006a Mapping the R10 and R11 genes for resistance to late blight (Phytophthora infestans) present in the potato (Solanum tuberosum) R-gene differentials of Black. Theoretical and Applied Genetics 112: BRADSHAW, J. E., C. A. HACKETT, R. LOWE, K. MCLEAN, H. E. STEWART et al., 2006b Detection of a quantitative trait locus for both foliage and tuber resistance to late blight [Phytophthora infestans (Mont.) de Bary] on chromosome 4 of a dihaploid potato clone (Solanum tuberosum subsp. tuberosum). Theoretical and Applied Genetics 113: BRETO, M. P., M. J. ASINS and E. A. CARBONELL, 1993 Genetic-variability in Lycopersicon species and their genetic-relationships. Theoretical and Applied Genetics 86: BROUWER, D. J., E. S. JONES and D. A. ST CLAIR, 2004 QTL analysis of quantitative resistance to Phytophthora infestans (late blight) in tomato and comparisons with potato. Genome 47: BROUWER, D. J., and D. A. ST.CLAIR, 2004 Fine mapping of three quantitative trait loci for late blight resistance in tomato using near isogenic lines (NILs) and sub-nils. Theoretical and Applied Genetics 108: BURKI, F., K. SHALCHIAN-TABRIZI, M. MINGE, A. SKJAEVELAND, S. I. NIKOLAEV et al., 2007 Phylogenomics Reshuffles the Eukaryotic Supergroups. PLoS ONE 2. CARMEILLE, A., C. CARANTA, J. DINTINGER, P. PRIOR, J. LUISETTI et al., 2006 Identification of QTLs for Ralstonia solanacearum race 3-phylotype II resistance in tomato. Theoretical and Applied Genetics 113: CHAMPOURET, N., K. BOUWMEESTER, H. RIETMAN, T. VAN DER LEE, C. MALIEPAARD et al., 2009 Phytophthora infestans isolates lacking class I ipio variants are virulent on Rpiblb1 potato. Molecular Plant-Microbe Interactions 22:

54 CHEN, G. Q., and M. R. FOOLAD, 1999 A molecular linkage map of tomato based on a cross between Lycopersicon esculentum and L. pimpinellifolium and its comparison with other molecular maps of tomato. Genome 42: CHEN, Q., L. M. KAWCHUK, D. R. LYNCH, M. S. GOETTEL and D. K. FUJIMOTO, 2003 Identification of late blight, colorado potato beetle, and blackleg resistance in three Mexican and two South American wild 2x (1EBN) Solanum species. American Journal of Potato Research 80: CHUNWONGSE, J., C. CHUNWONGSE, L. BLACK and P. HANSON, 2002 Molecular mapping of the Ph-3 gene for late blight resistance in tomato. Journal of Horticultural Science and Biotechnology 77: COHEN, Y., 2002 Populations of Phytophthora infestans in Israel underwent three major genetic changes during 1983 to Phytopathology 92: COLLINS, A., D. MILBOURNE, L. RAMSAY, R. MEYER, C. CHATOT-BALANDRAS et al., 1999 QTL for field resistance to late blight in potato are strongly correlated with maturity and vigor. Molecular Breeding 5: COLTON, L., H. I. GROZA, S. M. WIELGUS and J. JIANG, 2006 Marker-assisted selection for the broad-spectrum potato late blight resistance conferred by gene RB derived from a wild potato species. Crop Science 46: DAAYF, F., and H. W. PLATT, 2003 Differential pathogenicity on potato and tomato of Phytophthora infestans US-8 and US-11 strains isolated from potato and tomato. Canadian Journal of Plant Pathology-Revue Canadienne De Phytopathologie 25: DAMASCENO, C. M. B., J. G. BISHOP, D. R. RIPOLL, J. WIN, S. KAMOUN et al., 2008 Structure of the glucanase inhibitor protein (GIP) family from Phytophthora species suggests coevolution with plant endo-beta-1,3-glucanases. Molecular Plant-Microbe Interactions 21: DEAHL, K. L., L. R. COOKE, L. L. BLACK, T. C. WANG, F. M. PEREZ et al., 2002 Population changes in Phytophthora infestans in Taiwan associated with the appearance of resistance to metalaxyl. Pest Management Science 58: DEAHL, K. L., R. W. GOTH, R. YOUNG, S. L. SINDEN and M. E. GALLEGLY, 1991 Occurrence of the A2 mating type of Phytophthora infestans in potato fields in the United States and Canada. American Potato Journal 68: DEBARY, A., 1876 Researches into the nature of the potato-fungus- Phytophthora infestans. Journal of the Royal Agricultural Society of England 12: DOGANLAR, S., A. FRARY, M. C. DAUNAY, R. N. LESTER and S. D. TANKSLEY, 2002a Conservation of gene function in the Solanaceae as revealed by comparative mapping of domestication traits in eggplant. Genetics 161: DOGANLAR, S., A. FRARY, H. M. KU and S. D. TANKSLEY, 2002b Mapping quantitative trait loci in inbred backcross lines of Lycopersicon pimpinellifolium (LA1589). Genome 45: DOUCHES, D. S., J. B. BAMBERG, W. KIRK, K. JASTRZEBSKI, B. A. NIEMIRA et al., 2001 Evaluation of wild Solanum species for resistance to the US-8 genotype of Phytophthora infestans utilizing a fine-screening technique. American Journal of Potato Research 78: DOUCHES, D. S., W. W. KIRK, K. JASTRZEBSKI, C. LONG and R. HAMMERSCHMIDT, 1997 Susceptibility of potato varieties and advanced breeding lines (Solanum tuberosum L) to Phytophthora infestans (Mont) de Bary in greenhouse screenings. American Potato Journal 74:

55 EL-KHARBOTLY, A., C. LEONARDS-SCHIPPERS, D. J. HUIGEN, E. JACOBSEN, P. A. et al., 1994 Segregation analysis and RFLP mapping of the R1 and R3 alleles conferring race-specific resistance to Phytophthora infestans in progeny of dihaploid potato parents. Molecular & General Genetics 242: EL-KHARBOTLY, A., C. PALOMINO-SANCHEZ, F. SALAMINI, E. JACOBSEN and C. GEBHARDT, 1996 R6 and R7 alleles of potato conferring race-specific resistance to Phytophthora infestans (Mont.) de Bary identified genetic loci clustering with the R3 locus on chromosome XI. Theoretical and Applied Genetics 92: ESHED, Y., and D. ZAMIR, 1995 An introgression line population of Lycopersicon pennellii in the cultivated tomato enables the identification and fine mapping of yield-associated QTL. Genetics 141: EWING, E. E., I. SIMKO, C. D. SMART, M. W. BONIERBALE, E. S. G. MIZUBUTI et al., 2000 Genetic mapping from field tests of qualitative and quantitative resistance to Phytophthora infestans in a population derived from Solanum tuberosum and Solanum berthaultii. Molecular Breeding 6: FAOSTAT, 2005 FAO Statistical Databases, pp. Food and Agriculture Association of the United Nations, Statistics Division. FELTUS, F. A., J. WUN, S. R. SCHULZE, J. C. ESTILL, N. JIANG et al., 2004 An SNP resource for rice genetics and breeding based on subspecies indica and japonica Genome Research 14: FLIER, W. G., G. B. M. VAN DEN BOSCH and L. J. TURKENSTEEN, 2003 Stability of partial resistance in potato cultivars exposed to aggressive strains of Phytophthora infestans. Plant Pathology 52: FLOR, H. H., 1955 Host-parasite interaction in flax rust - its genetics and other implications. Phytopathology 45: FOOLAD, M. R., 2007 Genome mapping and molecular breeding of tomato, pp. 52 in International Journal of Plant Genomics. FOOLAD, M. R., H. L. MERK and H. ASHRAFI, 2008 Genetics, genomics and breeding of late blight and early blight resistance in tomato. Critical Reviews in Plant Sciences 27: FOOLAD, M. R., L. P. ZHANG, A. A. KHAN and D. NINO-LIU, 2002b Identification of QTLs for early blight (Alternaria solani) resistance in tomato using backcross populations of a Lycopersicon esculentum X L. hirsutum cross. Theoretical and Applied Genetics 104: FOSTER, S. J., T. H. PARK, M. PEL, G. BRIGNETI, J. SLIWKA et al., 2009 Rpi-vnt1.1, a Tm-2(2) homolog from Solanum venturii, confers resistance to potato late blight. Molecular Plant- Microbe Interactions 22: FRARY, A., Y. M. XU, J. P. LIU, S. MITCHELL, E. TEDESCHI et al., 2005 Development of a set of PCR-based anchor markers encompassing the tomato genome and evaluation of their usefulness for genetics and breeding experiments. Theoretical and Applied Genetics 111: FRY, W. E., and S. B. GOODWIN, 1997a Re-emergence of potato and tomato late blight in the United States. Plant Disease 81: FRY, W. E., and S. B. GOODWIN, 1997b Resurgence of the Irish potato famine fungus. Bioscience 47: GALLEGLY, M. E., and J. GALINDO, 1958 Mating types and oospores of Phytophthora infestans in nature in Mexico. Phytopathology 48: GALLEGLY, M. E., and M. E. MARVEL, 1955 Inheritance of resistance to tomato race-o of Phytophthora infestans. Phytopathology 45:

56 GAVINO, P. D., C. D. SMART, R. W. SANDROCK, J. S. MILLER, P. B. HAMM et al., 2000 Implications of sexual reproduction for Phytophthora infestans in the United States: Generation of an aggressive lineage. Plant Disease 84: GEBHARDT, C., 1994 RFLP mapping in potato of qualitative and quantitative genetic loci conferring resistance to potato pathogens. American Potato Journal 71: GEBHARDT, C., and J. P. T. VALKONEN, 2001 Organization of genes controlling disease resistance in the potato genome. Annual Review of Phytopathology 39: GHIMIRE, S. R., K. D. HYDE, I. J. HODGKISS, D. S. SHAW and E. C. Y. LIEW, 2003 Variations in the Phytophthora infestans population in Nepal as revealed by nuclear and mitochondrial DNA polymorphisms. Phytopathology 93: GHISLAIN, M., B. TROGNITZ, M. D. HERRERA, J. SOLIS, G. CASALLO et al., 2001 Genetic loci associated with field resistance to late blight in offspring of Solanum phureja and S. tuberosum grown under short-day conditions. Theoretical and Applied Genetics 103: GIJZEN, M., 2009 Runaway repeats force expansion of the Phytophthora infestans genome. Genome Biology 10. GISI, U., and Y. COHEN, 1996 Resistance to phenylamide fungicides: A case study with Phytophthora infestans involving mating type and race structure. Annual Review of Phytopathology 34: GOFF, S. A., D. RICKE, T.-H. LAN, G. PRESTING, R. WANG et al., 2002 A draft sequence of the rice genome (Oryza sativa L. ssp. japonica). Science 296: GOMEZ-ALPIZAR, L., I. CARBONE and J. B. RISTAINO, 2007 An Andean origin of Phytophthora infestans inferred from mitochondrial and nuclear gene genealogies. Proceedings of the National Academy of Sciences of the United States of America 104: GOODWIN S. B., SPIELMAN L. J., MATUSZAK J. M., BERGERON S. N. and FRY W. E., 1992 Clonal diversity and genetic differentiation of Phytophthora infestans populations in Northern and Central Mexico. Phytopathology 82: GOODWIN, S. B., B. A. COHEN and W. E. FRY, 1994 Panglobal distribution of a single clonal lineage of the Irish potato famine fungus. Proceedings of the National Academy of Science 91: GOODWIN, S. B., C. D. SMART, R. W. SANDROCK, K. L. DEAHL, Z. K. PUNJA et al., 1998 Genetic change within populations of Phytophthora infestans in the United States and Canada during 1994 to 1996: Role of migration and recombination. Phytopathology 88: GOVERS, F., and M. GIJZEN, 2006 Phytophthora genomics: The plant destroyers' genome decoded. Molecular Plant-Microbe Interactions 19: GRANDILLO, S., and S. D. TANKSLEY, 1996 Genetic analysis of RFLPs, GATA microsatellites and RAPDs in a cross between L. esculentum and L. pimpinellifolium. Theoretical and Applied Genetics 92: GROUFFAUD, S., P. VAN WEST, A. O. AVROVA, P. R. J. BIRCH and S. C. WHISSON, 2008 Plasmodium falciparum and Hyaloperonospora parasitica effector translocation motifs are functional in Phytophthora infestans. Microbiology-Sgm 154: GRUNWALD, N. J., and W. G. FLIER, 2005 The biology of Phytophthora infestans at its center of origin. Annual Review of Phytopathology 43: GUENTHNER, J. F., K. C. MICHAEL and P. NOLTE, 2001 The economic impact of potato late blight on US growers. Potato Research 44: GUPTA, V., S. MATHUR, A. U. SOLANKE, M. K. SHARMA, R. KUMAR et al., 2009 Genome analysis and genetic enhancement of tomato. Critical Reviews in Biotechnology 29:

57 HAAS, B. J., S. KAMOUN, M. C. ZODY, R. H. Y. JIANG, R. E. HANDSAKER et al., 2009 Genome sequence and analysis of the Irish potato famine pathogen Phytophthora infestans. Nature 461: HALTERMAN, D. A., Y. CHEN, J. SOPEE, J. BERDUO-SANDOVAL and A. SANCHEZ-PEREZ, 2010 Competition between Phytophthora infestans effectors leads to increased aggressiveness on plants containing broad-spectrum late blight resistance. PLoS ONE 5. HALTERMAN, D. A., L. C. KRAMER, S. WIELGUS and J. M. JIANG, 2008 Performance of transgenic potato containing the late blight resistance gene RB. Plant Disease 92: HARLAN, J. R., 1971 Agricultural origins: Centers and noncenters. Science 174: HEIN, I., E. M. GILROY, M. R. ARMSTRONG and P. R. J. BIRCH, 2009 The zig-zag-zig in oomycete-plant interactions. Molecular Plant Pathology 10: HERMSEN, J. G. T., and M. S. RAMANNA, 1973 Double-bridge hybrids of Solanum bulbocastanum and dultivars of Solanum tuberosum. Euphytica 22: HOHL, H. R., and K. ISELIN, 1984 Strains of Phytophthora infestans from Switzerland with A2- mating type behavior. Transactions of the British Mycological Society 83: HUANG, S. W., E. A. G. VAN DER VOSSEN, H. H. KUANG, V. VLEESHOUWERS, N. W. ZHANG et al., 2005 Comparative genomics enabled the isolation of the R3a late blight resistance gene in potato. Plant Journal 42: HUANG, S. W., V. VLEESHOUWERS, J. S. WERIJ, R. C. B. HUTTEN, H. J. VAN ECK et al., 2004 The R3 resistance to Phytophthora infestans in potato is conferred by two closely linked R genes with distinct specificities. Molecular Plant-Microbe Interactions 17: HUBERT, D. A., P. TORNERO, Y. BELKHADIR, P. KRISHNA, A. TAKAHASHI et al., 2003 Cytosolic HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance protein. Embo Journal 22: INGLE, R. A., M. CARSTENS and K. J. DENBY, 2006 PAMP recognition and the plant-pathogen arms race. Bioessays 28: IRZHANSKY, I., and Y. COHEN, 2006 Inheritance of resistance against Phytophtora infestans in Lycopersicon pimpinellifolium L3707. Euphytica 149: JACOBS, M. M. J., B. VOSMAN, V. VLEESHOUWERS, R. G. F. VISSER, B. HENKEN et al., 2010 A novel approach to locate Phytophthora infestans resistance genes on the potato genetic map. Theoretical and Applied Genetics 120: JIANG, R. H. Y., A. L. DAWE, R. WEIDE, M. VAN STAVEREN, S. PETERS et al., 2005 Elicitin genes in Phytophthora infestans are clustered and interspersed with various transposon-like elements. Molecular Genetics and Genomics 273: JUDELSON, H. S., 1997 The genetics and biology of Phytophthora infestans: Modern approaches to a historical challenge. Fungal Genetics and Biology 22: JUDELSON, H. S., A. M. V. AH-FONG, G. AUX, A. O. AVROVA, C. BRUCE et al., 2008 Gene expression profiling during asexual development of the late blight pathogen Phytophthora infestans reveals a highly dynamic transcriptome. Molecular Plant-Microbe Interactions 21: JUDELSON, H. S., and F. A. BLANCO, 2005 The spores of Phytophthora: Weapons of the plant destroyer. Nature Reviews Microbiology 3: KAMOUN, S., 2006 A catalogue of the effector secretome of plant pathogenic oomycetes. Annual Review of Phytopathology 44: KIM, M. J., and M. A. MUTSCHLER, 2005 Transfer to processing tomato and characterization of late blight resistance derived from Solanum pimpinellifolium L. L3708. Journal of the American Society for Horticultural Science 130:

58 KIRK, W. W., K. J. FELCHER, D. S. DOUCHES, J. COOMBS, J. M. STEIN et al., 2001 Effect of host plant resistance and reduced rates and frequencies of fungicide application to control potato late blight. Plant Disease 85: KRAMER, L. C., M. J. CHOUDOIR, S. M. WIELGUS, P. B. BHASKAR and J. M. JIANG, 2009 Correlation between transcript abundance of the RB gene and the level of the RBmediated late blight resistance in potato. Molecular Plant-Microbe Interactions 22: KROMANN, P., A. TAIPE and J. L. ANDRADE-PIEDRA, 2008 Preemergence infection of potato sprouts by Phytophthora infestans in the highland tropics of Ecuador. Plant Disease 92: KUANG, H. H., F. S. WEI, M. R. MARANO, U. WIRTZ, X. X. WANG et al., 2005 The R1 resistance gene cluster contains three groups of independently evolving, type I R1 homologues and shows substantial structural variation among haplotypes of Solanum demissum. Plant Journal 44: KUHL, J. C., R. E. HANNEMAN and M. J. HAVEY, 2001 Characterization and mapping of Rpi1, a late-blight resistance locus from diploid (1EBN) Mexican Solanum pinnatisectum. Molecular Genetics and Genomics 265: LABATE, J. A., and A. M. BALDO, 2005 Tomato SNP discovery by EST mining and resequencing. Molecular Breeding 16: LEE, S. J., B. S. KELLEY, C. M. B. DAMASCENO, B. S. JOHN, B. S. KIM et al., 2006 A functional screen to characterize the secretomes of eukaryotic pathogens and their hosts in planta. Molecular Plant-Microbe Interactions 19: LEONARDS-SCHIPPERS, C., W. GIEFFERS, F. SALAMINI and C. GEBHARDT, 1992 The R1 gene conferring race-specific resistance to Phytophthora infestans in potato is located on potato chromosome V. Molecular & General Genetics 233: LEONARDS-SCHIPPERS, C., W. GIEFFERS, R. SCHAFERPREGL, E. RITTER, S. J. KNAPP et al., 1994 Quantitative resistance to Phytophthora infestans in potato - a case-study for QTL mapping in an allogamous plant-species. Genetics 137: LI, X., H. J. VAN ECK, J. VAN DER VOORT, D. J. HUIGEN, P. STAM et al., 1998 Autotetraploids and genetic mapping using common AFLP markers: the R2 allele conferring resistance to Phytophthora infestans mapped on potato chromosome 4. Theoretical and Applied Genetics 96: LIPPMAN, Z., and S. D. TANKSLEY, 2001 Dissecting the genetic pathway to extreme fruit size in tomato using a cross between the small-fruited wild species Lycopersicon pimpinellifolium and L. esculentum var. giant heirloom. Genetics 158: LIVINGSTONE, K. D., V. K. LACKNEY, J. R. BLAUTH, R. VAN WIJK and M. K. JAHN, 1999 Genome mapping in Capsicum and the evolution of genome structure in the Solanaceae. Genetics 152: LOKOSSOU, A. A., T. H. PARK, G. VAN ARKEL, M. ARENS, C. RUYTER-SPIRA et al., 2009 Exploiting knowledge of R/Avr genes to rapidly clone a new LZ-NBS-LRR family of late blight resistance genes from potato linkage group IV. Molecular Plant-Microbe Interactions 22: MALCOLMSON, J. F., 1969 Factors involved in resistance to blight (Phytophthora infestans (Mont.) de Bary) in potatoes and assessment of resistance using detached leaves. Annals of Applied Biology 64: MALCOLMSON, J. F., 1976 Assessment of field resistance to blight (Phytophthora infestans) in potatoes. Transactions of the British Mycological Society 67: MALCOLMSON, J. F., and W. BLACK, 1966 New R genes in Solanum demissum lindl. and their complementary races of Phytophthora infestans (Mont.) de Bary. Euphytica 15:

59 MARTIN, G. B., S. H. BROMMONSCHENKEL, J. CHUNWONGSE, A. FRARY, M. W. GANAL et al., 1993 Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science 262: MCDONALD, B. A., and C. LINDE, 2002 The population genetics of plant pathogens and breeding strategies for durable resistance. Euphytica 124: MILLER, J. C., and S. D. TANKSLEY, 1990 RFLP analysis of phylogenetic-relationships and genetic-variation in the genus Lycopersicon. Theoretical and Applied Genetics 80: MOREAU, P., P. THOQUET, J. OLIVIER, H. LATERROT and N. GRIMSLEY, 1998 Genetic mapping of Ph-2, a single locus controlling partial resistance to Phytophtora infestans in tomato. Molecular Plant-Microbe Interactions 11: MUELLER, L. A., R. K. LANKHORST, S. D. TANKSLEY, J. J. GIOVANNONI, R. WHITE et al., 2009 A snapshot of the emerging tomato genome sequence. The Plant Genome 2: MUELLER, L. A., T. H. SOLOW, N. TAYLOR, B. SKWARECKI, R. BUELS et al., 2005a The SOL Genomics Network. A comparative resource for Solanaceae biology and beyond. Plant Physiology 138: MUELLER, L. A., S. D. TANKSLEY, J. J. GIOVANNONI, J. VAN ECK, S. STACK et al., 2005b The tomato sequencing project, the first cornerstone of the International Solanaceae Project (SOL). Comparative and Functional Genomics 6: NAERSTAD, R., A. HERMANSEN and T. BJOR, 2007 Exploiting host resistance to reduce the use of fungicides to control potato late blight. Plant Pathology 56: NAESS, S. K., J. M. BRADEEN, S. M. WIELGUS, G. T. HABERLACH, J. M. MCGRATH et al., 2000 Resistance to late blight in Solanum bulbocastanum is mapped to chromosome 8. Theoretical and Applied Genetics 101: NIEDERHAUSER, J. S., and W. R. MILLS, 1953 Resistance of solanum species to Phytophthora infestans in Mexico. Phytopathology 43: OBERHAGEMANN, P., C. CHATOT-BALANDRAS, R. SCHAFER-PREGL, D. WEGENER, C. PALOMINO et al., 1999 A genetic analysis of quantitative resistance to late blight in potato: towards marker-assisted selection. Molecular Breeding 5: OCHWO, M. K. N., S. KAMOUN, E. ADIPALA, P. R. RUBAIHAYO, K. LAMOUR et al., 2002 Genetic diversity of Phytophthora infestans (Mont.) de Bary in the Eastern and Western highlands of Uganda. Journal of Phytopathology-Phytopathologische Zeitschrift 150: OH, S. K., C. YOUNG, M. LEE, R. OLIVA, T. O. BOZKURT et al., 2009 In planta expression screens of Phytophthora infestans RXLR effectors reveal diverse phenotypes, including activation of the Solanum bulbocastanum disease resistance protein Rpi-blb2. Plant Cell 21: PARK, T., V. VLEESHOUWERS, J. KIM, R. HUTTEN and R. VISSER, 2005a Dissection of foliage and tuber late blight resistance in mapping populations of potato. Euphytica 143: PARK, T. H., J. GROS, A. SIKKEMA, V. VLEESHOUWERS, M. MUSKENS et al., 2005b The late blight resistance locus Rpi-blb3 from Solanum bulbocastanum belongs to a major late blight R gene cluster on chromosome 4 of potato. Molecular Plant-Microbe Interactions 18: PARK, T. H., V. VLEESHOUWERS, R. C. B. HUTTEN, H. J. VAN ECK, E. VAN DER VOSSEN et al., 2005c High-resolution mapping and analysis of the resistance locus Rpi-abpt against Phytophthora infestans in potato. Molecular Breeding 16: PEIRCE, L. C., 1971 Linkage tests with Ph conditioning resistance to race 0, Phytophthora infestans. Tomato Genetics Co-operative Report 21:

60 PEL, M. A., S. J. FOSTER, T. H. PARK, H. RIETMAN, G. VAN ARKEL et al., 2009 Mapping and cloning of late blight resistance genes from Solanum venturii using an interspecific candidate gene approach. Molecular Plant-Microbe Interactions 22: RAPOSO, R., D. S. WILKS and W. E. FRY, 1993 Evaluation of potato late blight forecasts modified to include weather forecasts: a simulation analysis. Phytopathology 83: REDDICK, D., 1939 Whence came Phytophthora infestans? Chronica Botanica 4: RICH, A. E., M. C. RICHARDS and E. M. MEADER, 1962 Rockingham, a new tomato variety resistant to late blight. Plant Disease Reporter 46: 130. RICK, C. M., 1976 Tomato, pp in Evolution of Crop Plants, edited by W. N. SIMMONS. Longman. RICK, C. M., 1982 The Potential of Exotic Germplasm for Tomato Improvement, pp in Plant Improvement and Somatic Cell Genetics, edited by I. K. VASIL, W. R. SCOWCROFT and K. J. FREY. Academic Press. RODRIGUEZ, F., F. N. WU, C. ANE, S. TANKSLEY and D. M. SPOONER, 2009 Do potatoes and tomatoes have a single evolutionary history, and what proportion of the genome supports this history? Bmc Evolutionary Biology 9. RUBIN, E., and Y. COHEN, 2004 Oospores associated with tomato seed may lead to seedborne transmission of Phytophthora infestans. Phytoparasitica 32: RUSSELL, P. E., 2005 A century of fungicide evolution. Journal of Agricultural Sciences 143: SANDBRINK, J. M., L. T. COLON, P. WOLTERS and W. J. STIEKEMA, 2000 Two related genotypes of Solanum microdontum carry different segregating alleles for field resistance to Phytophthora infestans. Molecular Breeding 6: SCHNABLE, P. S., D. WARE, R. S. FULTON, J. C. STEIN, F. WEI et al., 2009 The B73 maize genome: Complexity, diversity, and dynamics. Science 326: SCHORNACK, S., E. HUITEMA, L. M. CANO, T. O. BOZKURT, R. OLIVA et al., 2009 Ten things to know about oomycete effectors. Molecular Plant Pathology 10: SCOTT, J. W., 2005 Fresh market tomato breeding in the USA, pp in 15th Meeting of the EUCARPIA-Tomato-Working-Group, edited by M. CIRULLI, J. W. SCOTT and G. BUBICI. International Society Horticultural Science, Bari, ITALY. SEAMAN, A., R. LORIA, W. FRY and T. ZITTER, 2010 Late blight: A serious disease of potatoes and tomatoes, pp. SHARMA, A., L. P. ZHANG, D. NINO-LIU, H. ASHRAFI and M. R. FOOLAD, 2008 A Solanum lycopersicum x Solanum pimpinellifolium linkage map of tomato displaying genomic locations of R-genes, RGAs, and candidate resistance/defense-response ESTs, pp. 18 in International Journal of Plant Genomics. SHEN, C. Y., L. A. BOWER, E. D.C. and P. H. TSAO, 1983 Formation of sex organs in the A1 mating type of Phytophthora infestans induced chemically by A2 isolates of other species of Phytophthora. Canadian Journal of Botany 61: SHIRASU, K., T. LAHAYE, M. W. TAN, F. S. ZHOU, C. AZEVEDO et al., 1999 A novel class of eukaryotic zinc-binding proteins is required for disease resistance signaling in barley and development in C-elegans. Cell 99: SHTIENBERG, D., R. RAPOSO, S. N. BERGERON, D. E. LEGARD, A. T. DYER et al., 1994 Incorporation of cultivar resistance in a reduced-sprays strategy to suppress early and late blights on potato. Plant Disease 78: SIMKO, I., S. COSTANZO, V. RAMANJULU, B. CHRIST and K. HAYNES, 2006 Mapping polygenes for tuber resistance to late blight in a diploid Solanum phureja X S. stenotomum hybrid population. Plant Breeding 125:

61 SLIWKA, J., H. JAKUCZUN, R. LEBECKA, W. MARCZEWSKI, C. GEBHARDT et al., 2006 The novel, major locus Rpi-phu1 for late blight resistance maps to potato chromosome IX and is not correlated with long vegetation period. Theoretical and Applied Genetics 113: SMART, C., S. TANKSLEY, H. MAYTON and W. FRY, 2007 Resistance to Phytophthora infestans in Lycopersicon pennellii. Plant Disease 91: SMILDE, W. D., G. BRIGNETI, L. JAGGER, S. PERKINS and J. D. G. JONES, 2005 Solanum mochiquense chromosome IX carries a novel late blight resistance gene Rpi-moc1. Theoretical and Applied Genetics 110: SONG, J., J. M. BRADEEN, S. K. NAESS, J. A. RAASCH, S. M. WIELGUS et al., 2003 Gene RB cloned from Solanum bulbocastanum confers broad spectrum resistance to potato late blight. Proceedings of the National Academy of Science 100: SORENSEN, K., M. MADSEN, H. KIRK, D. MADSEN and A. TORP, 2006 Linkage and quantitative trait locus mapping of foliage late blight resistance in the wild species Solanum vernei. Plant Breeding 125: TANKSLEY, S. D., M. W. GANAL, J. P. PRINCE, M. C. DEVICENTE, M. W. BONIERBALE et al., 1992 High-density molecular linkage maps of the tomato and potato genomes. Genetics 132: TIAN, M. Y., B. BENEDETTI and S. KAMOUN, 2005 A second kazal-like protease inhibitor from Phytophthora infestans inhibits and interacts with the apoplastic pathogenesis-related protease P69B of tomato. Plant Physiology 138: TIAN, M. Y., E. HUITEMA, L. DA CUNHA, T. TORTO-ALALIBO and S. KAMOUN, 2004 A Kazallike extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. Journal of Biological Chemistry 279: TIAN, M. Y., J. WIN, J. SONG, R. VAN DER HOORN, E. VAN DER KNAAP et al., 2007 A Phytophthora infestans cystatin-like protein targets a novel tomato papain-like apoplastic protease. Plant Physiology 143: TOOLEY, P. W., C. D. THERRIEN and D. L. RITCH, 1989 Mating type, race composition, nuclear- DNA content, and isozyme analysis of Peruvian isolates of Phytophthora infestans. Phytopathology 79: TORTO, T. A., S. A. LI, A. STYER, E. HUITEMA, A. TESTA et al., 2003 EST mining and functional expression assays identify extracellular effector proteins from the plant pathogen Phytophthora. Genome Research 13: TYLER, B. M., 2009 Entering and breaking: virulence effector proteins of oomycete plant pathogens. Cellular Microbiology 11: TYLER, B. M., S. TRIPATHY, X. M. ZHANG, P. DEHAL, R. H. Y. JIANG et al., 2006 Phytophthora genome sequences uncover evolutionary origins and mechanisms of pathogenesis. Science 313: USDA, 2010 The United States Department of Agriculture, pp. VAN DER HOEVEN, R., C. RONNING, J. GIOVANNONI, G. MARTIN and S. TANKSLEY, 2002 Deductions about the number, organization, and evolution of genes in the tomato genome based on analysis of a large expressed sequence tag collection and selective genomic sequencing. Plant Cell 14: VAN DER KNAAP, E., Z. B. LIPPMAN and S. D. TANKSLEY, 2002 Extremely elongated tomato fruit controlled by four quantitative trait loci with epistatic interactions. Theoretical and Applied Genetics 104: VAN DER LINDEN, C. G., D. WOUTERS, V. MIHALKA, E. Z. KOCHIEVA, M. J. M. SMULDERS et al., 2004 Efficient targeting of plant disease resistance loci using NBS profiling. Theoretical and Applied Genetics 109:

62 VAN DER VOSSEN, E., A. SIKKEMA, B. L. HEKKERT, J. GROS, P. STEVENS et al., 2003 An ancient R gene from the wild potato species Solanum bulbocastanum confers broad-spectrum resistance to Phytophthora infestans in cultivated potato and tomato. The Plant Journal 36: VAN DER VOSSEN, E. A. G., J. GROS, A. SIKKEMA, M. MUSKENS, D. WOUTERS et al., 2005 The Rpi-blb2 gene from Solanum bulbocastanum is an Mi-1 gene homolog conferring broadspectrum late blight resistance in potato. Plant Journal 44: VAN DEYNZE, A., K. STOFFEL, C. R. BUELL, A. KOZIK, J. LIU et al., 2007 Diversity in conserved genes in tomato. Bmc Genomics 8: 9. VAN POPPEL, P., J. GUO, P. DE VONDERVOORT, M. W. M. JUNG, P. R. J. BIRCH et al., 2008 The Phytophthora infestans avirulence gene Avr4 encodes an RXLR- deer effector. Molecular Plant-Microbe Interactions 21: VAN POPPEL, P., D. J. HUIGEN and F. GOVERS, 2009 Differential recognition of Phytophthora infestans races in potato R4 breeding lines. Phytopathology 99: VILLAMON, F. G., D. M. SPOONER, M. ORRILLO, E. MIHOVILOVICH, W. PEREZ et al., 2005 Late blight resistance linkages in a novel cross of the wild potato species Solanum paucissectum (series Piurana). Theoretical and Applied Genetics 111: VISKER, M., H. HEILERSIG, L. KODDE, W. VAN DE WEG, R. VOORRIPS et al., 2005 Genetic linkage of QTLs for late blight resistance and foliage maturity type in six related potato progenies. Euphytica 143: VISSER, R. G. F., C. W. B. BACHEM, J. M. DE BOER, G. J. BRYAN, S. K. CHAKRABATI et al., 2009 Sequencing the potato genome: Outline and first results to come from the elucidation of the sequence of the world's third most important food crop. American Journal of Potato Research 86: VLEESHOUWERS, V. G. A. A., H. RIETMAN, P. KRENEK, N. CHAMPOURET, C. YOUNG et al., 2008 Effector genomics accelerates discovery and functional profiling of potato disease resistance and Phytophthora infestans avirulence genes. PLoS ONE 3: e2875. VORWERK, S., S. SOMERVILLE and C. SOMERVILLE, 2004 The role of plant cell wall polysaccharide composition in disease resistance. Trends in Plant Science 9: WALTER, J. M., and R. A. CONOVER, 1952 Hereditary resistance to late blight of tomato. Phytopathology 42: WANG, Y., X. M. TANG, Z. K. CHENG, L. MUCLLER, J. GIOVANNONI et al., 2006 Euchromatin and pericentromeric heterochromatin: Comparative composition in the tomato genome. Genetics 172: WHISSON, S. C., P. BOEVINK, L. MOLELEKI, A. O. AVROVA, J. MORALES et al., 2007 A translocation signal for delivery of oomycete effector proteins into host plant cells. Nature 450: WU, F. N., and S. D. TANKSLEY, 2010 Chromosomal evolution in the plant family Solanaceae. Bmc Genomics 11. WYENANDT, C. A., R. P. MULROONEY, K. L. EVERTS, S. L. RIDEOUT and B. K. GUGINO, 2009 Fungicide resistance management guidelines for vegetable crops grown in the mid- Atlantic region , pp., edited by N. I. P. M. CENTER. YANG, W., X. BAI, E. KABELKA, C. EATON, S. KAMOUN et al., 2004 Discovery of single nucleotide polymorphisms in Lycopersicon esculentum by computer aided analysis of expressed sequence tags. Molecular Breeding 14: YOUNG, N. D., 1996 QTL mapping and quantitative disease resistance in plants. Annual Review of Phytopathology 34: YU, J., S. HU, J. WANG, G. K.-S. WONG, S. LI et al., 2002 A draft sequence of the rice genome (Oryza sativa L. ssp. indica). Science 296:

63 ZHANG, L. P., G. Y. LIN, D. NINO-LIU and M. R. FOOLAD, 2003 Mapping QTLs conferring early blight (Alternaria solani) resistance in a Lycopersicon esculentum X L. hirsutum cross by selective genotyping. Molecular Breeding 12:

64

65 Chapter 2 Parent-offspring correlation estimate of the heritability for late blight resistance conferred by an accession of the tomato wild species, Solanum pimpinellifolium Abstract Late blight (LB) is a notorious and destructive disease of tomatoes and potatoes. Caused by the oomycete Phytophthora infestans (Mont.) de Bary, LB can wipe-out entire crops in several days. Previously, LB was well-managed through frequent fungicide applications, cultural practices, and growing semi-resistant potato cultivars. There are few cultivars with LB resistance and these have only been made available recently. During the past twenty years, new and aggressive P. infestans strains that are resistant to fungicides have appeared. To regain adequate control of LB, new sources of genetic resistance in wild species are being identified and characterized. This research estimated the heritability (h 2 ) for LB resistance conferred by PSLP153, an accession of the wild tomato relative Solanum pimpinellifolium. Heritability was estimated in filial progeny developed from hybridizations between the S. lycopersicum inbred breeding line NCEBR-2 and PSLP153. In the F 2 population, 986 seedlings were evaluated for LB resistance using a P. infestans isolate belonging to the US-13 clonal lineage (mating type 2) under controlled greenhouse conditions. Percent defoliation (disease severity) due to LB was measured for each F 2 individual. Fifty of the most LB-resistant F 2 individuals and forty-four of the most LB-susceptible, but surviving F 2 individuals were allowed to self-pollinate to generate F 3 seed. Seedlings of the F 3 progeny were evaluated for LB resistance in two experiments. In each experiment, the mean percent defoliation was measured for twelve individuals from each F 3 family. Using parent-progeny correlation analysis, h 2 was estimated to be 0.76 and 0.68 in the two

66 51 experiments. The moderately high h 2 value and the non-normal distribution of the F 2 population suggest that LB resistance conferred by PSLP153 may be qualitatively controlled by the action of one or a few genes. In addition, the moderately high h 2 value indicates that reasonable selection progress for LB resistance conferred by PSLP153 can be expected. Breeding efforts are currently underway to incorporate this LB resistance into The Pennsylvania State University s tomato breeding material. Introduction Late blight (LB), caused by the oomycete Phytophthora infestans (Mont.) de Bary, is a notorious and devastating plant pathogen best known for its role in the Irish potato famine. P. infestans has been reported in all regions of the world, including Canada and the U.S. (DEAHL et al. 1991), Ecuador (KROMANN et al. 2008), Hungary (BAKONYI et al. 2002), Isreal (COHEN 2002), Nepal (GHIMIRE et al. 2003), Peru (TOOLEY et al. 1989), Poland (THERRIEN et al. 1993), Switzerland (HOHL and ISELIN 1984), Taiwan (DEAHL et al. 2002), and Uganda (OCHWO et al. 2002). In addition to affecting the potato, LB can affect other members of the Solanaceae family, including tomato, eggplant, pepper, nightshade species, and petunia (BECKTELL et al. 2006). Late blight can quickly destroy tomato and potato plants, with infection occurring at any time during the plant s life cycle. Late blight can attack any above-ground portion of a plant as well as potato tubers. Leaf infection typically begins at leaflet margins with the appearance of necrotic black or dark brown water-soaked lesions that typically have diffuse pale yellow-green borders that blend into healthy tissue. Under moist conditions, white, fluffy sporangia may develop on the leaf s abaxial side. Eventually, leaflets shrivel and die, and the plant may completely defoliate due to LB. Stem lesions caused by LB typically first appear at the plant s apex or at leaf nodes. The dark brown, soft lesions may subsequently spread down the rest of the

67 52 stem (SEAMAN et al. 2010). Tomato fruit infected by LB develop brown greasy lesions at the stem-end and sides of green fruit, rendering the fruit unmarketable. In potato, infected tubers have dry rot and brown or purple depressed lesions, also rendering them unmarketable (SEAMAN et al. 2010). Late blight is a notorious and devastating disease due to four characteristics of its causal pathogen, P. infestans. These characteristics are discussed by Fry and Goodwin (1997b) and Foolad et al. (2008). To begin with, low levels of the disease are difficult to detect. Thus growers may be initially unaware that their crops are affected. In addition, once LB is detected, it may be too late to save the crop using fungicides, as there is wide-spread and rapidly evolving systemic fungicide resistance. Nearly all P. infestans isolates are resistant to metalaxyl fungicides, which are systemic fungicides that were widely used to control LB in the 1970s (GISI and COHEN 1996). In addition to difficulties detecting LB and fungicide resistance, P. infestans can complete its asexual disease cycle within five days. Finally, each LB lesion has the potential to produce hundreds of thousands of infection-causing sporangia per day. The rapid progression of the disease cycle combined with the high potential for dispersal gives P. infestans the potential to destroy crops within seven to ten days of infection. P. infestans potential to rapidly and uncontrollably cause and spread disease makes adequate crop protection essential. Until the late 1970s, LB was well managed through the use of cultural practices, frequent and timely fungicide application, and growing moderately resistant potato cultivars (FOOLAD et al. 2008). However, there have never been tomato cultivars available with sufficient levels of LB resistance. Late blight re-emerged as an important plant disease in Europe in the early 1980s and in North America in the late 1980s. Fry and Goodwin (1997a) discuss the two major reasons why LB s re-emergence is of great concern. First, prior to the 1980s, only the A1 mating type of P. infestans was found outside of Mexico (GALLEGLY and GALINDO 1958). As a heterothallic organism, P. infestans requires the A1 and A2 mating types to be present in order for sexual

68 53 reproduction to occur (JUDELSON 1997). The A2 mating type was identified in Europe in 1981 and in North America in 1991 (HOHL and ISELIN 1984) (DEAHL et al. 1991). The presence of the A1 and A2 mating types together outside of Mexico created opportunity for sexual reproduction to occur and for the generation of new, more aggressive P. infestans isolates. This situation was realized in 1993 with the appearance of the sexually derived US-11 clonal lineage (GAVINO et al. 2000). US-11 was extremely aggressive on tomato crops in the Pacific Northwest, the Northeast, and California (GAVINO et al. 2000). McDonald and Linde (2002) theorized that the widespread potential for sexual reproduction in P. infestans greatly increased the risk of host resistance breakdown. Therefore, the potential for sexual reproduction in P. infestans makes adequate disease control essential. In addition to creating new isolates, sexual reproduction in P. infestans produces oospores, which can overwinter in fields, unlike the zoospores produced during asexual reproduction (FOOLAD et al. 2008). If oospores overwinter, they are a source of inoculum for the following growing season (GAVINO et al. 2000). The second concern associated with LB s re-emergence is the appearance of metalaxyl resistant isolates (FRY and GOODWIN 1997a). Although the appearance of metalaxyl resistance nearly coincided with the appearance of the A2 mating type outside of Mexico, there does not appear to be a genetic relationship between the two events (GISI and COHEN 1996). Metalaxyl resistance was of great concern to tomato and potato growers because metalaxyl fungicides were the only systemic fungicides available to control LB (GISI and COHEN 1996). Systemic fungicides slow or inhibit disease progress once disease symptoms are apparent. With metalaxyl resistant isolates, disease control was futile when disease symptoms were present. To address this problem, metalaxyl fungicides were only made available in combination with at least one other fungicide with a different mode of action, such as mancozeb or chlorothalinol (RUSSELL 2005). In addition, metalaxyl has been replaced by metalaxyl-m (mefenoxam), an optical isomer (RUSSELL 2005).

69 54 The problems associated with fungicide resistance have made the use of cultivars with genetic resistance to LB more attractive and appealing (FOOLAD et al. 2008). Efforts to find genetic resistance to LB in tomato have been underway since 1946 (ANDRUS 1946). A 1946 outbreak of LB that affected tomatoes spawned interest to find effective sources of tomato LB resistance, beginning with the cultivars grown at the time. Andrus reported that cultivars including Adelaide Dwarf, Garden State, and Venture were LB resistant, while cultivars including Bounty, Express, and Rutgers were LB susceptible (ANDRUS 1946). Efforts were soon extended beyond cultivars to search wild tomato species for LB resistance, including S. habrochaites, S. peruvianum, and S. pimpinellifolium. In 1953, a preliminary report focused on screening wild tomato relatives for resistance to tomato diseases identified varying levels of LB resistance in some S. pimpinellifolium accessions, but could not identify LB resistance in any other wild species (ALEXANDER 1953). Following this report, three major genes conferring tomato LB resistance in the related tomato species S. pimpinellifolium have been identified in the literature. The first reported major LB resistance gene, Ph-1, confers resistance to P. infestans race 0, but is completely ineffective against race 1 (PEIRCE 1971). Ph-1 is no longer considered an effective source of LB resistance as race 1 is now the predominant P. infestans race (FOOLAD et al. 2008; GALLEGLY and MARVEL 1955). A second major LB resistance gene, Ph-2, was identified in S. pimpinellifolium accession West Virginia 700 (GALLEGLY and MARVEL 1955). However, Ph-2 confers only partial resistance to some P. infestans isolates (FOOLAD et al. 2008). The most recently reported tomato LB resistance gene, Ph-3, was identified in S. pimpinellifolium accession L3708 (a.k.a. LA1269 and PI365957) (CHUNWONGSE et al. 2002). Some newer and aggressive P. infestans isolates overcome the LB resistance conferred by Ph-3. Overall, current LB control approaches are not sufficient, with annual costs of control and losses attributed to LB estimated as high as five billion dollars (JUDELSON and BLANCO 2005).

70 55 A severe LB outbreak in the northeastern U.S. in summer 2004 prior to my arrival at The Pennsylvania State University prompted research to uncover new sources of tomato LB resistance by The Pennsylvania State University tomato genetics and breeding program. Approximately 70 S. pimpinellifolium accessions, which were previously identified as having potential horticultural value at The Pennsylvania State University, were field screened for LB resistance as a result of a natural LB inoculation. The S. pimpinellifolium accessions were subsequently screened under growth chamber, high tunnel, and greenhouse conditions. Detached leaflets were evaluated in the growth chamber experiments, while whole plants were evaluated in the high tunnel and greenhouse experiments. The growth chamber and greenhouse experiments were replicated with seven P. infestans isolates, all of mating type 2, and belonging to the clonal lineages US-8, US- 13, US-14, and US-15. Several S. pimpinellifolium accessions highly resistant to LB were identified as a result of these screenings. One of these resistant accessions with desirable horticultural characteristics, PSLP153, was selected for further evaluation and genetic characterization. The genetic characterization of the LB resistance conferred by PSLP153 is the focus of my thesis research. An initial step in the genetic characterization of the LB resistance conferred by PSLP153 was to measure its heritability (h 2 ). Broadly defined, the concept of heritability refers to the proportion of a population s total phenotypic variation that could be attributed to genetic causes (FEHR 1993). The genetic causes of phenotypic variation can be subdivided into additive and nonadditive genetic effects. Interest lies mainly in the additive genetic effects, as they are most valuable in a breeding context. If a trait is not genetically controlled (h 2 =0), or h 2 is low, a longterm breeding project to introduce the trait to breeding material is likely not worthwhile. This is particularly true of traits transferred from wild species, such as S. pimpinellifolium, due to their inherent undesirable characteristics, including indeterminate growth habit and small fruit size.

71 56 A parent-offspring correlation method was employed to estimate h 2 in this research. This method has been used to estimate h 2 in numerous traits, including heading date, forage protein content, and plant height in Indian grass, Sorgastrum nutans (L.) Nash (VOGEL et al. 1980), heat tolerance in wheat, Triticum aestivum (L.) (IBRAHIM and QUICK 2001), seed shape in soybean, Glycine max (L.) Merr. (COBER et al. 1997), salt tolerance in tomato (FOOLAD and JONES 1992), and early blight resistance in tomato (FOOLAD and LIN 2001; FOOLAD et al. 2002a; NASH and GARDNER 1988). Lush (1940) proposed the parent-offspring method of estimating h 2, where the regression coefficient (b) is equal to h 2 when working with self-pollinated plants. Although not strictly a measure of narrow-sense heritability, the use of genetically related individuals in the parentoffspring method limits the contribution of dominant genetic effects to the h 2 estimate (LUSH 1940). Using the parent-offspring method of estimating h 2, the offspring performance is regressed on the parental performance and the regression coefficient is equal to h 2. Dudley and Moll (1969) promoted the parent-offspring method of estimating h 2 in self-pollinated crops as an empirical and reliable method with minimal genetic assumptions (individuals are diploid and inheritance is Mendelian). However, the parent-offspring regression method also assumes equality of environmental variance for parent and progeny generations, which Frey and Horner (1957) suggest is not always a valid assumption. For example, the equality of environmental variance assumption may not be valid when parent and progeny generations are evaluated in different field seasons. To address the concern surrounding environmental variance equality, Frey and Horner (1957) demonstrated that the correlation coefficient is equivalent to standard unit h 2 obtained by calculating the regression on data coded in standard units. Thus, in this study, the parent-offspring correlation method was used to estimate h 2 for LB resistance conferred by the S. pimpinellifolium accession PSLP153.

72 57 With respect to h 2 for tomato LB resistance, only one study with limited utility was previously reported. Abreu et al. (2008) estimated h 2 for LB resistance conferred by the distant tomato relative, S. habrochaites using generation means analysis. Abreu et al. (2008) estimated that broad-sense h 2 was 0.55 and narrow-sense h 2 was In addition, Abreu et al. (2008) estimated that the resistance was controlled by at least 29 genes. The low narrow-sense h 2, the large number of genes, and the difficulty in hybridizing S. habrochaites with the cultivated tomato make this source of LB resistance impractical for use in breeding programs. This emphasizes the need for further h 2 estimates for tomato LB resistance, particularly in situations where strong LB resistance is conferred, such as the tomato LB resistance conferred by PSLP153. The argument for further investigation of new sources conferring strong LB resistance, such as PSLP153, is strengthened by the potential threat of disease and the lack of sufficient disease control. The primary objective of this research was to estimate h 2 for the LB resistance conferred by PSLP153 using a parent-progeny correlation approach. Subsequently, an assessment was made based on the h 2 value and the need for new sources of LB resistance to determine whether or not breeding projects to introduce the LB resistance conferred by PSLP153 were warranted. Materials and Methods Plant Materials The parental lines used in this research were NCEBR-2, a S. lycopersicum L. inbred line and PSLP153, an inbred accession of the wild tomato species, S. pimpinellifolium. NCEBR-2, an advanced tomato breeding line developed by R. Gardner at North Carolina State University, Fletcher, NC, combines early blight resistance with desirable horticultural characteristics (GARDNER 1988). However, NCEBR-2 is susceptible to LB. Conversely, PSLP153 is highly

73 resistant to LB, but has undesirable traits, including indeterminate growth habit and small, though 58 red, fruit. Previously, NCEBR-2 (pistillate parent) was hybridized with PSLP153 and F 1 and F 2 progeny were developed (MR Foolad et al., unpubl. data). In the present study, the F 2 progeny and F 3 families (self-pollinated progeny of F 2 ) were evaluated for LB resistance. Based on the F 2 and F 3 disease evaluations, heritability (h 2 ) for LB resistance was estimated using parent-progeny correlation analysis. Inoculum Preparation Rock Springs, an aggressive Phytophthora infestans isolate with mating type 2 and belonging to the US-13 clonal lineage, was used as the pathogen source for LB screening. Rock Springs, obtained from S. Kim with the Pennsylvania Department of Agriculture, was originally collected from naturally infected tomato plants growing in Rock Springs, PA during summer To prepare the pathogen for inoculation, Rock Springs was grown on LB susceptible tomato leaflets in 9-cm Petri dishes containing a thin layer of 1.7% water agar. The Petri dishes were placed in a plastic tray with four layers of moistened paper towel on the bottom of the tray to help maintain high humidity. To further help maintain high humidity, the plastic tray was wrapped in a clear plastic bag that was sprayed with distilled water using a spray bottle. The tray and its contents were incubated at temperatures between 14 and 16 C with a 12 h photoperiod provided by cool white fluorescent lamps for 7-10 days in an incubator. After 7-10 days, the tomato leaflets were placed in a glass beaker containing 500 ml of 4 C water. The water-leaflet mixture was gently shaken using a vortex to dislodge sporangia from the leaflets. Sporangia concentration was estimated by taking the mean of three sporangia counts obtained using a haemacytometer and a light microscope. The sporangia concentration was adjusted to sporangia/ ml in a 2 L solution. Prior to inoculation, the suspension was chilled at 4 C

74 59 between 1 and 2 h and the suspension was filtered through cheesecloth to prevent the leaflets from clogging the sprayer. Inoculation and Screening of the F 2 population A large F 2 population (n=986), the parental lines (NCEBR-2 and PSLP153), the F 1, and several resistant and susceptible controls were grown in an isolated, controlled greenhouse in 72- cell seedling flats. Twelve individuals of each parental line and control were grown. The parental lines and controls were separated into two groups (replications), so that each replication had six individuals of each parental line/control. The replications were placed at opposite ends of the greenhouse so that when the disease evaluations were conducted, the parental lines/controls could be compared between groups to ensure the inoculation was uniform. Seven-week-old seedlings were used for the inoculation. On December 19, 2005, seven hours prior to inoculation, black, opaque curtains (blackouts) were lowered to cover the sides and roof of the greenhouse and the grow lights were turned off. In addition, the temperature was regulated between 16 and 18 C and the relative humidity (RH) was maintained at 100% using high-pressure foggers and an overhead humidifier. Plastic drop cloths were hung around the greenhouse and benches to prevent the plants from being directly exposed to the water sprayed from the high-pressure foggers. The humidifier and over-head high-pressure foggers were turned off thirty minutes prior to inoculation. The plastic drop cloths were raised above the plants so that the plants could be sprayed with water using a home-made sprayer. The sprayer consisted of a spray-wand with nozzle connected to a 2 L plastic pop bottle. The pop bottle was pressured using CO 2 regulated from a CO 2 tank. After the plants were sprayed with water, 1 L of inoculum was sprayed uniformly over the plants using the home-made sprayer. A half-hour later, the second liter of

75 60 inoculum was sprayed uniformly over the plants. Two hours post-inoculation, the plastic drop cloths were lowered to cover the plants and the humidity was turned on. On December 20, the blackouts were raised. On December 28, the humidifier and high-pressure foggers were turned off and the temperature returned to normal tomato growing conditions. On December 28, 29, and 30, the parental lines, controls, and F 2 seedlings were evaluated for disease severity based on the severity of the foliage infection on a scale from 0 to 100 by a minimum of two observers. A score of 0 indicated there was no foliar infection, while a score of 100 indicated that the plant had completely defoliated due to LB infection. Screening of the F 3 Families Fifty of the most LB-resistant F 2 individuals and forty-four of the most LB-susceptible, but surviving, F 2 individuals were allowed to self-pollinate to generate F 3 seed. Ripe fruit were harvested from the F 2 plants and cut open. F 3 seed was collected in plastic cups and allowed to ferment between 24 and 48 hours to loosen the gel surrounding each seed. The seed was sterilized in one percent bleach for thirty minutes and rinsed through a fine metal strainer using a garden hose with nozzle to increase the water pressure to fully remove the gel. The seed was dried on newspaper and stored in paper envelopes. Seedlings of the 94 F 3 families, the parental lines, the F 1, and resistant and susceptible controls were evaluated for LB resistance in replicated experiments conducted in October/November 2006 and August In each experiment, twelve seedlings of each of the F 3 families, parental lines, and control lines were grown in 72-cell seedling flats in an isolated and controlled greenhouse. The seedlings were divided into two groups, each with six seedlings of

76 61 each F 3 family/parental line/control line. The groups were placed on separate greenhouse benches to create an experiment replicated in space. In the 2006 LB evaluation, seven-and-a-half week old seedlings were inoculated with P. infestans Rock Springs isolate on October 27 using the same procedure described for the F 2 population. After 17 days, there were no macroscopic disease symptoms present on NCEBR-2 or the susceptible controls, so the seedlings were re-inoculated on November 13. The two groups of F 3 families, parental lines, F 1, and control lines were evaluated separately for LB foliar infection on November 20 based on the same 100 point scale used for the F 2 individuals. The disease evaluation was an average value based on all six seedlings within a replicate, unless a plant was affected by factors other than disease, such as breakage. In this situation, the affected seedling was discarded and the evaluation was based on the remaining five seedlings. In the 2007 LB evaluation, nine-week-old seedlings were inoculated with P. infestans isolate Rock Springs on August 1 using the same procedure described for the F 2 population. As in the 2006 experiment, the first inoculation did not lead to development of macroscopic disease symptoms on NCEBR-2 or the susceptible controls, so the seedlings were re-inoculated on August 9. On August 20, the two groups of F 3 families, parental lines, F 1, and controls were evaluated for LB foliar infection in the same manner as the 2006 experiment. Data Analysis Disease severity scores based on a scale from 0 to 100 were used to estimate the heritability (h 2 ) of the LB resistance conferred by PSLP153 using a parent-progeny correlation analysis. F 2 disease severity scores were estimated using single plants, while the F 3 family, parental lines, and control line scores were estimated as the mean disease severity of six plants in each family/line (replication). Because the F 3 families were evaluated for LB resistance in two

77 62 experiments and each experiment included two replications, four mean disease severity scores were obtained for each F 3 family. Heritability was estimated by calculating the parent-progeny correlations of the LB disease severity between the F 2 individuals and their F 3 progeny. Correlation, rather than regression coefficient was used to estimate the h 2 in order to reduce potential scaling effects of the environment caused by evaluating the parent and progeny generations at different times. Frey and Horner demonstrated that the correlation method of h 2 estimation is equivalent to standardunit h 2 estimates calculated by regressing data coded in standard units. Therefore: h 2 (F2:F3) = r F2:F3 = cov F2:F3 /[V F3 V F2 ] ½ = (V A + 1/2V D )/[(V A + 1/4V D + 1/nV E )(V A + V D + V E )] ½ where V A, V D, and V E are the additive, dominance, and environmental variances, respectively, cov and r are the covariance and correlation, V F2 is the variance of the F 2 generation, V F3 is the among-family variance in the F 3 generation, and n is the average number of individuals in each F 3 family. The standard error was estimated using the equation SE = [h 2 F2:F3 = (1-r 2 F2:F3)/(n-2)] ½, where n is the number of F 3 families. The Ryan-Joiner test was performed using Minitab 15 statistical software (Minitab, State College, PA) to assess whether or not disease severity was normally distributed in the F 2 population. Results Late blight severity, as measured by final percent defoliation, as well as the range of disease severity for the parental lines (NCEBR-2 and PSLP153), F 1, F 2 population, F 2 parents, and F 3 progeny families are presented in Table 2-1. The reactions of the parental lines to LB were

78 63 opposite to each other and extreme (Table 2-1). While NCEBR-2 was highly susceptible to LB; PSLP153 was highly resistant. The F 1 was also highly resistant to LB. As expected from pure lines, the parental genotypes and F 1 exhibited little variation across replications and experiments, as demonstrated by the small range of disease severity and the small standard deviation when compared with the ranges and standard deviations of the segregating F 2 and F 3 populations. Table 2-1. Late blight (LB) disease severity (final percent defoliation ± SD/SE) for the parental lines, F 1, F 2, and F 3 generations, as well as estimates of heritability. Generation Final % Defoliation Number of individuals (P 1, P 2, F 2 )/families (F 3 ) Average Range h 2 (F 2 :F 3 ) P 1 (NCEBR-2) ± P 2 (PSLP153) ± F ± F 2 Population ± F 2 Parents ± F 3 Progeny Experiment I (2006) ± F 3 Progeny Experiment II (2007) ± The F 2 population had a mean disease severity intermediate to the parental lines and F1 (Table 2-1). Twenty-six percent of the F 2 individuals had a disease severity of 25% or less, 58% had a disease severity of 50% or less, 15% had a disease severity between 50% and 75%, and 28% had a disease severity of 75% or greater (Figure 2-1). The result of the Ryan-Joiner test for normality indicated that disease severity of the F 2 population was not normally distributed (p<0.01).

79 Frequency Disease Severity (%) Figure 2-1. Frequency distribution of the F 2 population disease severity (n=986). Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions. Fifty of the most LB resistant F 2 individuals and 44 of the most LB susceptible, but surviving F 2 individuals, were allowed to self-pollinate to generate F 3 seed. The selected LB resistant F 2 individuals had a disease severity less than 15% and a mean disease severity of 7%, whereas the selected LB susceptible F 2 individuals had a disease severity greater than 30% and a mean disease severity of 72% (Figure 2-2). The selected F 2 individuals are referred to as the parental generation in the parent-progeny correlation analysis. The resultant F 3 families are referred to as the progeny generation.

80 Frequency Selected Resistant Selected Susceptible Disease Severity (%) Figure 2-2. Frequency distribution of the disease severity for the selected resistant (n=50) and susceptible individuals (n=44) in the F 2 parental generation. Late blight disease severity scores were significantly correlated between replications in each F 3 family screening experiment (Experiment I: r=0.72, p<0.001; Experiment II: r=0.86, p<0.001), thus data for the two replications of each experiment were pooled for heritability estimation. There was also a significant correlation between the two F 3 experiments (r=0.846, p<0.001). The frequency distributions of the mean disease severity of the 94 F 3 families in experiments I (2006) and II (2007) are shown in figures 2-3 and 2-4, respectively. The frequency distributions for the mean disease severity of the F 3 progeny were similar in experiments I and II. Both frequency distributions were bimodal with peaks of high (95% or greater) and low (10% or less) disease severity. Furthermore, the peak in frequency was greater when disease severity was low than when it was high. Intermediate disease severities had low frequencies, typically less than ten percent of the population.

81 Frequency Disease Severity (%) Figure 2-3. Frequency distribution of the mean disease severity of the 94 F 3 progeny families in experiment I (2006).

82 Frequency Disease Severity (%) Figure 2-4. Frequency distribution of the mean disease severity for the 94 F3 progeny families in experiment II (2007). Heritability estimates as measured by correlation were 0.76 (p<0.001) in experiment I and 0.68 (p<0.001) in experiment II, with an overall h 2 estimate of Discussion The reactions of the parental lines (NCEBR-2 and PSLP153) to LB were opposite to each other and extreme (Table 2-1). While NCEBR-2 was highly susceptible to LB; PSLP153 was highly resistant. The high level of LB resistance exhibited by S. pimpinellifolium accession PSLP153 makes this accession highly attractive as a source of LB resistance. The F 1 individuals were also highly resistant to LB, indicating that the resistance is under dominant genetic control. In addition, the high level of LB resistance exhibited by the F 1 suggests that the LB resistance may be qualitatively controlled. Although qualitative disease resistance is often less desirable

83 68 than quantitative resistance due to the potential for resistance breakdown, in the case of LB resistance, there has been some evidence of quantitative resistance breakdown (FLIER et al. 2003). In addition, qualitative disease resistance genes can be pyramided to provide disease resistance that is potentially durable and broad-spectrum based (COLLARD and MACKILL 2008; MELCHINGER 1990; SINGH et al. 2001). The strong and potentially qualitative LB resistance conferred by PSLP153 makes this a promising source of LB resistance. To determine the potential utility of PSLP153 as a source of LB resistance in tomato breeding material, h 2 of the LB resistance conferred by PSLP153 was estimated. Estimates of h 2 are beneficial when making decisions as to whether or not a long-term breeding project to introduce a trait of interest to breeding material is worthwhile. If h 2 is low, a long term breeding project is likely not worthwhile. This is particularly true of traits transferred from wild species, such as the tomato wild relative S. pimpinellifolium, due to their inherent undesirable characteristics. At least some of the undesirable characteristics will appear in hybrid progeny. The extent of the undesired background in hybrid progeny will depend on genetic factors associated with the undesired traits, such as whether the traits are qualitatively or quantitatively inherited, whether there the undesired traits and desired trait are genetically linked, and whether the traits act in a dominant or recessive manner. In the case of S. pimpinellifolium, the undesirable characteristics include indeterminate growth habit and small fruit size. With that said, the undesirable characteristics associated with S. pimpinellifolium are much less severe than those of more distantly related tomato wild species, such as S. habrochaites. S. habrochaites is a greenfruited species that cannot be hybridized with S. lycopersicum as easily as S. pimpinellifolium. Heritability of LB resistance conferred by S. pimpinellifolium accession PSLP153 was estimated using parent-progeny correlation analysis of F 2 individuals and F 3 families (self-progeny of F 2 ) derived from hybridizations between NCEBR-2 and PSLP153.

84 69 The parental F 2 individuals and their corresponding F 3 families responded similarly to LB disease pressure, as indicated by the significant correlations between the parent and progeny generations (Experiment I: r=0.76, p<0.001; Experiment II: r=0.68, p<0.001). The average of these correlations, which are estimates of h 2, is Based on these h 2 estimates, 72% of the phenotypic variation between the parent and progeny generations is explained by genetic effects. Because h 2 is less than one, phenotypic expression of LB resistance is also partially influenced by environmental factors. The moderately high h 2 value suggests that LB resistance may be qualitatively controlled by the action of one or a few genes. The high level of resistance of the F 1 individuals and the nonnormal distribution of the F 2 population provide further support that the resistance may be qualitatively controlled. However, neither the h 2 estimate, the high level of resistance of the F 1 individuals, nor the non-normal distribution of the F 2 population provides conclusive evidence. With no environmental effects and assuming the genes are acting in a Mendelian fashion, expected ratios for phenotypic classes are determined solely by the number of genes controlling the resistance. For specific ratios based on the number of genes conferring resistance, chi-square values can be calculated to determine whether the observed data meet the predicted Mendelian expectations. This would provide stronger evidence on which to evaluate whether or not the resistance was under qualitative control. Unfortunately, the continuous nature of the F 2 population frequency distribution makes it extremely difficult to accurately and reliably assign individuals to phenotypic classes. The observation of the continuous distribution could be due to the influence of environmental factors, given that environmental factors are known to play a role in LB resistance conferred by PSLP153. Further research must be conducted to determine the number of genes controlling LB resistance. For example, genetic mapping studies may be conducted to help identify the number

85 70 of genes or QTLs conferring LB resistance in S. pimpinellifolium accession PSLP153. In addition, these studies can identify the genomic segments that contain the resistance loci. The significant correlation (r = 0.85, p<0.001) between disease severity measures in the two experiments to evaluate disease severity in the F 3 families indicates that these disease evaluations are reliable. Reliable disease severity measures subsequently increase confidence in the reliability of the h 2 estimate. This reliability is particularly important for three reasons. First the F 2 disease evaluation was based on single plants, which can be unreliable. For example, a plant may appear resistant, but in reality it may have escaped the disease due to uneven disease inoculation or due to micro-environmental conditions not conducive to disease development. Second, the genotypes of the F 2 individuals were unknown, thus each F 3 family may have been segregating for disease resistance. Third, this is the first time h 2 for LB resistance has been estimated in S. pimpinellifolium and only the second time h 2 for LB resistance has been estimated in tomato. The first h 2 estimate for LB resistance in tomato was made using accession BGH6902 of the tomato wild species S. habrochaites. Abreu et al. (2008) estimated that broad sense h 2 was 0.55 and narrow sense h 2 was 0.09 using generation means analysis. Furthermore, Abreu et al. (2008) estimated that LB resistance was controlled by at least 29 genes using an equation derived by Burton (1951) in which the number of genes controlling a trait is proportional to the square of the range of the F 2 divided by the additive variance. As discussed earlier in this section, it appears likely that the LB resistance conferred by PSLP153 may be qualitatively, not quantitatively controlled. In addition to h 2 estimates being population and environment specific, S. habrochaites is only distantly related to S. pimpinellifolium (MILLER and TANKSLEY 1990). It is unlikely that the LB resistance conferred by S. habrochaites is comparable to the resistance conferred by PSLP153.

86 71 The h 2 for LB resistance conferred by S. pimpinellifolium accession PSLP153 provides insight regarding the nature of the genes conferring resistance and the potential utility of the resistance in breeding programs. The moderately high h 2 value, the high level of resistance of the F 1 individuals, and the frequency distribution of the F 2 population suggest that the LB resistance may be qualitatively controlled by the action of one or a few genes. However, further research is needed to make an accurate assessment. Insight into the potential utility of the LB resistance conferred by PSLP153 in breeding programs is essential because the resistance is conferred by a S. pimpinellifolium accession. Therefore, several generations of pre-breeding will be required to incorporate the resistance into useful breeding material. The moderately high h 2 value indicates that reasonable selection progress for increasing LB resistance can be achieved. As a result, breeding efforts have been undertaken to introduce the LB resistance conferred by PSLP153 to material in The Pennsylvania State University tomato breeding program.

87 72 References ABREU, F. B., D. J. H. DA SILVA, C. D. CRUZ and E. S. G. MIZUBUTI, 2008 Inheritance of resistance to Phytophthora infestans (Peronosporales, Pythiaceae) in a new source of resistance in tomato (Solanum sp (formerly Lycopersicon sp.), Solanales, Solanaceae). Genetics and Molecular Biology 31: ALEXANDER, L. J., 1953 Progress report of national screening committee for disease resistance in the tomato for Plant Disease Reporter 37: ANDRUS, C. F., 1946 Resistance of tomato varieties to late blight in south carolina. The Plant Disease Reporter 30: BAKONYI, J., M. LADAY, T. DULA and T. ERSEK, 2002 Characterisation of isolates of Phytophthora infestans from Hungary. European Journal of Plant Pathology 108: BECKTELL, M. C., C. A. SMART, C. H. HANEY and W. E. FRY, 2006 Host-pathogen interactions between Phytophthora infestans and the Solanaceous hosts Calibrachoa x Hybridus, Petunia x hybrida, and Nicotiana benthamiana. Plant Disease 90: BURTON, G. W., 1951 Quantitative inheritance in pearl milled (Pennisetum glaucum). Agronomy Journal 43: CHUNWONGSE, J., C. CHUNWONGSE, L. BLACK and P. HANSON, 2002 Molecular mapping of the Ph-3 gene for late blight resistance in tomato. Journal of Horticultural Science and Biotechnology 77: COBER, E. R., H. D. VOLDENG and J. A. FREGEAUREID, 1997 Heritability of seed shape and seed size in soybean. Crop Science 37: COHEN, Y., 2002 Populations of Phytophthora infestans in Israel underwent three major genetic changes during 1983 to Phytopathology 92: COLLARD, B. C. Y., and D. J. MACKILL, 2008 Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Philosophical Transactions of the Royal Society B-Biological Sciences 363: DEAHL, K. L., L. R. COOKE, L. L. BLACK, T. C. WANG, F. M. PEREZ et al., 2002 Population changes in Phytophthora infestans in Taiwan associated with the appearance of resistance to metalaxyl. Pest Management Science 58: DEAHL, K. L., R. W. GOTH, R. YOUNG, S. L. SINDEN and M. E. GALLEGLY, 1991 Occurrence of the A2 mating type of Phytophthora infestans in potato fields in the United States and Canada. American Potato Journal 68: DUDLEY, J. W., and R. H. MOLL, 1969 Interpretation and use of estimates of heritability and genetic variances in plant breeding. Crop Science 9: FEHR, W. R., 1993 Principles of Cultivar Development. MacMillan Publishing. FLIER, W. G., G. B. M. VAN DEN BOSCH and L. J. TURKENSTEEN, 2003 Stability of partial resistance in potato cultivars exposed to aggressive strains of Phytophthora infestans. Plant Pathology 52: FOOLAD, M. R., and R. A. JONES, 1992 Parent offspring regression estimates of heritability for salt tolerance during germination in tomato. Crop Science 32: FOOLAD, M. R., and G. Y. LIN, 2001 Heritability of early blight resistance in a Lycopersicon esculentum x Lycopersicon hirsutum cross estimated by correlation between parent and progeny. Plant Breeding 120: FOOLAD, M. R., H. L. MERK and H. ASHRAFI, 2008 Genetics, genomics and breeding of late blight and early blight resistance in tomato. Critical Reviews in Plant Sciences 27:

88 FOOLAD, M. R., P. SUBBIAH and G. S. GHANGAS, 2002a Parent-offspring correlation estimate of heritability for early blight resistance in tomato, Lycopersicon esculentum Mill. Euphytica 126: FREY, K. J., and T. HORNER, 1957 Heritability in standard units. Agronomy Journal 29: FRY, W. E., and S. B. GOODWIN, 1997a Re-emergence of potato and tomato late blight in the United States. Plant Disease 81: FRY, W. E., and S. B. GOODWIN, 1997b Resurgence of the Irish potato famine fungus. Bioscience 47: GALLEGLY, M. E., and J. GALINDO, 1958 Mating types and oospores of Phytophthora infestans in nature in Mexico. Phytopathology 48: GALLEGLY, M. E., and M. E. MARVEL, 1955 Inheritance of resistance to tomato race-o of Phytophthora infestans. Phytopathology 45: GARDNER, R. G., 1988 NC EBR-1 and NC EBR-2 early blight resistant tomato breeding lines. Hortscience 23: GAVINO, P. D., C. D. SMART, R. W. SANDROCK, J. S. MILLER, P. B. HAMM et al., 2000 Implications of sexual reproduction for Phytophthora infestans in the United States: Generation of an aggressive lineage. Plant Disease 84: GHIMIRE, S. R., K. D. HYDE, I. J. HODGKISS, D. S. SHAW and E. C. Y. LIEW, 2003 Variations in the Phytophthora infestans population in Nepal as revealed by nuclear and mitochondrial DNA polymorphisms. Phytopathology 93: GISI, U., and Y. COHEN, 1996 Resistance to phenylamide fungicides: A case study with Phytophthora infestans involving mating type and race structure. Annual Review of Phytopathology 34: HOHL, H. R., and K. ISELIN, 1984 Strains of Phytophthora infestans from Switzerland with A2- mating type behavior. Transactions of the British Mycological Society 83: IBRAHIM, A. M. H., and J. S. QUICK, 2001 Heritability of heat tolerance in winter and spring wheat. Crop Science 41: JUDELSON, H. S., 1997 The genetics and biology of Phytophthora infestans: Modern approaches to a historical challenge. Fungal Genetics and Biology 22: JUDELSON, H. S., and F. A. BLANCO, 2005 The spores of Phytophthora: Weapons of the plant destroyer. Nature Reviews Microbiology 3: KROMANN, P., A. TAIPE and J. L. ANDRADE-PIEDRA, 2008 Preemergence infection of potato sprouts by Phytophthora infestans in the highland tropics of Ecuador. Plant Disease 92: LUSH, J. L., 1940 Intra-sire correlations or regressions of offspring on dam as a method of estimating heritability of characteristics. Journal of Animal Science 1940: MCDONALD, B. A., and C. LINDE, 2002 The population genetics of plant pathogens and breeding strategies for durable resistance. Euphytica 124: MELCHINGER, A. E., 1990 Use of molecular markers in breeding for oligogenic disease resistance. Plant Breeding 104: MILLER, J. C., and S. D. TANKSLEY, 1990 RFLP analysis of phylogenetic-relationships and genetic-variation in the genus Lycopersicon. Theoretical and Applied Genetics 80: NASH, A. F., and R. G. GARDNER, 1988 Heritability of tomato early blight resistance derived from Lycopersicon hirsutum P.I Journal of the American Society for Horticultural Science 113: OCHWO, M. K. N., S. KAMOUN, E. ADIPALA, P. R. RUBAIHAYO, K. LAMOUR et al., 2002 Genetic diversity of Phytophthora infestans (Mont.) de Bary in the Eastern and Western 73

89 highlands of Uganda. Journal of Phytopathology-Phytopathologische Zeitschrift 150: PEIRCE, L. C., 1971 Linkage tests with Ph conditioning resistance to race 0, Phytophthora infestans. Tomato Genetics Co-operative Report 21: 30. RUSSELL, P. E., 2005 A century of fungicide evolution. Journal of Agricultural Sciences 143: SEAMAN, A., R. LORIA, W. FRY and T. ZITTER, 2010 Late blight: A serious disease of potatoes and tomatoes, pp. SINGH, S., J. S. SIDHU, N. HUANG, Y. VIKAL, Z. LI et al., 2001 Pyramiding three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106. Theoretical and Applied Genetics 102: THERRIEN, C. D., D. L. RITCH, L. S. SUJKOWSKI, S. L. J., F. W. E. et al., 1993 Phytophthora infestans in poland from ; nuclear dna content, mating type distribution and response to metalaxyl. Journal of Phytopathology-Phytopathologische Zeitschrift 139: TOOLEY, P. W., C. D. THERRIEN and D. L. RITCH, 1989 Mating type, race composition, nuclear- DNA content, and isozyme analysis of Peruvian isolates of Phytophthora infestans. Phytopathology 79: VOGEL, K. P., F. A. HASKINS and H. J. GORZ, 1980 Parent-progeny regression in Indiangrass - inflation of heritability environmental covariances. Crop Science 20:

90 Chapter 3 Identification and F 2 mapping of new genes conferring late blight resistance in the tomato wild species, Solanum pimpinellifolium Abstract Late blight (LB), caused by the oomycete Phytophthora infestans (Mont.) de Bary, is a notorious and destructive disease of tomatoes and potatoes that can wipe-out entire crops within several days. Previously, LB was relatively well-controlled through heavy fungicide application, cultural practices, and growing semi-resistant potato cultivars. There are few cultivars with LB resistance and these have only been made available recently. New and aggressive P. infestans strains have recently appeared. To regain adequate control of LB, new sources of genetic resistance in the wild species of tomato are being identified and characterized. This research identified and mapped regions of the tomato genome associated with LB resistance conferred by PSLP153, an accession of the wild tomato species, Solanum pimpinellifolium. To identify and map regions associated with LB resistance, a trait-based analysis (a.k.a. selective genotyping) was conducted using a large F 2 population. In total, 986 F 2 seedlings derived from hybridizations between a LB-susceptible S. lycopersicum breeding line (NCEBR-2; pistillate parent) and PSLP153 were evaluated for LB resistance using an aggressive P. infestans isolate belonging to the US-13 clonal lineage (mating type 2) under controlled greenhouse conditions. Percent defoliation (disease severity) due to LB was measured for each F 2 individual. Twenty-five of the most resistant (2.5%) and thirty-one of the most susceptible, but surviving (3.1%) F 2 individuals

91 76 were genotyped for 153 DNA marker loci. Marker allele frequencies were calculated and the differences in allele frequencies between the resistant and susceptible phenotypic classes were determined. For any genetic marker, an allele frequency difference greater than three standard errors of the allele frequency difference indicated that the marker was associated with LB resistance. Eleven markers were identified to be associated with LB resistance. A genetic linkage map, spanning 1102 cm of the twelve tomato chromosomes was constructed with an average of one DNA marker every 7.2 cm. The eleven markers associated with LB resistance were located on tomato chromosomes 1 and 10. The resistant segment on chromosome 1 had a maximum size of 30.9 cm and a minimum size of 23.0 cm. The resistance segment on chromosome 10 was located at the distal end of the chromosome, so the size of the segment could not be accurately determined. To further study the effects of these two segments on LB resistance, near isogenic lines are being constructed. Introduction Significance of the Tomato The cultivated tomato, Solanum lycopersicum L. (formerly Lycopersicum esculentum Mill.), is the second most commonly consumed vegetable crop worldwide (after potato) and the second most economically important vegetable crop in the U.S. (after the potato) with a farm value greater than $3 billion (FAOSTAT 2005; USDA 2010). Although the tomato has a relatively low overall nutritional value, it ranks highly in its nutritional contribution to the U.S. diet due to the large volume of fresh tomatoes and tomato products consumed (FOOLAD 2007). The economic and dietary importance of tomatoes makes breeding high quality tomatoes essential. Biotic and abiotic stresses, as well as changes in the environment, and changes in

92 77 consumer and producer preferences make development of new cultivars a constant priority. However, there is little genetic diversity within the cultivated tomato species to explore for use in new cultivar development. In fact, the cultivated tomato, S. lycopersicum, is estimated to contain a meager 5% of the genetic diversity within tomato species (MILLER and TANKSLEY 1990). The lack of genetic variation within S. lycopersicum has meant that breeders often cannot find a desired phenotype within the cultivated species, thereby forcing breeders to search for traits of interest in wild tomato species (RICK 1982; TANKSLEY and RICK 1980). Wild tomato species related to S. lycopersicum include S. pimpinellifolium, S. galapagense, S. cheesmanii, S. chmielewskii, S. peruvianum, S. habrochaites, and S. pennellii (MILLER and TANKSLEY 1990; RODRIGUEZ et al. 2009). The closest wild relative of the cultivated tomato is S. pimpinellifolium, a red-fruited tomato species, unlike the majority of wild tomato species, which are green-fruited. S. pimpinellifolium is also easily hybridized with S. lycopersicum. These and other qualities make S. pimpinellifolium a desirable species to use as a donor parent. However, the close evolutionary relationship between S. pimpinellifolium and S. lycopersicum means there are relatively few genetic differences between the species, thereby making identification of polymorphic markers challenging. Without sufficient numbers of polymorphic markers, accurate genetic mapping and gene isolation via mapping procedures are impossible. Tomato Genome Sequencing The tomato genome sequencing project focuses on sequencing the tomato euchromatin, which comprises less than 25% of the tomato genome (~220MB) using a map-based BAC-by- BAC approach (MUELLER et al. 2009; WANG et al. 2005). The euchromatin was selected for sequencing as it is a fraction of the tomato genome, but is predicted to contain close to 90% of the predicted genes (MUELLER et al. 2009; VAN DER HOEVEN et al. 2002; WANG et

93 78 al. 2005). Preliminary whole genome shotgun sequence is also available to complement the BAC sequence (MUELLER et al. 2009). Availability of tomato genome sequence and annotation will be of great assistance to genetic mapping and cloning endeavors. Mining the genome sequence will allow rapid development of large numbers of new PCR-based markers. For example, Feltus et al. (2004) aligned draft genome sequences of the Oryza sativa subspecies indica and japonica and predicted over potentially polymorphic single nucleotide polymorphisms (SNPs) and indels using an in silico approach. Direct sequencing evidence suggests that approximately 80% of the polymorphisms were real (FELTUS et al. 2004). Molecular Markers and Genetic Maps in Tomato Molecular markers and genetic mapping play extremely important roles in genetic analyses, including germplasm characterization, gene mapping and tagging, gene introgression, marker-assisted selection (MAS), and map-based cloning (BERNATZKY and TANKSLEY 1986c; GRANDILLO and TANKSLEY 1996). More than 25 linkage maps have been constructed using S. lycopersicum as one of the parents (FOOLAD 2007). To date, the majority of these genetic maps have been constructed using a distantly related tomato wild species, such as S. pennellii, as the second parent because the rate of marker polymorphism increases as the genetic distance between species increases. Furthermore, the tomato high-density tomato linkage map was developed using S. pennellii accession LA716. The first high-density linkage map, constructed based on data from 67 F 2 individuals genotyped with over 1000 molecular markers, now includes over 2500 molecular markers (MUELLER et al. 2005a; TANKSLEY et al. 1992). Despite the plethora of molecular markers identified as polymorphic between S. lycopersicum and S. pennellii, there are a limited number of molecular markers that detect polymorphism within S. lycopersicum or between S. lycopersicum and its closest wild relative, S. pimpinellifolium (BRETO et al. 1993;

94 79 LABATE and BALDO 2005; MILLER and TANKSLEY 1990). Seven linkage maps based on hybridizations between S. lycopersicum and S. pimpinellifolium are currently available. However, only three S. pimpinellifolium accessions (LA722, LA1589, and LA2093) have been used to develop these linkage maps and LA1589 was used to develop four of the seven maps. Furthermore, LA1589 was selected based on phenotypic differences in fruit quality, growth habit, and availability of DNA markers that were polymorphic between this accession and S. lycopersicum, not potential breeding utility (DOGANLAR et al. 2002b). As such, genetic maps developed using LA1589 as a parent have been useful only in the realm of basic science. Grandillo and Tanksley (1996) were the first to construct a genetic map based on hybridizations between S. lycopersicum and S. pimpinellifolium accession LA1589. The map was constructed using a BC 1 population and spanned 1279 cm of the tomato genome (GRANDILLO and TANKSLEY 1996). This map was based primarily on RFLP markers and was in agreement with the 1992 S. lycopersicum -S. pennellii high-density map, the standard tomato linkage map (GRANDILLO and TANKSLEY 1996; TANKSLEY et al. 1992). Although there was no difference in overall recombination between maps, there were differences in the distribution of recombination (GRANDILLO and TANKSLEY 1996). Subsequently, Lippman and Tanksley (2001) developed an F 2 map based on hybridization between S. lycopersicum and S. pimpinellifolium accession LA1589 to identify quantitative trait loci (QTLs) contributing to extremely large fruit size and explore the QTLs in an evolutionary context. Similarly, van der Knaap et al. (2002) developed another F 2 map based on hybridization between S. lycopersicum and S. pimpinellifolium to identify QTLs contributing to fruit shape so they could better understand fruit morphology. Doganlar et al. (2002b) developed a series of inbred backcross lines (IBLs) that originated from hybridizations between S. lycopersicum and S. pimpinellifolium accession LA1589. Using these IBLs, they identified 71 QTLs that contributed to fruit quality, flowering, and plant growth and development (DOGANLAR et al. 2002b).

95 80 Chen and Foolad (1999) were the first to develop a genetic linkage map that included a S. pimpinellifolium accession other than LA1589 as a parent. They developed a genetic map using a BC 1 population derived from hybridizations between S. lycopersicum and S. pimpinellifolium accession LA722 that spanned 1192 cm of the tomato genome (CHEN and FOOLAD 1999). LA722 is highly valuable agriculturally due to its salt tolerance, disease resistance, and fruit quality (CHEN and FOOLAD 1999). The map included 151 RFLP markers that were genotyped in 119 individuals (CHEN and FOOLAD 1999). Sharma et al. (2008) developed a map based on an F 2 population derived from hybridizations between S. lycopersicum and S. pimpinellifolium accession LA2093 that spanned 1002 cm of the tomato genome. LA2093 is a highly valuable accession due to its salt tolerance, early blight resistance, and fruit quality (ASHRAFI et al. 2009; SHARMA et al. 2008). Most recently, Ashrafi et al. (2009) developed a recombinant inbred line (RIL) map that spanned 1091 cm of the tomato genome based on the same initial cross as Sharma et al. (2008). All of the aforementioned genetic linkage maps are based primarily on RFLP markers, which are undesirable for reasons including high cost, high labor intensity, slow speed of genotyping, and high demand for plant tissue and good quality DNA. Over the past ten years, there has been a shift towards incorporating more polymerase chain reaction (PCR) based markers due to reduced costs, the ease of PCR, the rapid speed of genotyping, and the low demand for plant tissue. In 1998, Ganal et al. (1998) proposed that cleaved amplified polymorphic sequences (CAPS) markers based on sequence tagged sites identified through RFLP sequencing were useful PCR-based markers to economically follow linked genes through generations. Bai et al. (2004) supported the use of this approach and applied it to convert 24 RFLP markers to CAPS markers polymorphic between distantly related tomato species. Wu et al. (2006) designed and mapped CAPS markers on a substantially larger scale. Using conserved orthologous sequence (COSII) markers developed for use in comparative genomics, Wu et al. (2006) mapped 525 COSII markers as CAPS markers to the high-density

96 81 tomato map. Although CAPS markers are more economical than RFLP markers, they are still costly due to the required restriction enzymes. Simple sequence repeat (SSR) markers, also known as microsatellites, are a low-cost alternative to RFLP and CAPS markers. In addition, SSRs are valuable DNA markers due to their high level of polymorphism and their amenability to PCR-based methods and high throughput genotyping (BROUN and TANKSLEY 1996). Polymorphic SSRs are the result of variations in copy number of the basic repeat unit. The variations typically arise from slippages during DNA replication, base-pair substitutions, and possibly unequal crossing-over (BROUN and TANKSLEY 1996). Broun and Tanksley (1996) first demonstrated the utility of SSRs as tomato genetic markers. They also examined the organization of SSR markers within the tomato genome. GA and GT were the most common repeat motifs identified, followed by ATT and GCC. This was an interesting result because the AT motif was the most abundant motif in GenBank (BROUN and TANKSLEY 1996). Perhaps more importantly, Broun and Tanksley (1996) found that the SSRs they examined clustered in centromeric regions, thereby potentially limiting the use of SSRs as primary markers in constructing genetic linkage maps with uniform genome coverage. This result has also been observed with tetranucleotide motifs (ARENS et al. 1995; GRANDILLO and TANKSLEY 1996). It has since been suggested that GA and GT may be over-represented in centromeric regions and that the AT motif is the most abundant SSR motif and is randomly distributed in the tomato genome (ARESHCHENKOVA and GANAL 2002; HE et al. 2003). It was recently demonstrated that the observed centromeric clustering might be a result of bias in the genomic location of sequences analyzed for SSRs (GEETHANJALI et al. 2010). In addition, polymorphism has been positively correlated with the number of repeats of the SSR motif (HE et al. 2003). Thus, repeat number should be considered when searching for new potentially polymorphic SSR markers.

97 82 The public availability of large amounts of tomato DNA sequence from expressed sequence tags (ESTs), bacterial artificial chromosomes (BACs), and preliminary whole genome shotgun sequence is an extremely valuable resource for developing new DNA markers. The Solanaceae Genomics Resource Website ( provides over SSR primer pairs with potential applicability to tomato, with 102 designed specifically from S. pimpinellifolium sequence. Using publicly available BAC sequence, Geethanjali et al. (2010) developed new SSR markers on chromosome 6 that were polymorphic between two closely related tomato accessions, West Virginia 700 and Hawaii They used these new SSRs to map a QTL associated with resistance to bacterial wilt (GEETHANJALI et al. 2010). Although SSRs can be readily located in the tomato genome, locating polymorphic SSRs can be a much more laborious task and developing new DNA markers can be an expensive and labor-intensive process. In silico prediction of new SSR markers can offer a cheaper alternative. Using an in silico approach, Tang et al. (2008) identified 263 potentially polymorphic SSRs in tomato. Tang et al. (2008) analyzed publicly available, redundant EST sequences to identify polymorphic SSRs with high quality primers for PCR. However, these SSRs were not mapped. Subsequently, Ohyama et al. (2009) identified and mapped 685 new SSR markers identified in cdna and BAC-end sequences publicly available in tomato genome databases. It is clear from these examples that the availability of large quantities of DNA sequence can be an extraordinarily valuable resource to identifying and mapping new genes, including genes for disease resistance (GEETHANJALI et al. 2010). Significance of Late Blight Late blight (LB) caused by the oomycete Phytophthora infestans (Mont.) de Bary, is a notorious and devastating plant disease best known for its role in the Irish potato famine, though

98 83 it can be found worldwide. In addition to affecting potatoes, LB can also affect other members of the Solanaceae family, including tomato, nightshade species, eggplant, pepper, and petunia (BECKTELL et al. 2006). Late blight can quickly destroy tomato and potato plants, with infection occurring at any time during the plant s life cycle. It can infect any above-ground plant portion as well as potato tubers. Leaf infection due to LB typically begins at leaflet margins with the appearance of black or dark brown necrotic water-soaked lesions. These lesions may have pale yellow/green borders that blend into healthy tissues. Under moist conditions, white, fluffy sporangia may develop on the leaf s abaxial side. Eventually, leaflets shrivel and die, and the plant may completely defoliate due to disease. Stem lesions caused by LB typically first appear at the plant s apex or at leaf nodes. The dark brown, soft lesions may subsequently spread down the rest of the stem (SEAMAN et al. 2010). Tomato fruit infected by LB develop brown and greasy lesions at the stem-end and sides of green fruit, rendering the fruit unmarketable. Similarly, infected potato tubers have dry rot and brown or purple depressed lesions, rendering them unmarketable (SEAMAN et al. 2010). Late blight is a notorious and devastating disease due to four characteristics of its causal pathogen, P. infestans, as discussed by Fry and Goodwin (1997b) and Foolad et al. (2008). To begin with, low levels of disease are difficult to detect. Thus growers may be initially unaware that their crops are infected. In addition, once LB is detected, it may be too late to save the crop using fungicides, as there is wide-spread fungicide resistance. Nearly all P. infestans isolates are resistant to the systemic metalaxyl fungicides, which were in widespread use in the 1970s to control LB (GISI and COHEN 1996). In addition to difficulties detecting LB and fungicide resistance, P. infestans can complete its asexual disease life cycle within five to seven days. Finally, each LB lesions has the potential to produce hundreds of thousands of infection-causing sporangia per day. The rapid progression of the disease cycle combined with the high potential for dispersal gives P. infestans the potential to destroy crops within seven to ten days of infection.

99 84 P. infestans potential to rapidly and uncontrollably cause disease and spread disease makes adequate crop protection essential. Until the late 1970s, LB was well managed through the use of cultural practices, frequent and timely fungicide application, and growing moderately-resistant potato cultivars (FOOLAD et al. 2008). Late blight re-emerged as an important plant disease in Europe in the early 1980s and in North America in the late 1980s. Fry and Goodwin (1997a) discuss the two major reasons why LB s re-emergence is of great concern. First, prior to the 1980s, only the A1 mating type of P. infestans was found outside of Mexico (GALLEGLY and GALINDO 1958). As a heterothallic organism, P. infestans requires the A1 and A2 mating types to be present in order for sexual reproduction to occur (JUDELSON 1997). The A2 mating type was identified in Europe in 1981 and in North America in 1991 (HOHL and ISELIN 1984) (DEAHL et al. 1991). The presence of the A1 and A2 mating types together outside of Mexico created opportunity for sexual reproduction to occur and for the generation of new, more aggressive P. infestans isolates. This situation was realized in 1993 with the appearance of the sexually derived US-11 clonal lineage (GAVINO et al. 2000). US-11 was extremely aggressive on tomato crops in the Pacific Northwest, the Northeast, and California (GAVINO et al. 2000). In addition to creating new isolates, P. infestans sexual reproductive cycle produces oospores, which can overwinter in the field, unlike the zoospores produced during asexual reproduction (FOOLAD et al. 2008). If oospores overwinter, they are a source of inoculum for the following growing season (GAVINO et al. 2000). The second concern associated with LB s re-emergence is the appearance of metalaxylresistant isolates (FRY and GOODWIN 1997a). Although the appearance of metalaxyl resistance nearly coincided with the appearance of the A2 mating type outside of Mexico, there does not appear to be a genetic relationship between the events (GISI and COHEN 1996). Metalaxyl resistance was of great concern because metalaxyl fungicides were the only systemic fungicides

100 85 available to control LB (GISI and COHEN 1996). Systemic fungicides slow or inhibit disease progress once disease symptoms are apparent. With metalaxyl-resistant isolates, disease control was futile when disease symptoms were present. To address this problem, metalaxyl fungicides were only made available in combination with at least one other fungicide with a different mode of action, such as mancozeb or chlorothalinol (RUSSELL 2005). In addition, metalaxyl has been replaced by metalaxyl-m (mefenoxam), an optical isomer (RUSSELL 2005). The problems associated with fungicide resistance have made the use of cultivars with genetic LB resistance more attractive and appealing (FOOLAD et al. 2008). In addition to the development of fungicide resistance, frequent fungicide application is undesirable and unsustainable due to high costs and potential hazards to the environment, to individuals applying the fungicide and potentially to consumers. The negative effects associated with fungicide application as well as the potential for new P. infestans isolates make LB control that solely relies on heavy fungicide application undesirable. Using cultivars that are at least partially LB resistant can significantly reduce the number and rate of fungicide application (KIRK et al. 2001; SHTIENBERG et al. 1994). In addition, the greater the genetic resistance, the greater the potential to reduce fungicide use (NAERSTAD et al. 2007). Genetic Resistance It is widely theorized that pathogens and hosts continually battle in an evolutionary arms race for survival. To explain the interactions between pathogens and hosts, Flor (1955) proposed the gene-for-gene model, in which the host s resistance gene product (known as an R gene product) interacts with the pathogen s pathogenicity product (known as an avirulence gene product). Resistance to bacterial speck in tomato, caused by Pseudomonas syringae pv. tomato, is a classic example of a gene-for-gene interaction. In this gene-for-gene interaction, the tomato

101 86 resistance gene product, Pto, interacts with the P. syringae avirulence gene product AvrPto (MARTIN et al. 1993). This type of resistance is known as race-specific resistance, qualitative resistance, single gene resistance, or vertical resistance. As the names imply, race-specific resistance typically confers complete disease resistance to one, or a few, races of a pathogen. Subsequently, race-specific resistance is typically ineffective, or broken-down, when new races of the pathogen emerge. Conversely, race non-specific resistance, which is also known as quantitative resistance, polygenic resistance, field resistance, or horizontal resistance, typically confers partial disease resistance to multiple races of a pathogen. Race non-specific resistance often slows, but does not stop, disease progress. Although more durable to plant breeders due to its potential durability, race non-specific resistance s multi-genic nature makes the resistance more difficult to breed for. Race-specific and race non-specific tomato LB resistance genes will be discussed in detail below. Late Blight Resistance in Tomato Prior to a 1946 LB outbreak of tomato and potato in the U.S., concern for LB s devastating effects focused on potato. Because the 1946 outbreak also affected tomatoes, researchers were prompted to shift their research focus to include tomato, which led to identification of S. pimpinellifolium accessions with varying levels of LB resistance (ALEXANDER 1953; ANDRUS 1946; GALLEGLY and MARVEL 1955). More recent research has led to mapping of major LB resistance genes and QTLs in S. pimpinellifolium, S. habrochaites, and S. pennellii, as discussed below. Ph-1, the first reported tomato LB resistance gene, was discovered in S. pimpinellifolium accessions West Virginia 19 and 731 (BONDE and MURPHY 1952; GALLEGLY and MARVEL 1955). Ph-1, originally known as Ph, is a completely dominant gene that confers resistance to P.

102 87 infestans race T-0, but is susceptible to P. infestans race T-1 (GALLEGLY and MARVEL 1955; PEIRCE 1971; WALTER and CONOVER 1952). In 1962, the LB resistant Rockingham cultivar, containing Ph-1, was released (RICH et al. 1962). Rockingham was subsequently used to map Ph- 1 to the distal end of chromosome 7 using morphological markers (PEIRCE 1971). Currently, P. infestans race T-1 predominates, rendering the LB resistance conferred by Ph-1 of little value in breeding material (FOOLAD et al. 2008). Unlike Ph-1, Ph-2, the second LB resistance gene to be identified, confers resistance to P. infestans race T-1. Ph-2 was discovered in S. pimpinellifolium accession West Virginia 700 (GALLEGLY and MARVEL 1955). Ph-2 confers partial LB resistance, and slows, but does not stop, disease progress (MOREAU et al. 1998). In addition, the resistance conferred by Ph-2 often fails upon exposure to aggressive P. infestans isolates (FOOLAD et al. 2008). The dependence of the resistance on environmental conditions, plant physiological stage, plant organ, and P. infestans isolate has made characterization of Ph-2 difficult (MOREAU et al. 1998). With that said, Ph-2 was mapped between RFLP markers CP105 and TG233, which are located 8.4 cm interval apart on the long arm of chromosome 10 (MOREAU et al. 1998). Although there have been no recent efforts to fine-map or clone Ph-2, it has been introduced into a variety of breeding material (N. Grimsley, CRNS-INRA, pers. comm.) (FOOLAD et al. 2008). Following observations that LB resistance conferred by Ph-1 and Ph-2 was overcome by new P. infestans isolates in Taiwan, Nepal, Indonesia, and the Philippines, further germplasm screenings of S. pimpinellifolium accessions were conducted. These screenings led to identification of S. pimpinellifolium accession L3708 (a.k.a. LA1269 and PI365957) as a new source of LB resistance conferred by a partially dominant gene, named Ph-3 (CHUNWONGSE et al. 2002). L3708 conferred resistance to P. infestans isolates that could overcome Ph-1 and Ph-2. The bulked segregant analysis (BSA) method was used with amplified fragment length polymorphism (AFLP) markers to identify markers associated with resistance conferred by Ph-3

103 88 (CHUNWONGSE et al. 2002). Subsequently, the AFLP markers associated with resistance were mapped to the long arm of chromosome 9 near the RFLP marker TG591a (CHUNWONGSE et al. 2002) using the tomato introgression lines (ILs) developed from a cross between S. lycopersicum cv. M82 and S. pennellii Correl accession LA716 (ESHED and ZAMIR 1995). In addition, Ph-3 has been incorporated into fresh market and processing tomato breeding material in public breeding programs, including Cornell, North Carolina State University, and The Pennsylvania State University (FOOLAD et al. 2008). While developing processing breeding material with Ph-3, Kim and Mutschler (2005) discovered that resistance must be conferred by additional gene(s). Furthermore, P. infestans isolates that overcome Ph-3 were reported as early as 2002 (CHUNWONGSE et al. 2002). In addition to major gene race-specific resistance, race non-specific LB resistance conferred by major genes has also been reported. Irzhansky and Cohen (2006) found evidence that S. pimpinellifolium accession L3707 (PI365951) possesses race non-specific LB resistance conferred by two epistatic genes that are non-allelic to Ph-1, Ph-2, and Ph-3. To date no genes or QTLs for LB resistance have been identified or mapped in this accession. Although all major genes conferring LB resistance have been reported in S. pimpinellifolium, QTLs conferring LB resistance have been reported in S. habrochaites and S. pennellii. QTLs for LB resistance from S. habrochaites accession LA2099 were identified on all 12 tomato chromosomes using composite interval mapping (BROUWER et al. 2004). Using RFLPs common between tomato and potato, Brouwer et al. (2004) compared QTLs detected in their study with previously reported QTLs for LB resistance in potato. They identified common QTLs on chromosomes 3 and 4. Three of the most commonly detected QTLs on chromosomes 4, 5, and 11 were selected and near isogenic lines (NILs) and subnils were developed to fine-map the QTLs (BROUWER and ST.CLAIR 2004). The initial QTL intervals ranged from 28 to 47 cm and were narrowed to 6.9, 8.8, and 15.1 cm, respectively (BROUWER and ST.CLAIR 2004). The QTL

104 89 segments also contained undesirable alleles for plant shape, canopy density, maturity, fruit yield, and fruit size, therefore, severe linkage drag prevented these QTLs from being useful in breeding applications (BROUWER and ST.CLAIR 2004). A second study evaluated LB resistance in S. habrochaites accession BGH6902 (ABREU et al. 2008). This results of this study indicated that 28 genes played a role in conferring LB resistance, however, no genes were mapped. A QTL conferring LB resistance from S. pennellii accession LA716 has been mapped to tomato chromosome 6, which was confirmed in the tomato ILs (SMART et al. 2007). The value of this QTL is questionable as in this research LB resistance was defined not as the absence of disease, rather as a relative measure when compared to highly susceptible plants. Despite the considerable time and effort invested into identifying LB resistant material, mapping LB resistance genes, and transferring LB resistance genes to breeding material, few commercially available tomato cultivars have sufficient levels of LB resistance. Ph-1, Ph-2, and Ph-3 LB resistance genes have been overcome by new and aggressive P. infestans strains and the identified QTLs are of little breeding value. In addition, the potential for sexual reproduction to create new P. infestans isolates and the rapid asexual disease cycle give P. infestans a high probability of overcoming LB resistance genes. These issues emphasize the need for new, strong, and durable sources of tomato LB resistance and their introgression into commercial tomato lines and cultivars. Prior Research An LB outbreak in the northeastern U.S. in summer 2004 with considerable impact on The Pennsylvania State University s tomato genetics and breeding program prompted research to identify new sources of LB resistance with the intent of transferring the resistance to breeding material to provide protection against future LB outbreaks. Approximately 70 S. pimpinellifolium

105 90 accessions with desirable horticultural characteristics were screened in the field for LB resistance in summer 2004 as a result of a natural infestation. Subsequently, the accessions were screened for LB resistance under high tunnel, greenhouse, and growth chamber conditions. Screenings in high tunnels and a controlled greenhouse were conducted using whole plants, while growth chamber screenings were conducted using detached leaflets. Replicated evaluations using seven P. infestans isolates were conducted under greenhouse and growth chamber conditions. The isolates, which were all mating type 2, included the US-8, US-13, US-14, and US-15 genotypes. These evaluations led to identification of several S. pimpinellifolium accessions with LB resistance. One of the highly resistant accessions, PSLP153, was selected for further evaluation and genetic characterization. The genetic characterization of the LB resistance conferred by PSLP153 is the focus of my thesis research. As a first step in the characterization of the LB resistance conferred by PSLP153, heritability (h 2 ) for the LB resistance was estimated. Using the parent-progeny correlation method, h 2 was estimated to be 0.68 and 0.76 in two replicated experiments. The moderately-high h 2 value indicates that reasonable selection progress for increasing LB resistance can be achieved. As a result, breeding efforts have been undertaken to introduce the LB resistance conferred by PSLP153 to material in The Pennsylvania State University tomato breeding program. The h 2 for LB resistance conferred by PSLP153 provides insight regarding the nature of the genes conferring LB resistance. The moderately-high h 2 value suggests that the resistance may be qualitatively controlled by the action of one or a few genes. The next step in the genetic characterization of the LB resistance conferred by PSLP153 is to identify and map regions of the tomato genome associated with resistance. Identifying and mapping these segments is an initial step toward identifying molecular markers useful for marker-assisted selection (MAS) and cloning the resistance gene(s). Marker-assisted selection and the cloned resistance gene(s) will be helpful to introducing the LB resistance to tomato breeding material.

106 91 Identifying and Mapping New Late Blight Resistance Genes To identify and map regions of the tomato genome associated with the LB resistance conferred by PSLP153, different mapping approaches including marker based analysis (MBA) or trait-based analysis (TBA; a.k.a. selective genotyping) can be conducted. Thoday (1961) proposed MBA and demonstrated its potential utility in gene mapping using Drosophila melanogaster. Using a MBA approach, all individuals in a mapping population are genotyped and phenotyped to identified marker genotypes associated with phenotypes. This approach is highly useful when analysis of multiple traits is desired and when the cost of genotyping is low, as large populations are required to accurately study quantitative traits. In theory, individuals can be phenotyped for all segregating traits in a population. In the current research, however, response to LB was the only segregating trait of interest. In addition, RFLP markers were initially used to identify segments of the genome associated with LB resistance. The high cost, high labor intensity, slow speed of genotyping, and high demand for plant tissue made the MBA approach undesirable. Research conducted by Stuber et al. (1982; 1980) led to the proposal of TBA to associate phenotypic and genotypic data. Stuber et al. (1982; 1980) concluded that changes in maize allozyme allele frequency over time were associated with changes in grain yield, and thus were the result of selection. Lebowitz et al. (1987) applied these findings to utilize extreme phenotypic classes to determine linkage between molecular markers and nearby QTLs in a theoretical discussion. In the TBA approach, only select progeny with extreme phenotypes that are derived from hybridizations between inbred lines are genotyped. The genotypes of the extreme phenotypic classes are determined to calculate allele frequency differences between extreme phenotypes. Selection for extreme phenotypes alters marker allele frequencies at loci affecting the trait of interest as well as the adjacent loci through hitchhiker effects (LEBOWITZ et al. 1987).

107 92 Thus, marker loci with significant allele frequency differences between the selected phenotypic classes are considered linked with the trait of interest (FOOLAD and JONES 1993; FOOLAD et al. 1997; LEBOWITZ et al. 1987; ZHANG et al. 2003). Lebowitz et al. (1987) proposed that TBA applied in an F 2 or BC population had equivalent power to MBA in situations where there was only one trait of interest and the cost of obtaining genotypic data was high compared to the cost of obtaining phenotypic data. This was confirmed by Darvasi and Soller (1992), who found that to maintain the same level of power, while decreasing the number of individuals genotyped, there needed to be a dramatic increase in the number of individuals phenotyped. In addition, they found it would likely never be useful to genotype more than the upper and lower 25% of the population (DARVASI and SOLLER 1992). Navabi et al. (2009) purported that TBA can be particularly useful when trying to identify genomic segments with large, rather than small, phenotypic effect. Although TBA could be conducted using both extreme phenotypic classes (bidirectional) or only one extreme phenotypic class (unidirectional), bidirectional TBA has equal, or greater power than unidirectional TBA (FOOLAD and JONES 1993; GALLAIS et al. 2007; NAVABI et al. 2009). Thus, bidirectional TBA was conducted in an F 2 population to identify regions of the tomato genome associated with LB resistance conferred by S. pimpinellifolium accession PSLP153. Gallais et al. (2007) proposed that TBA could be particularly useful in breeding applications to identify markers associated with a trait of interest that could then be used for marker-assisted breeding. Trait-based analysis has been used to identify genomic regions associated with traits in a variety of agriculturally relevant species, including malt and grain quality in barley, Hordeum vulgare L. (AYOUB and MATHER 2002), anthracnose resistance in white lupin, Lupinus albus L. (YANG et al. 2010), early blight resistance in tomato, S. lycopersicum (ZHANG et al. 2003), salt tolerance in tomato (FOOLAD and JONES 1993; FOOLAD et al. 1997), and drought tolerance in maize, Zea mays (HAO et al. 2009). In the current research, we

108 were interested only in one trait (LB) and the initial genetic markers were RFLPs, thus the TBA approach was employed as described below. 93 Research Objectives The main objective of this research was to identify segments of the tomato genome associated with the late blight resistance conferred by S. pimpinellifolium accession PSLP153. To reach this objective, the following research had to be conducted: 1. Identify RFLP markers polymorphic between the S. lycopersicum inbred line NCEBR-2 (LB susceptible) and S. pimpinellifolium accession PSLP153 (LB resistant), the parents of the mapping population in this study; 2. Develop additional PCR-based markers polymorphic between NCEBR-2 and PSLP153; 3. Construct a linkage map based on an F 2 population developed from hybridization between NCEBR-2 and PSLP153; 4. Screen the F 2 population for LB response; 5. Conduct QTL mapping using a trait-based marker analysis. Materials and Methods Plant Materials The parental lines used in this research were NCEBR-2, a S. lycopersicum L. inbred line and PSLP153, an inbred accession of the wild tomato species, S. pimpinellifolium. NCEBR-2, an advanced tomato breeding line developed by R. Gardner at North Carolina State University,

109 94 Fletcher, NC, combines early blight resistance with desirable horticultural characteristics (GARDNER 1988). However, NCEBR-2 is susceptible to LB. Conversely, PSLP153 is highly resistant to LB, but has undesirable traits, including indeterminate growth habit and small, though red, fruit. Previously, NCEBR-2 (pistillate parent) was hybridized with PSLP153 and F 1 and F 2 progeny were developed (MR Foolad et al. unpubl. data). In the present research, the F 2 progeny were evaluated for LB resistance. Select LB resistant and susceptible individuals were genotyped with DNA markers to create a genetic map and identify segments of the tomato genome associated with LB resistance. Inoculum Preparation Rock Springs, an aggressive P. infestans isolate with mating type 2 and belonging to the US-13 clonal lineage, was used as the pathogen source for LB screening. Rock Springs, obtained from S. Kim with the Pennsylvania Department of Agriculture, was originally collected from naturally infected tomato plants growing in Rock Springs, PA, during summer To prepare the pathogen for inoculation, Rock Springs was grown on LB susceptible tomato leaflets in 9-cm Petri dishes containing a thin layer of 1.7% water agar. The Petri dishes were placed in a plastic tray with four layers of moistened paper towel on the bottom of the tray to help maintain high humidity. To further help maintain humidity, the plastic tray was wrapped in a clear plastic bag that was sprayed with distilled water using a spray bottle. The tray was incubated at temperatures between 14 and 16 C with a 12 h photoperiod provided by cool white fluorescent lamps for 7-10 days in an incubator. After 7-10 days, the tomato leaflets were placed in 500 ml of 4 C water in a glass beaker. The water-leaflet mixture was gently shaken using a vortex to dislodge sporangia from the leaflets. Sporangia concentration was estimated by taking the mean of three sporangia counts obtained using a haemacytometer and a light microscope. The

110 95 sporangia concentration was adjusted to ~ sporangia/ ml in a 2 L solution. Prior to inoculation, the suspension was chilled at 4 C between 1 and 2 h and the suspension was filtered through cheesecloth to prevent the leaflets from clogging the sprayer. Inoculation and Screening of the F 2 Population A large F 2 population (n=986), the parental lines (NCEBR-2 and PSLP153), F 1, and several resistant and susceptible controls were grown in an isolated, controlled greenhouse in 72- cell seedling flats. The controls included the LB-susceptible breeding line UCT5, the commercial cultivar New Yorker (LB resistance gene Ph-1) and the following breeding lines developed by R. Gardner at NC State University: NC84173, NC63EB (LB resistance gene Ph-2), NC870 (LB resistance gene Ph-3), and NC3220 (LB resistance genes Ph-2 and Ph-3). Twelve individuals of each parental line, control, and the F 1 were grown. The parental lines, F 1, and controls were separated into two groups (replications), so that each replication had six individuals of each parental line/f 1 /control. The replications were placed at opposite ends of the greenhouse so that when disease evaluations were conducted, the parental lines/f 1 /controls could be compared between replications to ensure the inoculation was uniform. Seven-week-old seedlings were used for the inoculation. On December 19, 2005, seven hours prior to inoculation, black, opaque curtains (blackouts) were lowered to cover the sides and roof of the greenhouse and the lights were turned off. In addition, the temperature was regulated between 16 and 18 C and the relative humidity (RH) kept at 100% using high-pressure foggers and an over-head humidifier. Plastic drop cloths were hung around the greenhouse benches to prevent the plants from being directly exposed to the water from the high-pressure foggers.

111 96 The humidifier and high-pressure foggers were turned off 30 minutes prior to inoculation. The plastic drop cloths were raised above the plants so that the plants could be sprayed with water using a home-made sprayer. The sprayer consisted of a spray-wand with nozzle connected to a 2 L plastic pop bottle. The pop bottle was pressured using CO 2 regulated from a CO 2 tank. After the plants were sprayed with water, 1 L of inoculum was sprayed uniformly over the plants using the home-made sprayer. Thirty minutes later, the second liter of inoculum was sprayed uniformly over the plants. Two hours post-inoculation, the plastic drop cloths were lowered to cover the plants and the humidity was turned on. On December 20, the blackouts were raised. On December 28, the humidity was turned off and the temperature returned to normal tomato growing conditions. On December 28, 29, and 30, the parental lines, F 1, controls, and F 2 seedlings were evaluated for disease severity based on the severity of the foliage infection on a scale from 0 to 100 by a minimum of two observers. A score of 0 indicated there was no foliar infection, while a score of 100 indicated that a plant had completely defoliated due to LB infection. DNA Extraction Leaf tissue from the parental lines, NCEBR-2 and PSLP153, was collected in 50 ml Falcon tubes. Each tube was immediately placed in liquid nitrogen for approximately 30 seconds and then placed on ice until it could be stored at -80 C. Genomic DNA was extracted from g of leaf tissue of each genotype using the CTAB method (BERNATZKY and TANKSLEY 1986a). The DNA was treated with 1 µl RNase A (10 mg/ml) per 100 µl DNA for one hour at room temperature. DNA concentration was measured at 260 nm using a GeneQuant spectrophotometer (Biochrom, Cambridge, UK) and adjusted to 1 µg/µl in nuclease free water.

112 97 Parental Survey To create a genetic map and identify segments of the tomato genome associated with LB resistance, DNA markers polymorphic between the parental lines, NCEBR-2 and PSLP153, were identified. To identify polymorphic markers, 1309 SSR, RFLP, and CAPS markers were surveyed for polymorphism between NCEBR-2 and PSLP153 (Table 3-1). The methods used to survey each marker type are discussed below. Table 3-1. Number of DNA markers surveyed for polymorphism between the parental lines, NCEBR-2 and PSLP153. Marker Type Number of Markers Surveyed SSRs 761 RFLP 307 CAPS 241 Total 1309 Simple Sequence Repeats The 761 SSR markers surveyed for polymorphism between the parental lines were identified on the Sol Genomics Network (including BAC sequences and whole genome sequence used to mine SSRs) ( on tomatomap.net (SSRs and insertions/deletions (indels)), on the Solanaceae Genomic Resources Website ( in a 2008 BMC Bioinformatics publication (TANG et al. 2008) and in a 2009 Molecular Breeding publication (OHYAMA et al. 2009). The marker sources are listed in Table 3-2 in the approximate order in which they were surveyed for polymorphism. The protocols used to survey the markers for polymorphism are outlined.

113 Table 3-2. Simple sequence repeat (SSR) markers surveyed for polymorphism between the parental lines, S. lycopersicum inbred line NCEBR-2 and S. pimpinellifolium accession PSLP153. The marker sources are listed in the approximate order in which the markers were surveyed. SSR Marker Source Number of Markers Surveyed SGN 152 Tomatomap.net SSRs/Indels 14 Solanaceae Genomic Resources 42 BMC Bioinformatics Publication 74 Molecular Breeding Publication 16 Tomato BACs 419 Tomato Whole Genome Sequence 44 Total The SSRs located on the Sol Genomics Network were surveyed for polymorphism in a joint project with graduate students Hamid Ashrafi (currently a postdoc at UC Davis) and Matthew Kinkade. A subset of the 263 SSR markers identified as polymorphic in tomato by Tang et al. (2008) based on analysis of publicly available, redundant EST sequences were surveyed for polymorphism between the parental lines. However, these SSRs had not been mapped. More recently, Ohyama et al. (2009) identified and mapped 685 new SSR markers identified in cdna and BAC-end sequences that were publicly available. These markers were extremely promising as they had been mapped. A subset of these markers was surveyed for polymorphism between NCEBR-2 and PSLP153. Publicly available BAC and preliminary whole genome shotgun sequence were mined for SSRs using Websat, a web-based program that locates SSRs and designs primers for PCR amplification using Primer3 (MARTINS et al. 2009). The mined BAC sequences were selected based on their position on the current tomato physical map ( The mined whole genome shotgun scaffold was selected based on association with previously mapped markers ( The mined SSRs were selected for the parental survey preferentially based on the di-nucleotide repeat motifs and for maximum numbers of repeats. Di-

114 99 nucleotide repeats are the most common type of repeats and are randomly distributed throughout the genome (ARESHCHENKOVA and GANAL 2002; HE et al. 2003). SSRs with maximal numbers of repeats were selected as higher numbers of motif repeats have been associated with higher levels of polymorphism (HE et al. 2003). Forward and reverse primers for these potential SSR markers are listed in Tables 3-3 and 3-4. Table 3-3. Forward and reverse PCR primers for SSR markers designed from BAC sequences for parental survey. Marker BAC Clone Forward Primer (5' 3') Reverse Primer (5' 3') B1A C01HBA0051C14.1 AGGCGTCAAACCTTGCTTTAGT CGATTTCTCATGTTTCGGAC B1B C01HBA0051C14.1 GTTACAACAGGCAGCTCAAATG TCTCATTCCTCCTATCCCAAGA B1C C01HBA0051C14.1 GATGGTTCTTTGGTGTCCTTGT TCATCTGGACGTGTTAATCAGC B1D C01HBA0051C14.1 CGCAAGGATTCAGCTCATTT TTCCCGGTAGGATCAGACTTC B1E C01HBA0051C14.1 TTTCTTTCCGCTTGTCCATC ACGAGATAGCAACCCCTTCATA B1F C01HBA0051C14.1 CCACTATCATTGCCACAGAAGA TGAAACCACCTATTCCTCCATC B1G C01HBA0051C14.1 AATAAGCGCATCTGGTGTAGTG AGCCAGTGTAGTGTGTCTTTGA B1H C01HBA0088L02.2 CTTGGGCCTTTCAACTACTGA TCACCTCTCTCCCATTCTTTGT B1I C01HBA0088L02.2 CTTTTGTGTGCTTGGAGAACTG AGAGATGATGCTTCGAGAGAGG B1J C01HBA0088L02.2 CTTCTATCTCCACCATTCCCAG GTCACAATCAGCACAGCCTTAC B1K C01HBA0088L02.2 CCCACTCAACTACCTCTTCCAC CCTCATTTAACCCTCCTCCTCT B1L C01HBA0088L02.2 ATACGGAGTGGTGGACCTAGAA AAAGAGGGAAAAGAGGGTTGTC B1M C01HBA0088L02.2 GCTGAGAAGCAATCTTGTGCTA CTGCCAAGTGAAAACTCACATC B1N C01HBA0108J06.1 TGGGGAAGAAGATGAAGATG TAATACACTTGCTGTGACGTGG B1O C01HBA0108J06.1 TGCCAGATAGGCTCTGTAAGAA AAAGAGATGTTCACCGTTCACC B1P C01HBA0108J06.1 GAGATACCAAGATTCCGTAGCG TACCCATTCACAACTGATGAGC B1Q C01HBA0108J06.1 TACTTGTTTACATGGCCTTCCC TGGGACTCTCCTACTTAGCCAC B1R C01HBA0108J06.1 GGTTGAGAAACAACATGACCAC GATTCCTTATTCCACCCATCC B1S C01HBA0108J06.1 AAAGCGCGTCATGGTAAAGT TGACCTAAAATGGGTGCTTG B1T C01HBA0159C14.1 CAACCAAGGGACTTAAATGCTG TCGATGGAGTTCAGGAAACA B1U C01HBA0159C14.1 TAAAGGATCTTGGCCTCTCTGT TCATTACAGCACCTATCATCGC B1V C01HBA0159C14.1 ACATCGAAATGAGCCCTGTAGT TGACCAATCAATACGGTCCAC B1W C01HBA0159C14.1 TGAAGTAGGGACAAAGCCATCT CGCCAGAACCTATGAAACAATC B1X C01HBA0159C14.1 GTTGGAAGGCACTTTCTCTGTT CCAAGCTGGAAGAAGCTGTAGT B1Y C01HBA0159C14.1 CTGAATGGAAGGTCATACGTCA GGTTACTCTTGTACTCTGCCCA B1Z C01HBA0003D15.1 GATCTACGTGAACACATGGGAA GAAAAGATGATGGCTAGGTTCG B1AA C01HBA0003D15.1 GTTAGTGGAAGTCAAGGGTTGG GTCATAAAAGCGAGATGCTCTG B1AB C01HBA0003D15.1 AGAGAAAATAGTCAAATGCCCC AGGTCGAAAAGGGGTAGAAAAT

115 100 B1AC C01HBA0032H01.1 GGTGTGAATACGTCACCAATGA ACCTTTCTTTCTCTTCTTCCCG B1AD C01HBA0032H01.1 TCTCGATGTATTTCCGAGGAGT CGAAGAAGTAGTGACGGGAGTT B1AE C01HBA0032H01.1 CGAGATTTGAACCTTTCCCA TCGGAAGAACACCTAACCTAGC B1AF C01HBA0033C15.1 CTGATCCAACACACTTTTCTGC AGCAGGACACCCATTTGTAGTT B1AG C01HBA0033C15.1 GCTCCAAGCAGCAATCTTAATC TGGCTAGGGACTACCGAAAA B1AH C01HBA0033C15.1 GTCTCCAAGGCATCAATTCTAC GTTCATTCTCAAGTAAGAGGCG B1AI C01HBA0155M04.1 CGAAGAAGTAGTGACGGGAGTT TCTCGATGTATTTCCGAGGAGT B1AJ C01HBA0155M04.1 CTGTGTCCGCTGATCTCAATTA GAGAAAATTCCAACAGTAGCCG B1AK C01HBA0155M04.1 GCAGCATGAAGGACTAACAGAA CGTGCATCTTGGTAATGGAAAC B1AL C01HBA0163B20.1 CAGAAGGGACATCTAAGGGAAA TGTCAGGTTGATTTGGTCTCG B1AM C01HBA0163B20.1 TAAACTTCTCCCTTTTCCCACC CTCCATCTCCTGTGGAATCAAT B1AN C01HBA0163B20.1 ATGACAAGGGTATTTTGGAGCC GGTGTATTCGATCTCTTGGAGG B1AO C01HBA0216G16.2 TTGATACACATTAGGAGTGGCG CCTTTACACCCGCAATCTTTCT B1AP C01HBA0216G16.2 GTTGGGTAATGTTCTACCTGCG AACTTTCCATCGAGCAGATCAC B1AQ C01HBA0216G16.2 ATATGATCTTCCACTGCCCA ATCACGCTCCAAAGCAAACT B1AR C01HBA0252G05.2 CTCTTGGAGGTCTTATTCAAGC CCCAAAATGTAGGTGATGGATG B1AS C01HBA0252G05.2 AAATGGTGGACATAGACGAAGG GTTTGGGTTCATAAGAGGACCA B1AT C01HBA0252G05.2 CCGGAAATGATGGACATAGAC TGCCATGTTCTGACAAGCTAAC B1AU C01HBA0256E08.2 GGGTTGGACAAAAGTTGGG AGAGAACTGGAAAGGGAAGAGC B1AV C01HBA0256E08.2 AATAATGGTGTGGTGTGTGACC CATTCTCCTCGTACACGTCCTC B1AW C01HBA0256E08.2 CTAAGTCCAAACACGTTGCAG AAAGAAGAGGAAGAACTGCGTG B1AX C01HBA0329A12.1 ATGGAGGGAAATAAGATGGAGG GACTTGGACCTTGGATTGTAGC B1AY C01HBA0329A12.1 GTTGCTCGCGCTCGTTTCT TGGAGGGAGGAAATAGAGTATCAC B1AZ C01HBA0329A12.1 CCACAACCGTCTTCTTTCTTTC CGTAATGCCCGATAAAACTACC B1BA C01SLM0026F20.1 TCCTAAACACTCATTTCCCACC GCTACCCATAAAGAAAGGGACA B1BB C01SLM0026F20.1 ACGCAGGAAATTGACCTCTCTA GGTATGGGTGGAACCAGAAAT B1BC C01SLM0026F20.1 GTTCCATAGCAAACACACACAC CTGCCCAAGTCTCTTTTGTCTT B1BD C01HBA0032H01.1 ATAGGTTGATAGCAGGCCATGT GGTGACGTATTCACACCAAGTA B1BE C01HBA0032H01.1 AAAACAGGAAGAGGGGAGAAC CATAACCTACCTCCACCGAAGA B1BF C01HBA0032H01.1 AAGAACAGGAAGAGGGGAGAAC CCATAACCTACCTCCACCAAAG B1BG C01HBA0155M04.1 GAATGCTAGAAGGATGGATTGG TGCTTAATGACCCCTTTGTCTC B1BH C01HBA0155M04.1 GGTTCGCTGCTACATCAGTCTA AAAACCTTCAACCCAGCTCA B1BI C01HBA0155M04.1 ACGTATTTTGCCACGTAGGACT AGAATGAGAGATGCTGTTGTGG B1BJ C01HBA0252G05.2 TAGTCATCGAACGTCTTGGTCA GGTAAACTATGAAGAGGGCTCG B1BK C01HBA0252G05.2 AAATGGTGGACATAGACGAAGG GTTTGGGTTCATAAGAGGACCA B1BL C01HBA0252G05.2 GTTACAACATCATCCACGCAGT TGGCAAAGTGACAGCCATC B1BM C01HBA0252G05.2 GTGGTGGATGGATGTGTGATAG GCCTTAGATTCATTTCGCACC B1BN C01HBA0256E08.2 GGAATATGGCGTACTTGACCTC TATTTCGATTGTATGGGCCG B1BO C01HBA0256E08.2 GGAATATGGCGTACTTGACCTC TATTTCGATTGTATGGGCCG B1BP C01HBA0256E08.2 AATAATGGTGTGGTGTGTGACC CCTCATTCTCCTCGTACACGTC

116 101 B1BQ C01HBA0256E08.2 AGCAAAGTTGATGCTATGGAGC GATGCGACGAAACTGACAAA B1BR C01HBA0329A12.1 CATGACCCATCTCAAATCCA AGGCCAGTTTGCGTATAACAAC B1BS C01HBA0329A12.1 GGATGCTCAGGTTTGTTGACTT TGCCTGCAAAGGTAGATTGT B1BT C01SLM0026F20.1 ACTATCGTCATTACCGGCTCTC CGTAGAGTTCCAAAAGTCGAAG B1BU C01SLM0026F20.1 CATAACCTACCTCCACCGAAGA GAGGCGTATGGGACTATTTCTG B1BV C01SLM0026F20.1 AATAGGTTTGGGGCATGAGAC GGCTTAGGCATACGAGAAGAAA B1BW C01HBA0005L21.1 AGGAATCACCGTTCAAACAAAC CCAATACAAAACTCGCCTCTTC B1BX C01HBA0005L21.1 AAAATTAAGCTGGCACTGAGGT CAACAACCAAAGCTCCTCTTCT B1BY C01HBA0005L21.1 ATATCAAAGCCGAGTGAAAGGA AAATGAGTGTAAATCTGGCGGT B1BZ C01HBA0005L21.1 ATTTTGGAAGCAGGTAGATGGA GGGAACAATAACTCAAGGAACTAGAAC B1CA C01HBA0005L21.1 CAGCAATTCTTTACCCCATGTT TAATGTGGCGCTTGATACCTTT B1CB C01HBA0008L19.1 CGCCTTTATATGTTGAAGTAGTGTC ATGTGTTGGAAGCGTGAAAT B1CC C01HBA0008L19.1 ATGATCTTTTGCGTGGAGCTTA ACCTTTCCCATGTTCACTTTTG B1CD C01HBA0008L19.1 GTGTATTTACCATCCGTTTCGC TTATAGGGTTTAAGGTGTGCGG B1CE C01HBA0008L19.1 TAGGAGGCAAATGCAATGTGTA CATATTTTGAGAAGCTGGGCTC B1CF C01HBA0008L19.1 GAGAGAGTGGGAAAGAGGTGAA GTCTCCAAATGTAATGGGTGCT B1CG C01HBA0008L19.1 ACCTCCTGTCCACTCACCAC GAAGAGCGACATCCTCAAAAGT B1CH C01HBA0008L19.1 GAGGAAAACTGATGGAGAATGG AGGGCTTATACTTTGCAGGGTT B1CI C01HBA0008L19.1 CTTGTTGACCTTTCGCTTTTCT TCAAGTGAGTAGGAGTGGGGAG B1CJ C01HBA0024O06.1 GTGTATTTTGTATGTGAACGAGACC AGAGTGACGAAAGGGGAATTTA B1CK C01HBA0024O06.1 TAGTGGGTGTGAAAGCAGCATA GCATTTCTTCTTCAACGATTCC B1CL C01HBA0024O06.1 CCTTGTGTTCTTGGATTACTTGC GCTTCTCAAATATGGCTGGTTC B1CM C01HBA0024O06.1 TTCTGCATCAAGGTGAAACATC AATTTCTTTGTAGCCAGGGAGG B1CN C01HBA0071F18.1 ATCCATCTATCGGCTCACAAAT CCCTCCACAAACACATACGA B1CO C01HBA0071F18.1 ATCCATTATCTGCGAGGTCTGT AAAGGTGGGCAATTACATCAAC B1CP C01HBA0071F18.1 TGTTGGTTGTGGTTTCTCAACT AATGTAACCGAAGATACGCTCC B1CQ C01HBA0071F18.1 GGAAATGTATCTTGAGACGAGAGG CGGTTCCTCCGGTTCTTT B2A C02HBA0303I24.2 TGTGTGGTAGTGAGTAAAGTGGG TCAAGACCCAAATGATGATGAC B2B C02HBA0303I24.2 AAGTGAAGAGTCAAAACATGCC AGTAGAGGAGATTCAAGTGCCC B2C C02HBA0303I24.2 GAGTCCTTTTCTGGAGATTTCATAC TAATACCCTGACTGCCCTGAA B2D C02HBA0280E02.2 CCTATCCCAACCTCTTGCACTA AAACTTAGGGCTGAACCAACCT B2E C02HBA0280E02.2 TTAGCTTCGCATATCTTGGCAT GCCATTTACATTGACTTTGTGAGC B2F C02HBA0280E02.2 TGGATTCTCTCACCTCCTCCTA ATTACATCCCATCTTCCCCTTT B2G C02HBA0209K17.2 ACTGCCAAAATACCTATGCGAC TCTGCTGCTCAAAACGACTAAC B2H C02HBA0209K17.2 TCCTTCTAAACCTTGACGCATT AAGCTCAGGAAAGTAAGCATGG B2I C02HBA0066C13.2 GCCAAACTATTTACCACATCAGC GTTGGATAGAGATGGACGCAAT B2J C02HBA0066C13.2 TAGATGATAAGAGCTGGGGAGC GGAAAGGCAACAGCAAGTATTC B2K C02HBA0066C13.2 AAGCTGTGAAGAGGAAGCAATC GGGATTAGTCGAGGTGTGTGTT B2L C02HBA0329G05.3 AAGGAGTTGTTTGAAGGTCCG TGACCAACCTATTATGGCAAGC B2M C02HBA0329G05.3 TGAATGTTTGTGTGGTGTTGG CGGCAGATAGTGGATACAATGA

117 102 B2N C02HBA0329G05.3 CTTTCAGATGTGCAGAGAGGTG CTTGCGTACTTGTCTTGGTCAG B2O C02HBA0009K06.2 GGTGTATCCTCCCATTAGAATTTAC TTCCGCCCTCGTGTAATAG B2P C02HBA0009K06.2 CCTTCACATTATCACGAGTTGC CATATTGGCTTCAAAGAGACCAC B2Q C02HBA0009K06.2 AACGCTTTGTTAGGCTCGACT TTGAGGGGTACTTGTGCATTATC B2R C02HBA0016A12.2 TATTTTCTGTCAAGGTTGCCCT TCAGGAGATTTTGGGGTCTCTA B2S C02HBA0016A12.2 CCAAGTCTCTTTTGCCTTTCTC CCTGCTAACTTTTCGTCATTTG B2T C02HBA0016A12.2 TCCAGATGTCGCAGAAAGAGTA GAACTTACCTGGCATCCAAAAC B2U C02HBA0111M10.2 TAGGCTTACAAAACCAAAACCG TACGGGCCACAAGAATAGGTAG B2V C02HBA0111M10.2 ACCTTTATGTTCCCACTGATGC TTGCACAGGTATTCGCTTTCTA B2W C02HBA0111M10.2 ATACAATTCTCTGCCCACGTCT TCCGTCTAAAATTCACCCAAGT B2X C02HBA0073P13.2 AGCTAGGACAGGTGCTGAAAGT TCGAGCGAATTAGATGTCTTGA B2Y C02HBA0073P13.2 ATACGAAAGTGAAGGCTGACAA CTCTGCTCAACTCATCAAATCA B2Z C02HBA0073P13.2 GCCGAATTTAGTTAGTCATGGG GAAGAAAGAGGCAAGCGAGATA B2AA C02HBA0073P13.2 ATTACCGACGAAGAGGAAACAA ATGAAAAGTTGAGGGTGATTGG B2AB C02HBA0177F12.3 ATGAGGGGACGTATTGAAGAGA ACATGGAGTATGAAAGGTTGGG B2AC C02HBA0177F12.3 AACCCTTAACCTTCCCCTGTTA GATACTTCATCACAGCCATCCA B2AE C02HBA0009K06.2 GAGCATCATATACATCCTTCGCT AGGTTATTGGAAACATGGCACT B2AF C02HBA0066C13.2 ACATCAAGAGGGCAGCTACAAG GCTGAATGTTGCGGTTAGTTCT B2AG C02HBA0073P13.2 TCCTGTGTTTGTTTCTGTGGAC AATGCAGATAGGAGAGGAACCA B2AH C02HBA0111M10.2 TGCGTTGCACGTTTATCCTA TACCTTTGGGTCGGTAACAAAT B2AI C02HBA0111M10.2 TTGGTTTCTCTCTCTAGGTTGCTT ATTCGTAGCCCTGAATGTGAAT B2AJ C02HBA0177F12.3 TCGTATTTGTTGCTATTGGCTG GGGAGTTTAGAAGCGTGAGAGA B2AK C02HBA0177F12.3 ACCGAGCCAAGAAAGAATGTAA GGGCAGGATGATGTATCTGAAT B2AL C02HBA0209K17.2 ACGACTTCCACAAGTATGAGCA TCTCACCTCTCTCCTATCTCGC B2AM C02HBA0209K17.2 ATGAGAAAGGCGGAGATGATAA TGAAATCACAACTCGAACATCC B2AN C02HBA0280E02.2 AAGCACATGGGTAGGAAGAGAA GATCAATTTCAGCCAGAGAGGT B2AO C02HBA0280E02.2 GCTTCCTTCATGGGTTAAAATG TGGTTCCCAGATTAGTTTCGTT B2AP C02HBA0280E02.2 AACTCTGGACCGAAAGAATGTC ATGTGGTTTGCGAGCTATTACA B2AQ C02HBA0280E02.2 TTTTGTTTAGCTGACTCGATGC TCATTATTACAACCCTCCGTCC B2AR C02HBA0303I24.2 GAGAGGGTGGAGGGTTAGTAGG TGGGTGATCTTTTCCTTAATGC B2AS C02HBA0303I24.2 ACATGCCTAATGTGCGAGAATA GCTTTGACTGCTGTGTTAGCTG B2AT C02HBA0303I24.2 GCTTTGACTGCTGTGTTAGCTG ACATGCCTAATGTGCGAGAATA B2AU C02HBA0329G05.3 CGCTGTACCTCCATATTTCCTC TGTAATGAGACCAAACCTTCCA B2AV C02HBA0046M08.3 CCCCACCATTTGAATTTTGTAG CGCCACATAGACGAACCTAAAG B2AW C02HBA0046M08.3 AAAGAGGGAGACAAAGTCATCG AATTACTGGGTTTTGCTGGAAC B2AX C02HBA0046M08.3 CCTAAACACAAGGACCCGTTAG AACCAATAAGAATCGAACCGAC B2AY C02HBA0046M08.3 CTCAAATTAGTGCATGAGGACA GTGTTTTCTACCAAAGGCAAAC B2AZ C02HBA0025A22.2 CCACAATAATCGGTTTTCACCT TATGCCGTTTTCCTTATCTGGT B2BA C02HBA0025A22.2 AACCGAGTTTAGGGGTGTTTTC AGCTTCTTTCACTACCAGCCAA B2BB C02HBA0025A22.2 ATGAGAAAGGCGGAGATGATAA TGAAATCACAACTCGAACATCC

118 103 B2BC C02HBA0025N15.2 AATCTTCGGCAGTAACCAAGTC ACACATGCCTTTCCTCAACTTT B2BD C02HBA0025N15.2 AAGCACATGGGTAGGAAGAGAA GATCAATTTCAGCCAGAGAGGT B2BE C02HBA0025N15.2 TTAGCTTCGCATATCTTGGCAT GCCATTTACATTGACTTTGTGAGC B2BF C02HBA0027B01.1 ATCTGTTTCAAGGTTTGCCTGT ACTATTTCCTTTTCGGGGACAT B2BG C02HBA0027B01.1 CTGTCATTGTAGGGGAAAGAGG TTCATCCATAGACACACGGTTC B2BH C02HBA0027B01.1 AACGAGGGGTATATCAGCTTCA GCATAACCTACTCAACATTTCAGG B2BI C02HBA0026M05.1 CTCGTGGCTAACGTGGATTATT CCTTCTCATTTCATACCTAATGTGG B2BJ C02HBA0026M05.1 TAGTCCAAAGTAGTGGTGGCAA CCAACCCATTTATTACCCAATC B2BK C02HBA0026M05.1 AGCTTCCCTCTCTCCTTCACTT GCCCGTAAGTATCACACAACAA B2BL C02HBA0060J03.2 GAATGTCAATTTCTAGCGTCCC ACAAAATCCTCGGTAACTCCAA B2BM C02HBA0060J03.2 AGAAATTGAGTTGGATCACGTC GCAAATGGAAGCTATACAAAGG B2BN C02HBA0060J03.2 CCCCAATTAGTTTCCACTTCAC ACTACCAAAGCACAAGGACAGG B2BO C02HBA0064B17.3 GGTCCTCCCTCCACTTTATTTT ATAATGCCCACAAGTCCCC B2BP C02HBA0064B17.3 GTTTCTTGATATGTGGACACTTCCT CCTCTTACTCGCCTCTCACCT B2BQ C02HBA0064B17.3 GCTCTGCTTCTCTTGGAAGTGT CCGGATGAGTATGAATGTGAAA B2BR C02HBA0072A04.2 TAAGCCAATCCTACCGACTCTT ATACTTTGTCCCTCCCCAAACT B2BS C02HBA0072A04.2 GTGAGATGAAACGTGAACCAGA ACCATCCCTCAAAAGTCAATCA B2BT C02HBA0072A04.2 ATGTGGAAGAAACACACCCTCT GGCACTACACAACCATGAAGAA B2BU C02HBA0101G09.2 TTGGACCTTTCATTCCTACTGC GTCTAAGTTGATGGTTGGTCAGC B2BV C02HBA0101G09.2 AACAGATATAAAACGCGCATCC ATACACGGTAGACCCAATGCTT B2BW C02HBA0104A12.1 TCTGCAAGTGGTTCCAAAAGAT CAGTGCCATCCAACAAATATCA B2BX C02HBA0124N09.1 AAAATCTTCTTCGTAGGGCCA AGGAACCATGACAAACAATTCC B2BY C02HBA0124N09.1 TCGAGGATTGAGTGACATAAGG GGGATGCGATCAAGAATATGA B2BZ C02HBA0124N09.1 AAGGCTGTGGAAAGGCTAGTTA ACTCCGTACACAAGGGGACTT B2CA C02HBA0122F06.1 GCAAACCTAACTTTCTCCCCAT ATTGACCGAACCACGTTAAATC B2CB C02HBA0122F06.1 GATTCTATGGAGAGAGAGGCGA AAATTGGGTGTGAAGTGAAAGC B2CC C02HBA0122F06.1 AAGACAAAGGGACTCGTACTCG CACTGCCTCAATCCTTCTTAGC B2CD C02HBA0160F05.2 ACTGAAAGGAACATTTTGACGC GAAGGAAGTTGGTGATTGGAAC B2CE C02HBA0160F05.2 AGCTTCCCTCTCTCCTTCACTT GCCCGTAAGTATCACACAACAA B2CF C02HBA0160F05.2 ATGTTATGCAGTTTGGCCTCTT TCTCTGATCCCGACTTAATCATC B2CG C02HBA0159F19.3 ACAAAATCCTCGGTAACTCCAA GAATGTCAATTTCTAGCGTCCC B2CH C02HBA0159F19.3 AAGTTTAAGAGGATCGCTGCAC AGCAATTCCAAGGAGCTGATAA B2CI C02HBA0159F19.3 GGCTGGAATAAGGAGTACGTGT GCATCAAGCATCACCATCTATT B2CJ C02HBA0189G15.1 TTTCTATGGCTCCCTAACTTGC GAAGTGCCGATACACTACAAAATG B2CK C02HBA0189G15.1 CACATGACCAAACGCCTACTTA TACTCTCGTCGGTGCTGTTACT B2CL C02HBA0189G15.1 AGTGCATAATTGTCCTTTCACG TGAGAGAGGGAGTTAAGAAGCG B2CM C02HBA0168N10.2 GCGTAATCAATAAACTCCGAAC AGTACATAAGAGCAGCGCAGAC B2CN C02HBA0168N10.2 AAGTTGTCCCATAAATGCTGCT GTCTCCATAACCTCCTCATGCT B2CO C02HBA0168N10.2 TTTCACCTTCTACCCTGCATAA AGTGAGGGGTTTGCATAAAATC B2CP C02HBA0172H10.1 GCGGAGCTTAGTGAGATTTTGT AGAGGCGGTGTCAGAATTAAAA

119 104 B2CQ C02HBA0172H10.1 ATTAGGATAAAGGGATTGGGGA GGGATAAAAGTGGCTAACTCCA B2CR C02HBA0172H10.1 TGAAGCAATTCTCCTAACATGG AAAGCAAACACGACAACCCT B3A C03HBA0318C22.1 GGCCCCTCCATTGACTAGATTA GAAAGGGTATGGGACCTTGTCT B3B C03HBA0318C22.1 TGCGAATCACCACTAAAGAGAA AAGCAAGGGGCATTTATAGACA B3C C03HBA0318C22.1 CGTTTGGGGTCTGTTTCATAGT TAGTTAAAGGTGCCTCTTGGGA B3D C03HBA0001E24.1 TTCAGCCTACAGTTGACCTCAC TCGAAGCTCTTGTTTGGTGATA B3E C03HBA0001E24.1 AATAATGCGCCTCTCTCCACTA TCAATAGGCCAACCTTGATCTC B3F C03HBA0001E24.1 ATTTCTGTTCTTGTCCCCTTCA ACAACTTCCTCGATCATTGCTT B3G C03HBA0012D06.1 TGGCCCTCTTTTGTGTGTTTA ATCGAGAAACCATACGCATCTT B3H C03HBA0012D06.1 AGAGGGGTTGAAAAGTGGTTCT AGGGAGTGAAAATGGAGCAATA B3I C03HBA0012D06.1 AGTGGTGTGGAGCCAGTTG GAGAACGATCATACACTAGCCATAA B3J C03HBA0030O03.1 TATGAATCTCACACTTCGATGC GAGTTAGTCAAAATGGGCTTGA B3K C03HBA0030O03.1 TCTACCTCAAACTCTCGCTCG GTGGCAAACAAATCTGAAAGAG B3L C03HBA0030O03.1 GGTAGAATCGCATGGTAGGAAG GTGGGGTTTAAGGAACGACAT B3M C03HBA0323D22.1 TGCCAATGTCTAATCCTCGTAA GTGCAAGTGATGAAAAGCAAAG B3N C03HBA0323D22.1 GAGGAGTGAGACGAGCGATACT CTCCCAATCTCTGCCCCT B3O C03HBA0323D22.1 AGATTTGGGCTCTCGTATTCAG CGTATTTGGTTTTGAGCAGTTG B3P C03HBA0029M12.1 ACACGGCTTACGACAGGATATT CCTCAACAATCTCTTCCTTGCT B3Q C03HBA0029M12.1 GCCAAACAGGCTCTATATCATTCT CATTAACTCTGTCACCGGATTG B3R C03HBA0029M12.1 AGCGTCAACAAAGAGGAGAAAC GGAAAATCCGTCTATAAGGGTCA B3S C03HBA0020P05.1 AAGTCGAGAGGTGGTGAGTAGG AAAGGGGAATCTGAACAAAGGT B3T C03HBA0020P05.1 TGTAAGTATAGCCTCCCTTCCG TTCTTTGACACCAAATCCTCTG B3U C03HBA0020P05.1 TGACGATGTTCCTCTCCTCTTT GCAAAACTTGTTCCCTCTTTGT B3V C03HBA0143N09.1 TGCTAGACCCCTACCAGTCCT ACAAATCCTCCATTGCTCTGTT B3W C03HBA0143N09.1 GATGTGGCAAGTTAGTGAGTGG AATGCGCTTGACTGTTATCCTT B3X C03HBA0143N09.1 ATTCGTAAGTTTCCGTCTGTCC TAGAGGCATGATCGAGATTTGA B3Y C03HBA0233O20.1 CGGTGGTAAGATTGCTTTATCC GGAGATGTAGTGGTATCCCCAA B3Z C03HBA0233O20.1 TCTAAAGAGGAAAAGGAAGGGG TGATGCAATCCAATCTATGTCC B3AA C03HBA0233O20.1 GTTGGTTTAATGCACATGGAAG TTCAAGATTTTAGTTGCCCACC B3AB C03HBA0224P23.1 CGAAGACGTTTGGTACATTCAT TGCTTTCTCTTTTCCTTTACCG B3AC C03HBA0224P23.1 TCTATGAAGATCGCTGGGG ATTCTAATGCTGGATGATGAGG B3AD C03HBA0224P23.1 AAACAAAGGGTAGCGTGAACAT CCAAACGTCAAACGATGAGAT B3AE C03HBA0143N09.1 GTCATAAGGGTGGATTCTTTGG TTCTCTTGCACAACAAGCAACT B4A C04HBA0024G05.1 CAAATTAGCTCACTGTCCCAAG CATGTTTGATTTTGCACCCT B4B C04HBA0024G05.1 TCCGTTTGTAAGTTGGACCTTT TTATGGTGAAGGGTAGAGGGTG B4C C04HBA0114C15.1 TCACCAGAGATTTGTTATGAGGC ATTCTAACTTCAACGTGTGCCC B4D C04HBA0114C15.1 TCTGCATACATCCTACCTTCCC ACCCCATTTTCATTAGCAGTTC B4E C04HBA0114C15.1 ACCCCAAACAACAGTAATCACC TTGGAATTGGAAGTGAGGTCTT B4F C04HBA0132O11.1 GAACGAACCCTAGAAAGTGCAG GATCAATCGTCCCCTTAAATTG B4G C04HBA0132O11.1 ATGGATTTAAGGTGTCTTTGCG AACGAGGGTATATCAGCTCCAA

120 105 B4H C04HBA0132O11.1 ACACATCACGGAGTTTGATTCT TTTCAAGATCACGGCCATATAC B4I C04HBA0255I02.1 CTTTCCATTTGAGGAGAGCAGT GCCACAATAGAGACAGCCTTTT B4J C04HBA0255I02.1 AAAGGCAAAAGAGACTTGGACA CCCTCATATTCTTGCTTGCTCT B4K C04HBA0128L09.1 GATTTGGAGTCATGTTCATTCG CACAACCTACTGGCTTTTATGTG B4L C04HBA0128L09.1 GTGGGAGTGCTTCACCTTTAAT TCTAGCTCTGTCGTGATCCAAA B4M C04HBA0128L09.1 TCGCTTGTTTCATTTGTTCG CGCCTATCTTTGTGAGGTAGAGA B4N C00HBA0305L18.1 TACTGCTTCCTTCAACCTCCAT AAATCAACCAACGACAGATCCT B4O C00HBA0305L18.1 AGTCTGCCTTCTTTCGGAGTAG GTCCAACTTTACAGATCATGGC B4P C00HBA0305L18.1 TGAATTGATGTAAGGGCTATGC GACCAACCAAAGGGTACTTGAG B4Q C04HBA0219H08.1 GTTAAGCAAACCGTCACATACG GGTTACACGATTCACCTTCAACT B4R C04HBA0219H08.1 GTAATGAAAGTGCGACGATGAA CGTGAAAGTGAGATGCTTTGTG B4S C04HBA0219H08.1 ACTAGCTGTCAATTTCGTGTGG TTCTCCCACCATTCCTAACATT B4T C04HBA0029F16.1 TGCTGGAAGATCAAGAAGTATAAGC ACACACGCACACACACACATA B4U C04HBA0029F16.1 GTTGTCGGTAAGACATTCTCCC GAGCATAAGGATATGGTTGGTGA B4V C04HBA0029F16.1 TCACACACACACACACACACAC TACCACTCATCATTTGGTTTGG B4W C04HBA0006E18.1 CCATGTCACCCAATGTAAACAC TGCAAAGGTAAGGACCATGAA B4X C04HBA0006E18.1 GTACTAACCCCATTTCCTTCCC CATAGACGCACACAGACACAGA B4Y C04HBA0070F01.1 CTATTTGGCACCTCTTTTGCTC CGACATGAATAACCCATTCCA B4Z C04HBA0070F01.1 TCCTTTTCCTACAAAGATGGGA CAGGTTGGTATTCATGGTTCCT B4AA C04HBA0070F01.1 CCTCCTTATTGATGGAAGTTATCC ATTCTTCAGCTCTGCTTTGAGG B4AB C04HBA0077O05.2 CCAACATGGCACAAACAATCTA GTAAAGCTAACCCCAACACCAA B4AC C04HBA0077O05.2 TAGGGTGGGTTTGTTAGGAAGA TTTTATTAGATCCCCTCAACGC B4AD C04HBA0077O05.2 GAGCGAAGAGAAAAGGAACAAA GAAGCAAGCAAAACCCAAATAC B4AE C04HBA0080D03.1 CCAAGAGGCTAAGGAGGAATAA GCTAATAAGTCACACAATCAACTCC B4AF C04HBA0080D03.1 GCCTGGAAACGCTAAATAACAC AGTGAGAGAGAACAGACAGGGG B4AG C04HBA0080D03.1 CGCTCGCCAAATATACAAATAC TTAAAGGGAGGAAAGAGACGAG B4AH C04HBA0066O12.1 CCAGGTTTAGGCGTTCAAAATA AGCCACCGTAATATACACCGTC B4AI C04HBA0066O12.1 TCTTTCTCAATCCCTATGCTTG TAGTTCATTTGATGCCACACC B4AJ C04HBA0111P03.1 GACAGACTTGGATCTAGCCACC GCCCTTCAATCTTGTGGTCTTA B4AK C04HBA0111P03.1 TTTCGGACATAAATTGAGGGG TCTAGCAAAAGGTGGTGCGTAT B4AL C04HBA0111P03.1 GGGAAATACAAAGGGAAAGAGG GCTAAACATGGGTTTTCTTGCT B4AM C04HBA0203L19.1 GTCACGAAGAGATGAATGAATAAGG GCTAAACCGATGTGTTAATAGTGGT B4AN C04HBA0203L19.1 AGAGAATCCTTATTTGTGGCGA CAAAGCCCCTTCACGTATTTC B4AO C04HBA0203L19.1 ACTTAGGCGGGTCTAGGGTTC AAGGTGTGTCTCAGGGATTTTG B4AP C04HBA0077O05.2 AGGGGCTAGGAAAGCTAAAATC TAATTGAAAGGGGTTCGACATC B5A C05HBA0058L13.1 CACGTAGACACAATGGAGATGG GGAGGATGGCACTATACGACA B5B C05HBA0058L13.1 TCGTCTTTATCCCATCTCGC TATTAGACACACATCCATGCCG B5C C05HBA0058L13.1 CACATCAGAACCACATCGAAAT GTCATCGACATCACCCTTCTAA B5D C05HBA0168M18.1 GCAACATCAACAACAACAACCT CCTCATTCATCCTCAGACCATT B5E C05HBA0168M18.1 GGTCCAGAAGAGAGGGCTTT CTGTGATGAGATGTGATTCTACCA

121 106 B5F C05HBA0168M18.1 TTCAAAACGACCAAAAGGGT AAATAAGGTGGGCTTCGATGT B5G C05SLM0115G01.3 GCCTCATAAATCCTCATTTTGC CTTGCAGGCATGTTGTTAATGT B5H C05SLM0115G01.3 TGAAGTGTATCTGGTTGAGGGA TCGAAGGATGAACAAGTTTGC B5I C05SLM0115G01.3 TCAATGTTAGGACTTTAGGGGTTC AAAAGCAGAGCCAGGTGAAA B5J C05HBA0135A02.3 CATTCACAAACATCCAGTACCC TCTCGTATTCTTGTTGCAGCTC B5K C05HBA0135A02.3 TGCTCAAAATACCCCTCAAA TTCTCGAACATCGTGCATTAC B5L C05HBA0135A02.3 CCTTTGCTAGATGGTGCTATCC AACAACATACCCAGTGAAACCC B5M C05HBA0251J13.2 AGCCGAAGTTAAAAGCCGTATT AAATTCAAGTGTATCGCCGTCT B5N C05HBA0251J13.2 TCCCACAATACACAAGGAGAAA CATATCCCCATGCCTACATCTT B5O C05HBA0251J13.2 GAGAGAAAGATGTAGGCATGGG CTGAGATAAGCCCAAAAGTGCT B5P C05HBA0058L13.1 TCAGAACCACATCGGAATTATG ATACAGGCAATGATGAAGACGA B5Q C05HBA0058L13.1 CGCGATGTGAATTTGTCTATGA AAAGTCGGGTCTGGGTTATTCT B5R C05SLM0115G01.3 ACCTTTATATCTTGGAGCTTCCC CCCTACAGGAGAGTCACAACCT B5S C05SLM0115G01.3 GCATAGGTTGAAGGGGTACTTG GGCATGTGAGAAGAGATCCAT B5T C05HBA0135A02.3 CCCTCAATTTTGTGATTTAGACCTG TCCGCCCTTGACATTAACAAC B5U C05HBA0135A02.3 TATCTCGTGAGTTGTGGTTTGG AGTTATCGAACATCGTGCTTTG B5V C05HBA0251J13.2 ACATTATCCGTACCACTTTGGG ATCCATGAACAAACAAGGGAAC B6A C06SLM0065P01.1 GGATCAAGTGGACAGACAACAA GCTGCGTCTCAATCTCAAATAA B6B C06SLM0065P01.1 TGACATACAGAACCTCCAACAT AGACGCAAAGGAAGAAGCTAT B6C C06SLM0065P01.1 CAGGCAATTTCTTAGCGGAAT CTTTCACCCCAGGTTTTCCTAC B6D C02HBA0101G09.2 TTGGACCTTTCATTCCTACTGC GTCTAAGTTGATGGTTGGTCAGC B6E C02HBA0101G09.2 AACAGATATAAAACGCGCATCC ATACACGGTAGACCCAATGCTT B6F C02HBA0101G09.2 GAGATCCCACTGCCTAAATCTG CACTGGAACTATACCGAGGGAG B6G C06HBA0021K07.1 CTAGACGCTCATGCCTAGTGAA CACATTATCCCTTTCCTGCAAT B6H C06HBA0021K07.1 TATACGCACGACGAAACGAA TGTAGGGATAAAACACGGAACA B6I C06HBA0021K07.1 ATGCACCTTCCATCTCCTTTTA GTAAGTTTAATTGCCCTGCCTG B6J C06SLM0082G10.1 TAGGTTGGGGCAGAGCTAAGTA GGGGACAAAGGCAGTAGTGATA B6K C06SLM0082G10.1 TTTACTCTCTCCCTGCTGTTTT TGGTGCTAATGACTTGATATGC B6L C06SLM0082G10.1 ACCTTTTGGCATTTATCACAGG CTTGCTGGTGTTTGTGTTTGTT B6M C06HBA0055E14.1 CGGGGATAAACATGAACTTAAC GGCTATCTTTGAGTAACACGACA B6N C06HBA0055E14.1 GTGGGAGGATTCTAAATATGCG CCCCAACATTCTTTTCTCCA B6O C06HBA0055E14.1 ACGACACAAGTAATAAGCAAGCC AGTGAACGGAGAGGAACACAAT B6P C06HBA0026E06.2 TTGAAACAAAGGTGACAAGCC CACTATTCTACGGTTCATACCATGC B6Q C06HBA0026E06.2 TAGAACGCTCCATGACTCCAC CTTTAATCTAAGCGCCAGCAAC B6R C06HBA0026E06.2 TATGACGGGAAGGGTAATTTTG CAATTTCTGCCAATATCCACG B6S C06SLM0082G10.1 AATAGTTTTGGCTCCCCTTTTC AGTGGACTTAGAGATGATGGCG B7A C07SLE0071O22.1 ACTTTGGACTCATGTTGGAGAG AAAAGAGGGAATGAAGGGATAG B7B C07HBA0287B22.1 GCATGATTAGCTGTTGGATGAA CCATTAGGGGCATCTTCAATAA B7C C07HBA0287B22.1 ATATCCGTGTCTCCCACTCTGT CATTTTGGATCAGGGAAAGAAG B7D C07HBA0287B22.1 ATAAGAGGAAAGAGGCCCAAAC TGACCCGCGTTGGTATAAAT

122 107 B7E C07HBA0130B18.1 ACCGGCAAAATGTAAATGGA GCTAGTTCGGTAGTAAATGTGGAAA B7F C07HBA0130B18.1 GCTACCCCACCCTTTTGTTATT TCACTTCGATTGAGTTTCGTACC B7G C07HBA0309F18.1 GCAAAGATACAGGTAGCAGAGGA TCGTCAGAACAGGTACAAGAGC B7H C07HBA0309F18.1 GATACATCTAATTTCTGATCCCACG AAGTCACGGCTTAGGAAGAGG B7I C07HBA0309F18.1 AGGGTCATTGTGGTTGGTTATT CATTTGCCTTCATCGTTTGT B7J C07HBA0287B22.1 CTCACACACACACCTTGATTTACA GGCTCCTAAAATTGCCACAAC B7K C07HBA0287B22.1 GTTACCTCATTTGATTACGCCC CCTTACAACTGCAAACACCTGA B7L C07HBA0287B22.1 TGTAAGGCACCTAAGATACTCCG CGAACAGTACCCGAGTTTGG B7M C07HBA0287B22.1 CATCTGGTGAACAACTACGAACT AGCAAAGACCAAAGGTAAAAGG B7N C07HBA0309F18.1 ATCAAAACAGGAAAAGGGGACT AACAGGGACAACCATTACATCC B7O C07HBA0309F18.1 GTGCAAATGCTGAATGAAGTGA AGAGTCCGAGCAACAATTAGGA B8A C08SLM0031I10.1 AAAACCTCTCACCAAAGCATGA TGCTAGGAGTTATGATCGCTTGA B8B C08SLM0031I10.1 GTGTTTGCTCATTTGGCTCA ACTGTTTCTCCTGTAGTGGCAA B8C C08SLM0031I10.1 TTAAACCAGCTCACCCACAAC GAGCCAAAAGAAATGGAGAGAA B8D C08SLM0023K18.1 GAGAAACATGAAGTCAACGCAT TTGAGCTAGGAGATACAGAAGGC B8E C08SLM0023K18.1 ACTGGGAGAGGAAAGGAGAGAG ATCATTGTTTGAGGGGATTGAC B8F C08SLM0118A18.1 GTCGGTTGGGAAATGAACTACT TGTACTAGGGCAAATCAAGCAA B8G C08HBA0011I05.1 TTGCTTGGATTTGGTGTCAA GCACAGTTGCTTTATCACTTCG B8H C08HBA0011I05.1 CTTGCGTTTTCGATGTATCACT CTACTACAACAATTATGGACGAGGA B8I C08HBA0011I05.1 TGGCACAAACTCCAGATATTCA CAACCGATATTAGCTCGTCTCC B8J C08SLM0031I10.1 TCCCTTGGAATTGGGATTTT GAAGAAGAGTAAAGCGGAAGGC B8K C08SLM0031I10.1 GCACGGGCCATACTCCTC TATAGCAACCGCATCATACACG B9A C09HBA0072G22.3 TGACACGCTATACACCACAAAA TTCATGTCGGGGTTCTAAAGAT B9B C09HBA0072G22.3 CCCTCGCTTCTCTTGCTTATAC ACACGCACACACACACAAAAT B9C C09HBA0072G22.3 CAAAGCCGTGATCGAGAATTAG CACATCGAATGGGATTGAAACT B9D C09HBA0203J14.1 ATCTGTGTTTACCTGCTTTGGG ATTGGTATGCTGGATCTGCTG B9E C09HBA0203J14.1 AAGTTGCATCAGAACGAGGG GATTACATAGAGGATGGCTGTCAA B9F C09HBA0203J14.1 TATACATCCCTTGTGGTGGTTT TCTGATGACTTCTGCTCAACAA B9G C09HBA0165P17.1 GCGGGAGAACTATGGAAGATAA GCACACACACACAGACAGAGAA B9H C09HBA0165P17.1 TTCTTTCTTGACGCAAAAGC TAGGTGCAACGATGAAAATAGC B9I C09HBA0165P17.1 GCTCGCTTCATATCGCTTACTT AAGACAAAAGAGACTTGGGCAG B9J C09HBA0072G22.3 TTTATCCTCCTTCTCTCCCTCC CTTTATCGCACACTATCCTCCC B9K C09HBA0072G22.3 TTTCTTGTTGGATGAGGGATG ACCGACAGTTTCCCATGAAC B9L C09HBA0072G22.3 GCTTACACGCCATATCAAATCA TCTGACTTCTTGAGCATATTGTACG B9M C09HBA0203J14.1 GTATAAAATGCCCAAGGACCAA TGAGAGGTGTTGTGATGATTGA B9N C09HBA0203J14.1 AGCCCCTTGAAAACACTACACA CATTTGGCACACAAGATAATGC B9O C09HBA0203J14.1 CCCTCCCACTCTTTCTCTCTCT GCAAGCTACTCTTTCCAACTCC B9P C09HBA0165P17.1 CAATGAGTTTGGCAGGTGTTAG CATAGTTAAGGGGTGATTTAAGCC B9Q C09HBA0165P17.1 CATTTTCTTCCTTCCCTCGATA GACCCATCTTACCCTCACATTC B9R C09HBA0165P17.1 TTTTCCGATCATACCAATCG TTAATTTGGCAGTCTCTCATGC

123 108 B10A C10HBA0111D09.2 GGTCCTTGTGGGTCTATGTTTG CTTAGGTTTCGTGAAGGTTTGG B10B C10HBA0111D09.2 AGAAAGAGAGCGATTCCTAAGC TTGGTATCAGAGCATGAGGTTG B10C C10HBA0111D09.2 GTCACTTTTACCCCACTTCACC GAATCGGCTCCTTGATGATAGA B10D C10HBA0111D09.2 CTAGGATGTGGTTTTGGGATGT AGGTTCACTCGATGCCTACAAT B10E C10HBA0111D09.2 AGCTCGAATGAATAGATCACCC TACCGACCTACCCTTCTCTTGA B10F C10HBA0111D09.2 CCTTTATGTTGTCGGTTTCCGT CTCAAGCACCCATATTCCTTTC B10G C10HBA0041K23.1 CCAAATGAAAAGAGCAGTAGCC TTAGGCGAGTAAGGTTCTCAGG B10H C10HBA0041K23.1 CTTCCCTCTCTCTTTCTCATCG TCATTCATCTAGTGTGTGTGCG B10I C10HBA0041K23.1 GGGGTTCTCATTATCTCCCTTC TCTCTTGACATATTCCCAGTCG B10J C10HBA0115K16.1 TGTCCAGGGATATTACCTTTCG ACTAGCCTCTTAGCACTCGCC B10K C10HBA0115K16.1 TCACGATCCAAAGTACACCCTA TGTAGGTGGCAAGTGAGGAGT B10L C10HBA0115K16.1 CACCGACATACAAACCTGCTAA GGATAATGGTCTGGACATGGTT B10M C10SLE0045H11.1 TGATTCGGACACTACCGTCATA CAAACCTCTAGTCAAGGCATCA B10N C10SLE0045H11.1 AGAGTGGATTGAGAGCCAAGAG CTATTCAAGGGAGCTGAAGTGG B10O C10SLE0045H11.1 CTGTCAAATCTTTTCCTCTGCC CGCGAGCTAGACATAAGAGTCA B10P C10HBA0041K23.1 CTCATTTTCTTCTCCGCTCAGT TTTGTTCCCATTCCTACTCTGG B10Q C10HBA0041K23.1 CCCAATCCACTCAACCAAAA GTCGAGGTAGGGGTGATAAATA B10R C10HBA0041K23.1 AAAGAAACGGCGACATCAAC GAGACGAACTAACGACAATCCC B10S C10HBA0041K23.1 CTTCCCTCTCTCTTTCTCATCG TCATTCATCTAGTGTGTGTGCG B10T C10HBA0041K23.1 TCTGTGATCGTGTTGAATCTCC TAAATATACCTCATCGCCGTGG B10U C10HBA0041K23.1 TGGAAATTGACTCTCTGACCCT CATAACCTACCTCCACCGAAGA B10V C10HBA0115K16.1 TCCACTTGAGACACACTACCCA AGGAACTTGTGGGGAACACTTA B10W C10HBA0115K16.1 CAAACCCCTCACAAACATGA AGGGTAGGTCAGTCAACGGTC B10X C10HBA0115K16.1 AAAAGGCTCGATCACAATGC CCAATTCTCCCTAGAAACCTCC B10Y C10HBA0115K16.1 CACCGACATACAAACCTGCTAA GGATAATGGTCTGGACATGGTT B10Z C10SLE0045H11.1 CCACCTTCTACCCATAATCCAA ACGGTGTCGTTTCATTCTCTCT B10AA C10SLE0045H11.1 CAGTGGTTACTCCAACAGCAAG CCATAAATGAGCCCTCCAATAC B10AB C10SLE0045H11.1 CACGACTATCACCACCATCATT CACCCTCCAAACATACACAAGA B10AC C10SLE0045H11.1 ACTCGTTGTTACTCCCTCCAGA TCAGGTTAGAAAGGATGGCACT B10AD C10SLE0045H11.1 AATCCTCACTAACCATGTTGCC AGCTTGAAAACACTCAGGAACC B10AE C10SLE0045H11.1 AGACGACCCCATCATTAAGAGA GGAATAACGACGAAGCAACAAC B10AF C10SLE0045H11.1 ATGTTAAGTCCATCGTCCTCGT TGCATGATATGTTGGGATCG B10AG C10LEHBA0011E16 TTCAAGAGAAGCCATTTTCC GATCTGAAAGTACCATTAGGCG B10AH C10LEHBA0049K02 TCGCTCTTCTTTCTTTTATCGC TGTGCATCACTAACCCACTCAT B10AI C10HBA0020A12.1 GGGACTCATTAAGCAAGAACCA AGTGGCAAGTTTCATGGCAG B10AJ C10HBA0020A12.1 CTGCCATGAAACTTGCCAC CCTACGTGATACGATATAATGCACA B10AK C10HBA0020A12.1 GGATGAAAGAGAAATAGAGCAGG ATAAAGGCCAACTTTGAGAAGG B10AL C10HBA0020A12.1 CCCTCAATCATCTATTCATCCC TCATATCCACTTTTGCTGGTTG B10AM C10HBA0020A12.1 AGGATCTGAAAACCCTTGGTG TTACCGATGTCACCCTAACCTT B10AN C10HBA0020A12.1 CAAACCAATGTTATCAGAAGCG GTGTCGTCATCAAGGCTCTACA

124 109 B10AO C10HBA0188N09.1 TTTCTAAAACGACTAAGAGGGTCG TCTGTTTACCGGCCTTGAGTAA B10AP C10HBA0188N09.1 CTTCGGACTTAGATTGTGTTCG AACTTGAAACCTACCTGGCAAT B10AQ C10HBA0188N09.1 GAATTTTCATGGGGAAGGTAGA CATTTTGAGAGCGTTAGGGTTT B10AR C10HBA0188N09.1 GCCGTTTGGGTGATTGTC AAATGGAAGCGTCAAAATCG B10AS C10HBA0188N09.1 TGTTGGAAGTGATTCTTTGGAG TGAAGGTTAGGGTTGTTTTGGT B10AT C10HBA0188N09.1 TGGGGTTAGAAGAAAACTCGAT CATAAAAGAAGAAACGCATCCC B10AU C10HBA0234C10.1 CCTACGTGATACGATATAATGCACA CTGCCATGAAACTTGCCAC B10AV C10HBA0234C10.1 AGTGGCAAGTTTCATGGCAG GGGACTCATTAAGCAAGAACCA B10AW C10HBA0234C10.1 TACCGGAAGAGGAAAATGTTGT CACGAAATGTGCAACGTAAGAT B10AX C10HBA0234C10.1 ATAGACCACACCACATCACAGC GAATTTTGTCCAAGGAGGAATG B10AY C10HBA0234C10.1 CAGCTATGCACATTATCCAAGG CGTTTTAGCGGTTCTCTGGTAT B11A C11HBA0034I10.2 CGTTGTGTATAAATGCTTTGCC TCAGCTATTGTTGTCTGAGGGA B11B C11HBA0034I10.2 CCCCTTTCTCTCTCGTTGC TGCAGTACAACCCTCGAAAA B11C C11HBA0034I10.2 TGTGCCTTATATGAAACCCCTC TGACCGTTATTGGTGTCTTGTC B11D C11HBA0064J13.2 TTTAGATCAGAATACCACCGGC CATAAGTTCCAAACAACACCGA B11E C11HBA0064J13.2 GTTTTGTGTTTTGGTGCTTGTG GTTTCTAGGGTTCTCATTTTGTGG B11F C11HBA0064J13.2 TCTCCCGAACGTACTCTATCTTCT GTAGGTGAAGGCCGTTTGTAAT B11G C11HBA0119D16.2 CAATAGGGGTAAGGTTTGCGTA ACAGGTAACACAACTGCTACTGATAGA B11H C11HBA0119D16.2 CACAGCTTTTGTGGACAGGTTA AGAGAAAGACACGAGAAGGACG B11I C11HBA0119D16.2 TAGTGTTCACGGTTCGGATAAA CAAACGGGTCCTAGTGTCATAA B12A C12HBA0140M01.1 CAATCTTACCTAAACACTGCAACTG AGCCATTCAGTCACAACAACAT B12B C12HBA0140M01.1 AATGACAAATGAACCAGAACCC CAGAACCTGAAGGCAAAAGATT B12C C12HBA0140M01.1 CACACTCAGACCCCACTCTACA ATCTGCTACTGAAACGAAACCC B12D C12HBA0206G16.1 TGTCTTCACTCAACGAGGTACG GAACCATCTCTACATCCTCTACTGC B12E C12HBA0206G16.1 CAAACTAAGAGGGTAGCGAGGA CGGAGCCCACACCTTTATC B12F C12HBA0206G16.1 ACTGTATAAAACGCCTCGCCT TCTATGTGGATGCTTAGTTGGC B12G C12HBA0140M01.1 TTATGGTCGTCCTTCCAGTTTT ATCAGCCCAGCTCACCTAATAA B12H C12HBA0206G16.1 TAGTTGCACAAGGGTAGACGTG ATGCCAACATTCAAGTGATTCC B12I C12HBA0206G16.1 TGAGGTGATATGTATAGTGGTGGA TTGAGATGGAATGAGTATGTGC B12J C12HBA0206G16.1 AATTCGGGGACGAAACTAATG AGCATTGGACCCACAAGATAGT B12K C12HBA0206G16.1 ACCATGCAAATGAGTTCACAAG CAGTATTGGGTTATTGGTTTAGCG Table 3-4. Forward and reverse PCR primers for SSR markers designed from preliminary whole genome shotgun sequence for parental survey. Marker Forward Primer (5' 3') Reverse Primer (5' 3') SSRW1 GAACGATAAGCTAACAAGGCCA TCAAAAGTCAATCCAAACAGGC SSRW2 AGGCGGAGTCAAGATTAGGAGT GGCAAAGCTAAGTGGGAGTTC SSRW3 TCGAGAGCGTATTCACCTAACC CCAAGAGGAATGTGCCTTTATC SSRW4 GCTCTATCTGTTCTCTGCGGTT CTTGCTTGTAAATGTTGCCTTG

125 110 SSRW5 TTTGAGGAAACAATGAACCTCC GCTAATCCAACTAAACATGGGG SSRW6 TATCAATACGGAAGTTTGGGC AGGTGTTCCTTTGCTGTACCAT SSRW7 ATAGGTTGAGGGGTAGTTGTGC GTGATTCGGCTGGTTGAAATA SSRW8 ACGGAGTTCTGGAAAGTGCTTA TTGTGCATCCCATTAGAAAGTG SSRW9 CATTAGTCCCATCACCACACAT TGTCCCCAAAGTTGTTCCTTAT SSRW10 AGCCTCGTTTATGTCCTTGATG GAGTACAACACTTACCGTCCCC SSRW11 CTTACTCTTCTCCGTCGCAAAT AATGAGGTTGAGCTTTCTGCTT SSRW12 AGGGGAAAGTTGAAGGACAAGT TTAGGTAGGCAGGGTCATTAGG SSRW13 CAACTGATAGCTGGTGGTTTCA CTCTCCTCTTCTCCATTTCATCA SSRW14 TAGAAAACCCTCATGGCTCATT TACTCAACATTCGACCAAGTGC SSRW15 GCCAGTAAAAGCGTCTATCACA GAGAGAGGGAGGAGAAAGGC SSRW16 CTATAACACCCCTGGTACTTCAAA GGAAACATGAAAAGACACATGG SSRW17 GTTAGGCATTTGCGAACAAC AAAGATTTGGCCGGTTTG SSRW18 TGGTCACACTTGTTTGGTCTTT CTGAGAGAATAGAAATCCGCGT SSRW19 AGCCAAAGAGGAAATTGTGTGT TCATTACAGCACCTATCATCGC SSRW20 GAGGATAGCTGCACCAGAAGAT CAATATAGAAGCAACGCCAAGA SSRW21 ACGGATTTAGGAGAGGAAGACC TCTAATGGATTGCTCATGGTTG SSRW22 TTTTCTACAACAACAGCCCCTT CCAACTTCTAAGCCATCCAAAC SSRW23 CTTGTAGGGGAATGAAGTTTGG GATCCGGTTAGAAGAGACTTGC SSRW24 TCGGCTCAAATAGATAAGGGAA GTTTTGCGATTTAGGGACAAAC SSRW25 GAAAATTATGGGGCAAACTCAC GTTGTCAGATCCAAATCCTAACTTC SSRW26 TCCCTCTCTCAATCTCGCTTAC CTTCGCATATAGTCGCTCAAAA SSRW27 ACCTCAACCTCTTGTTGTCGTC TCTTTCCTTTCTTTTCCTTCCC SSRW28 GATCCATAAGTAACCCGATCCA TTTCTCCGTCTCCTCAACATTT SSRW29 CCCTCACGAATTTTATTAGCCA GACGTGCCATATTGTTTTGAAG SSRW30 TCAGGGCAACTTTCACACATAG GCCCAAGTCTCTTTTGTCTTTC SSRW31 GTTGGCTTGGCTCTACTGAAAT AGTCTTGGCTAATCACAGGGAA SSRW32 GTTTGCTCCCCTGTATGTGAAT ACAGAGACGCTTTACTCAACTGG SSRW33 CACACTCAACCTTTACGAACGA TCAACTCTGTCAAGCATAGGGA SSRW34 TTGGTGGCTTCAATACCTAACA TCAAGACAAAACACACGGAAAC SSRW35 GCGCCATGTAGAAGGGTCTAA ACGTTTATGGAAGAGAAAGGGG SSRW36 TCATAAAAGACGGAGCTTGTTG GCCACTTGATGTATTGGTCTCA SSRW37 GGATGGAATACCGGATGAATAG GTATATGAATGTGTGATGGACCG SSRW38 TTGATCCAACTCCCAAACAC TTGCTCATCGAACATTCTTG SSRW39 CATTACCTGCCATTAAACCACA TCGAACAATTCTCCATCGAA SSRW40 GGGGAGACTTTGCTATCTCGTA ATGCCTCTCTTACACCCAGAAG SSRW41 CATCAGCCCATTGAACTACTCA GCAAATATCATCTGACGTGGAA SSRW42 TGTTAGAAACCTGTGAAGCCCT TCAAATCCACAAGAAGCCAA SSRW43 ACTTTGAGGGGCAGATAGAGTG AATGAAGACCTTTGGAGGTGTC SSRW44 AGCTCCATCAGAAAGTTGCATT TTGATTGGTTCAGGTGTTCCTA

126 111 Forward and reverse primers for all SSR markers were synthesized by Integrated DNA Technologies (IDT) (Coralville, IA). The primers were re-suspended to 100 µm in 1X TE and diluted to 10 µm in nuclease free water. Genomic DNA of the parental lines were each amplified in a 25 µl reaction volume that included: 12.5 µl of 2X GoTaq Master Mix, 1 µl of forward primer, 1 µl of reverse primer, 5 µl of 10 ng/µl template DNA, and 5.5 µl of nuclease free water. The PCR reactions were carried out using Bio-Rad PTC100 thermocyclers (formerly MJ Research, Hercules, CA) and Bio-Rad C1000 thermocyclers (Hercules, CA) programmed as follows: 1 cycle at 94 C for 3 minutes, 35 cycles of 94 C for 30 s, 50 C for 45 s, and 72 C for 45 s, 72 C for 5 minutes, followed by storage at 4 C. The SSR markers surveyed by Hamid Ashrafi and Matthew Kinkade were separated using denaturing polyacrylamide gel electrophoresis (PAGE) as described by Creste et al. (2001). All other SSR markers were separated using non-denaturing PAGE on a Mega-Gel apparatus (CBS Scientific, Delmar, CA). The protocol was developed by Matthew Kinkade and based on Wang et al. (2003) and the Mega-Gel instruction manual. Briefly, 10 µl of each sample was separated on a 6% non-denaturing polyacrylamide gel run at 200 V between four and five hours. To stain the gel, 50 µl of 10 mg/ml ethidium bromide was added to the bottom reservoir of the Mega-Gel apparatus. Restriction Fragment Length Polymorphism Markers Three hundred and seven standard RFLP markers and EST clones used as RFLP markers were surveyed for polymorphism between NCEBR-2 and PSLP153. The standard RFLP markers included 180 random tomato genomic (TG) or cdna clones (CD or CT) previously selected from the high-density tomato genetic map (ASHRAFI et al. 2009; SHARMA et al. 2008). The 127 EST

127 112 clones were selected by Hamid Ashrafi based on their putative roles in the hypersensitive response or systemic acquired resistance (ASHRAFI et al. 2009). To conduct the parental survey with the RFLP-based markers, the Southern blotting procedure was employed (SOUTHERN 1975). To prepare the membranes for Southern blotting, 15 µg of genomic DNA from NCEBR-2 and PSLP153 was digested overnight at 37 C with seven restriction enzymes, DraI, EcoRI, EcoRV, HaeIII, HindIII, ScaI and XbaI, according to the manufacturer s guidelines (Promega, Madison, WI). An aliquot of 8.3 µl of 6X loading dye with Xylene Cyanol and Bromphenol Blue was added to each 50 µl digested mixture. The mixture was stored at 4 C until electrophoresis on a 0.8% agarose gel. The gel was electrophoresed for approximately 16 h at 35V to separate the DNA digestion products. Alkaline transfer was used to transfer the digestion products to XL nylon membranes (GE Healthcare Bio-Sciences, NJ and formerly Amersham Biosciences) overnight. The membranes were baked at 80 C for two hours, then washed with 2X SSC, semi-dried with blotting paper, and stored at 4 C in clear, plastic protective sheets. Radioactive probe labeling, hybridization, and autoradiography were carried out as previously described (BERNATZKY and TANKSLEY 1986b). A second set of Southern blots was constructed using seven additional enzymes: AluI, BstUI, CfoI, Hsp92II, MspI, RsaI, and TaqI (New England Biolabs, Ipswich, MA and Promega, Madison, WI). If an RFLP marker was not polymorphic with any of the initial seven restriction enzymes they were surveyed with, the marker probe was surveyed for hybridization with the second set of restriction enzymes. Cleaved Amplified Polymorphic Sequences The 241 CAPS markers surveyed for polymorphism between NCEBR-2 and PSLP153 included 124 EST clones, 49 CAPS markers available on the Sol Genomics Network ( 42 COSII markers available on the Sol Genomics Network

128 113 ( and 26 CAPS markers available on tomatomap.net. Based on the concept of developing CAPS markers from RFLP clones (BAI et al. 2004; GANAL et al. 1998), I developed new CAPS markers from previously mapped EST clones (ASHRAFI et al. 2009; SHARMA et al. 2008). To survey the EST clones for polymorphism as CAPS markers, the clones were sequenced and the sequences were manually aligned to identify single nucleotide polymorphisms (SNPs). To sequence the clones in NCEBR-2 and PSLP153, each clone sequence was retrieved from the Sol Genomics Network ( Forward and reverse primers were designed using Primer3 (ROZEN and SKALETSKY 2000) and primers were synthesized by IDT (Coralville, IA) (Table 3-5). The primers were re-suspended to 100 µm in 1X TE, then diluted to 10 µm in nuclease free water. The genomic DNA of each of the parental lines was amplified in a 50 µl reaction volume that included: 25 µl of 2X GoTaq Master Mix, 2 µl of forward primer, 2µL of reverse primer, 10 µl of 10 ng/µl template DNA, and 11 µl of nuclease free water. The PCR reactions were carried out using Bio-Rad PTC100 thermocyclers (formerly MJ Research, Hercules, CA) and Bio-Rad C1000 thermocyclers (Hercules, CA) programmed as follows: 1 cycle at 94 C for 3 minutes, 40 cycles of 94 C for 30 s, 55 C for 45 s, and 72 C for 2 min, 72 C for 5 minutes, followed by storage at 4 C. Following PCR amplification, the PCR products were separated on a 2% agarose gel pre-stained with ethidium bromide (1 µl of 10 mg/ml ethidium bromide per 100 ml of agarose gel solution). PCR products less than 1000 base pairs (bp) were cut from the gel and purified using a Qiagen PCR purification kit according to the manufacturer s protocol (Qiagen, Valencia, CA). EST clones with PCR products greater than 1000 bp were not included in the count of the number of polymorphic markers surveyed. The purified gel fragments were sequenced at the Penn State Genomics Facility (University Park, PA). The two parental lines sequences were aligned using the basic local alignment search tool (BLAST) available on the Sol Genomics network and the CAPS designer on the same site was used to design CAPS markers, if polymorphism was

129 114 detected ( solgenomics.net). When polymorphism was detected, it was validated by reamplifying the parental lines, digesting the PCR products with the predicted restriction enzyme according to the manufacturers protocols (Promega, Madison, WI and New England Biolabs, Ipswich, MA) and separating the digestion products on a 2% agarose gel. Table 3-5. Forward and reverse primers designed to amplify ESTs for sequencing in the parental lines, NCEBR-2 and PSLP153. EST Chromosome Forward Primer (5' 3') Reverse Primer (5' 3') clec66g13 1 AGCCTCAGCCTTTTCATCAG TGTGAATCCCAATCTTGATGC clec9l9 1 ACCAGTTGTGGAGGGTGGT TTAGCCAAATTTGACCGAAG cled27e12 1 TGGAGAGAAGCATCAGTAGGC AAAGTGTTTTGGGAAAAATAGGC cleg9n2 1 TCCACTTCAGCTTTCTTCTCATC CAGCATGATACCCAAAACAA cles9n20 1 TTCGGTTGATTGGGAGAAAG TTAGGCCAAACCACATCTCC clet14e21 1 TGCAAAACACAACATTCCACA TGCCAATGAGCATATTTTGG clet2o9 1 GCAACCATTGCTGGTGTTAG GGAATAAAATAGAGCGGAGTGC cley14c14 1 GCTGCCAAAGTTGGAAATGT AAGCGATTGTTCGACAGGTT ctoe6f10 1 AAGTTTGCCACATCCAGACG ACCAAATTTCCAACCCATCA ctos16i16 1 TCCCATAATTGGATTTCTATCAAGA TTGATTATTCATATCCATACCATAAAA clec14n19 2 GAGCAACCATTTCATGTGGA CGGCTGAGATAAGGGATTCA clec27m9 2 TTTAAGTACCGACTGCCTTGC TAACCATTTCCATTGCCACA clec72p14 2 GACTTAGCTGGGCAAGCAAT TTCACTGGCTTTTGTGCAAC clec7l24 2 TCTTGAGTGCGTTTTCACAA TCAGACGAAAAGGTTTCCAGA clec7p21 2 TGGAGAAACTGAAGGTTGTGG GACAGTTCTTCGAAGCGTTTG cled19b18 2 GAATGAAGCCCGGACCACTC ATTATCCATCGACCTATCCAGTTG clef2a11 2 TGTTCCCAACAACAACCTCA GAATCTGACGTCCCCAAAGA cler14h18 2 TCGTGTGGAACAGAAGGGTA AATCCAGCACACGGTAGCTT clet10e15 2 TGTATCACCCGTTGCACTGT CCACATTCAAATTGACCGTTA clet5a5 2 GGAAGAGAGCAAAGATGAGAGG AGGTTTCTCCATGAAAGTTACAGT clpp13j1 2 CTTTGTGCTTCCCCATGC CACTTATGGTCCTGAAATTAGGC ctoa29p9 2 GTCATGCGGAGAAGCAGAG GGAAGAAGCGATGTTGTCGT ctoa9c11 2 CTCATTGGCAGAATCGGAGT GCCACCATTTCAATCTCCAT ctod16e7 2 TGTATCACCCGTTGCACTGT CAGTCCAAATTTTCACCAGTAGG ctof14b17 2 CCTTCGTCAAACCCGTTAAT AATCCAGCCACTGGCAATAG cleb7j7 3 CTTATCACCACCGCCCTCTA TGGACACCACAATAGGCAAA clec20f13 3 GGTGATGGCAGAGCAAAAAT GAAGAAGTGGGAATGCAAGC clec40m5 3 GGACATCCAATGGCCAAATA ATGCCTAAGGTGTGGCATGT clei4n5 3 CATTGAAGTTTGCCCTGTGA GCATATCTCCAGCCTCTGCT cler17h16 3 AATGTTGGTGCCACGTGAGT TTGATGAAAGCCTTGGCTGA

130 115 clex10f20 3 GCCGGAGTTCAAGTTTCAGT ACCGATGAACTAGCCGATTC clex12o16 3 TGGGTTCTCCACAAGAGACTT CCACAGAGTATCAAATGTTCC clec78c22 4 CAAGCTTATGGATTGCTGAGG CCAAAAAGTATCTGGCAACCA cleg50p8 4 GAGGAGGAGAAACACCACCA CGCAAATAAAACCATCCCTTC clen7n12 4 TCAAACAAATTCAATTCCATCTAGTAA TCAGCTTCTTTCACCACTGAAG clew22d11 4 TAGCGAGCCCAAAATTTCAA CTCATCGGCCTGAATCAACT clew24m21 4 AATGGGTTTCTGGTGCTGAG ACGGTTTGTTTGGATTTGGA clpt1k12 4 CACCATACACAATGGCCAAA TCACGAAACCCATTCCTCTC ctos21d12 4 TCAAACATAGCAACTTTTCAAGC GTCACTACATGCTAAAGACCATT clec76e11 5 AAGCAGAAATGGCTGTTCGT TAGCGCTTGGCTTTGTGTAA cled8g3 5 TCTTGGATAATGGCACTGACC AGTCTTCTCTTCTTCTCTGGCTGA cler5e19 5 CGCGCAGGTATACGGATATAG TTTTCAACAATAAAAACATACTTGGTG clet8b23 5 TTGATTATTGCTTTAACAATCTGGA AAGCAAGCAACCAGAAATGG ctoc20d5 5 CCTCCAAATCTCCATTGCTC TCACGATGCATAACTCCGTTAG ctoe7j7 5 CTGCCATCTCCTTTCATTCC CGCAATAATACACCCCACAG ctof26e9 5 GCCCATCTCGCTCTAATGTC TCCCTGAAAATATGCAACTCAA ctof29b13 5 TTGCTGTGGAGGAAGTTGTG TTCAGAAACAACTACAAATTTAAACAA ctof33c3 5 CGGCTACATTGACCCTGAAT AGCAGCAAACTCCCTTTTTG clec76a13 6 TGTTTTTGTTTTACTGAACTGGCTA CAAAGCTTTTTATTGCAAACCA cled11a2 6 CTGAGCTTCTTGGCACTCCT GGTCCAAGCAAGAAAATCCA cleg32e10 6 CATGTCAGCAAACACAAAAGC ACTTTTGATTGCTGCCCAAA clen10h12 6 TTGAAAAATCCAGTGACCAAAA CTCCTGGTGCAAGGTCTGTT cles1k3 6 AATTCAGTTATGGCCGGAAG TGGTTCTCATCGTCAGCAAG clet19j2 6 CAAGAATGGCAGCAACAATG TCTTAGCCAGTCCCTCTGGA clet2h1 6 TCTTCACCCTAACACAGAGCAA ATCGTAAGTGCGGCATTCAT clet2l2 6 GTGGTTCTGTTTCCCAAGGA GCCGGTAATGCTTGAACAAT clet4g23 6 TTCCAAAATTGGCTTCTACACA CCGATAGTTGCGAATTCAGG clet5a4 6 CTGGCCAAGGAGTTGAAGTT TCAAGGTCGGTATGTGCTTG clet6i13 6 TGACACTAATTGGGAACCTCA CATCATCATCTTCGCCTTCC clet8i22 6 CGTTGACGCTTCATCACCTA CAGCTCATTCCCATCCATTT clew22n22 6 CTATGGCGCCTAAGGAAAAA AAATATTTAAGCCAACAATTGAAGC clex2f13 6 TAACCCTAGTTTCCCGCAGA GGTGGGGCTTTCTAACATGA clez16h16 6 TGCAGCAATTAGGATCAGGA TTTGGTGATCCTTTTCATTGG clpt5k21 6 GGGGAAAAAGTTGCAATCAA GGAGCCCTATACCACCTCGT cled22k8 7 CATGGTCCTAAGCCACCAAT GTGGAGTAACAACCGGAGGA cleg57m16 7 CATCCAAAAACGACCACACA CGGCGATCTAGGATGTTTTC clen14f9 7 TTTCAGAGGGCATGAGTCCT ATGACAGCCTTGCGTAGACC clet5m3 7 GTTCGTCGTGAGAATGATGC CCTTTTACCAAGGGCAAGC clex13i5 7 AAAAATTCTGGCAGGGGAAA CCCTTCTTGGCCTCAACTTT cley22l20 7 CTGCAGCAGCCATACTCAGA TCGAAAAATTCGTTGAGTGG

131 116 clpt1i9 7 TCTCTCCCCAAATTCAATGG CAAATAGGCGAGCACACTGA clpt4h11 7 GAAGCGTAATCCACGAGAGC TTTGCCAATTGTTGCAGAAC ctob9o3 7 GGATTCAATTAAGCCATCCTCA GCACTGCGAAAATGAAACCT ctoe15m9 7 ATGCTGGCTTAGCAAGGTGT CCACTTCAAATGGTTGTGTCC ctof34c13 7 CAGTTCCAACCTGAAAAGCA GGTCAAGCAAGGTATCCACAA ctos19o5 7 CCCACCCCCATTCCTCTT AAGGTTCAATCTTTAAACTCAAACAG clec73b1 8 GCACCAAAATGGCACGTATT AGAGATGGGCTCAACTCAAGA cled6m17 8 CGCGATGTAAAATCAAGCAA CAGTGTTCCCTTCTCCGTGT cleg61b21 8 TCTCTCATTACCAGGGAGCAA TCCTCAACAGCCACTCCTCT clei16e21 8 CAAGTCAAAGCTTTCTCTCACA GCACAGTTGCTGGTTGAATC clen10h3 8 AACGTGCTTATGCAAGAGCTG TTATGTTTGACAATTGATTGTTGATG clen14c8 8 AGACTGGTGATTGTGGTGGAG TCCGGTCTTTAAGTTTGTTACGA cler14j12 8 TTAGCTTTACAAGAAGCTGCTACA TCGACATAAACGACGACGAC clet8e2 8 TGCAATTCTCCGACATCAAA TACCCAAATGTGCCAGCTAC clet8f19 8 CCCCAGGTAAGTCATGAAGC TCATCGGTCACCTTCACAAA clpt2k10a 8 AAAAGCGGCAAGATTGAGGT ACCTGATCCAATTTGGCTTG clpt2k10b 8 AAAAGCGGCAAGATTGAGGT ACCTGATCCAATTTGGCTTG clpt2k10c 8 AAAAGCGGCAAGATTGAGGT ACCTGATCCAATTTGGCTTG ctod3n7 8 TGCTCATGCTATGCTTCACC TGGTTGGGGTCTCCTACTTG ctof28d12 8 CTTCCTTCACCACCACCAAC GGGTAAAGCAAAAGTTGGATCA ctof2l16 8 GGGTAATGGATAGTATGGGGAAA GCCTTGACATAAGAGCTTCCA ctof2n15 8 TTTTCTTCCTTCTTGCTTTTGTG CATCACTTGAGGGCATCTCC ctof9d16 8 TTTCACCTATGCCAATGCAG TTAGTACCAGCAGGGCAAGT clec6m14 9 AGGCTGAGGGAGATGGAAGT AACACACAACTCAACAAAAAGCA clec79a23 9 GGAGAGTCGTGTGGAGAAGC GTGCGTGTTGCATATGCTTT cled11l12 9 TGTCCACATCAGAAGTTAAAACAAA GAAAATGTGGGAACGGTGTC cled4n20 9 TGAAACTCTCATGGCACGAA AAGCCACGTTTTATTTATTCCA clet2d4 9 GAAGCCCTCCTCTATAGTTTCCA ATTGGACCGGTGAGATTACG clet7d17 9 TGGAGTGTGTGTTCGGAATG TCCATCATGGCAAGAGAGAA ctob9b13a 9 AAAGTGTATTTGCGGGTTCG CTGGACATTCTGCATCAAGC ctob9b13b 9 AAAGTGTATTTGCGGGTTCG CTGGACATTCTGCATCAAGC clec18o1 10 TGCTTTTGCTGTCTGCCTCT ATTTCCTTCCAGGAGCACAA cled11f6 10 TTAAAGCAGGCGACGAGAAT GGAGGGAGTTTCAAGTAATTAGCA cled16n20 10 GGGCAGAAACTGAACAAGGA TTTGGAGCCTTCTTTGCATT cled18g6 10 CGGTCACCTGAAGGACAAAT CAGACATGAGAGCACCAGGA clen9p2 10 TGAATTTCCACCCACCGATA TGTGAGCTATCGTGATGACTGTT cler4f5 10 CCAAGAAAGCCAGCTGTGA TGTAAGGAGATAAAAGGGTTGTCA clet3f16 10 CCAAGAAAGCCAGCTGTGAC TGCTCATGAAACAAAATGAAGTG clet3k21 10 GAAGATCAACGCTGAATCCAA CTGCTGCAAACTAACATCTGACT clex10n16 10 CAAAGCAAAAATGGGGTTGT CTAGCAAACATCAAAGGGAAA

132 117 clez6e21 10 GTCTACGTGGTGGGATGCAA TGTAGTCAGCCAGGGTCCTT ctof30k21 10 CTTGCCAAGAAGAAGTGTTGT CTAGTTAGCCAACAAGGTCCTC clec14i18 11 TAGTGTCAATTATTGTAATCACCCACT AACCACCGCGACCACCTA cled13i7a 11 GCTCCCCAACTGATGTAAGC GGACGACATAATAGCTTTAGTGGAA cled13i7b 11 GCTCCCCAACTGATGTAAGC GGACGACATAATAGCTTTAGTGGAA cled23k21 11 GAGGACTGTTTTGATTAGCTGAAA AGATTTTGATGCTGGCCTTC clem22k17 11 AAACAACAACTCCTCTTCTTCTTCA CCGGTGGGTGTTACCTTTAC clet5e4 11 TGCAGCCAACTCACAACTTC AGAATTGGCTGACCGAAGAG clex4g10 11 TGCAATTGGATAATGCGAAG CGCTGAAGCTGATTGAATGT clec80g6 12 TGTTTGTCGAAAGCAAAGGA CTTCAAGTTTTTCAACTTCTGTATGG clez15e8 12 CTTCTCCACCACCTCCCTACT AAGGTGTTACGAGAACAACATTCA clpt1g11 12 TTCAGCAAAACATGCACAAA GACCTTCCCTGGTGTGAAGA clpt6e9 12 TGATTTTTGGATGCCCATT TTGCATTCACCAAAGCAGAG ctos21d14 12 GTTTTCATGGAGGAAATACGG TTCAACCCCTAAAATCTTTCCA Forty-nine CAPS markers listed on the Sol Genomics Network ( were surveyed for polymorphism between the NCEBR-2 and PSLP153 parental lines. Forward and reverse primers were synthesized by IDT (Coralville, IA). The primers were re-suspended to 100 µm in 1X TE, then diluted to 10 µm in nuclease free water. The genomic DNA of each of the parental lines were each amplified in a 50 µl reaction volume that included: 25 µl of 2X GoTaq Master Mix, 2 µl of forward primer, 2µL of reverse primer, 10 µl of 10 ng/µl template DNA, and 11 µl of nuclease free water. The PCR reactions were carried out using Bio-Rad PTC100 thermocyclers (formerly MJ Research, Hercules, CA) programmed as follows: 1 cycle at 94 C for 3 minutes, 40 cycles of 94 C for 30 s, 55 C for 45 s, and 72 C for 2 min, 72 C for 5 minutes, followed by storage at 4 C. Following amplification, the PCR products were digested with the restriction enzyme recommended on the Sol Genomics Network ( according to the manufacturers instructions (Promega, Madison, WI and New England Biolabs, Ipswich, MA). The digestion products were separated on a 2% agarose gel to check for polymorphism. If the CAPS marker was not polymorphic using the recommended restriction

133 118 enzyme, the PCR products of the parental lines were sequenced, analyzed for SNPs, and the SNPs were verified as described for the EST clones. The same procedures were followed to survey the parental lines for polymorphism with the CAPS markers listed on tomatomap.net. The availability of more than 500 COSII PCR-based markers that have been mapped to the high-density tomato map made these markers attractive ( et al. 2006). Primers for a subset of 42 COSII markers on chromosomes 1 and 10 were synthesized by IDT (Coralville, IA). The primers were re-suspended to 100 µm in 1X TE, then diluted to 10 µm in nuclease free water. The genomic DNA of each of the parental lines were each amplified in a 50 µl reaction volume that included: 25 µl of 2X GoTaq Master Mix, 2 µl of forward primer, 2µL of reverse primer, 10 µl of 10 ng/µl template DNA, and 11 µl of nuclease free water. The PCR reactions were carried out using Bio-Rad PTC100 thermocyclers (formerly MJ Research, Hercules, CA) programmed as follows: 1 cycle at 94 C for 3 minutes, 35 cycles of 94 C for 60 s, 55 C for 60 s, and 72 C for 2 min, 72 C for 5 minutes, followed by storage at 4 C. Following PCR amplification, the PCR products were separated on a 2% agarose gel pre-stained with ethidium bromide (1 µl of 10 mg/ml ethidium bromide per 100 ml of agarose gel solution). The PCR products were purified, sequenced, and aligned using the same procedures outlined for the ESTs used as CAPS. Selection of F 2 individuals and Genotyping Following disease screening of the F 2 population, 25 of the most resistant individuals and 31 of the most susceptible, but surviving, individuals were selected for marker genotyping. Genomic DNA was extracted from the selected individuals in the same manner as described for the parental lines. The 56 selected F 2 individuals were genotyped with the polymorphic markers identified in the parental survey. Marker genotyping was conducted in the same fashion described

134 119 for the parental survey. The genotypic data of the 56 F 2 individuals was used to construct a genetic linkage map and to conduct trait-based analysis. Genetic Map Construction A genetic linkage map was constructed to determine the relative positions of the DNA markers genotyped in the 56 selected resistant and susceptible F 2 individuals. The map was constructed using MapMaker 3.0 (LANDER et al. 1987). Initially, the GROUP command was used to assign DNA markers to linkage groups using a minimum LOD score of 3.0 and a maximum recombination fraction of To find the best locus order within each group, the ORDER and COMPARE commands were used. The marker order was verified using the RIPPLE command. The Kosambi mapping function was used to convert recombination fractions into centimorgan map units (KOSAMBI 1944). The genetic map was visualized with MapChart software (VOORRIPS 2002). Statistical Analysis Genotype frequencies of the DNA markers genotyped in the F 2 selected individuals were calculated and tested for significant deviation from the expected 1:2:1 Mendelian genotype segregation pattern using χ 2 goodness-of-fit analysis. The Ryan-Joiner test was performed using Minitab 15 statistical software (Minitab, State College, PA) to assess whether or not disease severity was normally distributed in the F 2 population.

135 120 Trait-Based Analysis To identify and map regions of the tomato genome associated with the LB resistance conferred by PSLP153, different mapping approaches including marker based analysis (MBA) or trait-based analysis (TBA; a.k.a. selective genotyping) can be conducted. Using a MBA approach, all individuals in a mapping population are genotyped and phenotyped to identified marker genotypes associated with phenotypes. This approach is highly useful when analysis of multiple traits is desired and when the cost of genotyping is low, as large populations are required to accurately study quantitative traits. In theory, individuals can be phenotyped for all segregating traits in a population. In the current research, however, response to LB was the only segregating trait of interest. In addition, RFLP markers were initially used to identify segments of the genome associated with LB resistance. The high cost, high labor intensity, slow speed of genotyping, and high demand for plant tissue and high quality DNA made the MBA approach undesirable. Therefore, trait-based analysis (TBA) was used to identify segments of the tomato genome associated with LB resistance. In the TBA approach, only select progeny with extreme phenotypes that are derived from hybridizations between inbred lines are genotyped. The genotypes of the extreme phenotypic classes are determined to calculate allele frequency differences between extreme phenotypes. The allele frequency of each DNA marker was calculated for the selected F 2 resistant (n = 25) and susceptible (n = 31) phenotypic classes. An allele frequency difference greater than three standard errors (SE) of the allele frequency difference was considered significant. The standard error of the allele frequency difference was calculated as follows: SE = (p 1 q 1 /2N 1 + p 2 q 2 /2N 2 ) ½ where p 1 is the NCEBR-2 allele frequency in the resistant class, q 1 is the PSLP153 allele frequency in the resistant class, N 1 is the number of individuals in the resistant class, p 2 is the

136 121 NCEBR-2 allele frequency in the susceptible class, q 2 is the PSLP153 allele frequency in the susceptible class, and N 2 is the number of individuals in the susceptible class (DARVASI and SOLLER 1992; FOOLAD and JONES 1993; FOOLAD et al. 1997; LEBOWITZ et al. 1987; ZHANG et al. 2003). This test provides greater than 99% confidence for the identified regions (LEBOWITZ et al. 1987; ZHANG et al. 2003). A significant allele frequency difference was inferred to indicate an association between the DNA marker and LB resistance (FOOLAD and JONES 1993; FOOLAD et al. 1997; LEBOWITZ et al. 1987; STUBER et al. 1980; ZHANG et al. 2003). Although TBA could be conducted using both extreme phenotypic classes (bidirectional) or only one extreme phenotypic class (unidirectional), bidirectional TBA has equal, or greater power than unidirectional TBA (FOOLAD and JONES 1993; GALLAIS et al. 2007; NAVABI et al. 2009). Thus, bidirectional TBA was conducted in an F 2 population to identify regions of the tomato genome associated with LB resistance conferred by S. pimpinellifolium accession PSLP153. For DNA markers associated with LB resistance, the recombination fraction between marker locus and LB resistance gene was estimated by calculating the z score (FISHER and BALMUKAND 1928). When an LB resistant individual had at least one PSLP153 allele at a marker locus or when an LB susceptible individual was homozygous for the NCEBR-2 allele at a marker locus, the individual was considered to be of the parental type. Conversely, when an LB resistant individual was homozygous for the NCEBR-2 allele at a marker locus or an LB susceptible individual had a PSLP153 allele at a marker locus, the individuals was considered to be of recombinant type. Therefore, z was calculated as the product of the numbers of resistant and susceptible individuals of the recombinant types divided by the product of the numbers of resistant and susceptible individuals of the parental types. Graphical genotypes for the resistant and susceptible individuals were constructed using GGT2 Graphical Genotypes software (VAN BERLOO 2008).

137 122 Results Screening of the F 2 Population The reactions of the parental lines to LB were opposite to each other and extreme (Table 3-6). While NCEBR-2 was highly susceptible to LB; PSLP153 was highly resistant. NC84173 was also highly susceptible to LB (disease severity 97%). PSLP153, the F 1, NC870 and NC3220 were all resistant to LB, with disease severities between 15 and 20%. A large F 2 population (n=986) was evaluated for LB resistance under controlled greenhouse conditions. Disease severity was measured as percent defoliation of whole plants due to LB infection. The mean F 2 disease severity was 46.8 ± 27.85%. Twenty-six percent of the F 2 individuals had disease severity of 25% or less, 58% had disease severity of 50% or less, 18% had disease severity between 50 and 75%, and 28% had disease severity 75% or greater (Figure 3-1). The results of the Ryan- Joiner test for normality indicated that the LB disease severity of the F 2 population was not normally distributed (p<0.01). Table 3-6. Disease severity of the parental lines and resistant and susceptible controls. Ph-1 indicates that the line has late blight (LB) resistance conferred by Ph-1, Ph-2 indicates that the line has LB resistance conferred by Ph-2, and Ph-3 indicates that the line has LB resistance conferred by Ph-3. Control Disease Severity (%) NCEBR-2 95 PSLP F 1 20 UCT5 75 New Yorker (Ph-1) 80 NC NC63EB (Ph-2) 45 NC870 (Ph-3) 18 NC3220 (Ph-2, Ph-3) 15

138 Frequency Disease Severity (%) Figure 3-1. Frequency distribution of the F 2 population disease severity (n=986). Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions. Selection of F 2 Individuals for Genetic Mapping and Trait-Based Analysis Twenty-five of the most LB resistant individuals and 31 of the most LB susceptible, but surviving individuals were selected for genetic mapping and trait-based analysis. The selected resistant individuals had a mean disease severity of 8.3 ± 4.2% and disease severity ranged between 0 and 15%. Conversely, the selected susceptible individuals had a mean disease severity of 74.9 ± 15.9% and disease severity ranged between 30 and 95%. There was no overlap in disease severity between the selected resistant and susceptible individuals (Figure 3-2).

139 Frequency Selected Resistant Selected Susceptible Disease Severity (%) Figure 3-2. Frequency distribution of disease severity for the F 2 selected late blight resistant and susceptible individuals to be used for marker genotyping and trait-based analysis. The late blight disease screening was conducted using whole plants in a controlled greenhouse. Parental Survey Of the 1309 molecular markers surveyed for polymorphism between the S. lycopersicum inbred breeding line NCEBR-2 and the S. pimpinellifolium accession PSLP153, 153 (11.7%) were polymorphic (Tables 3-7, 3-8, 3-9). SSRs had the highest level of polymorphism, followed by RFLPs and CAPS. Of the 153 molecular markers that were polymorphic between NCEBR-2 and PSLP153, 117 (76%), were PCR-based. Twelve of these 117 markers were CAPS. The restriction enzymes used for these CAPS markers are listed in Table None of the COSII markers were polymorphic. The polymorphism level for ESTs surveyed as CAPS markers had the next lowest polymorphism level (4%). The CAPS markers posted on the Sol Genomics Network ( had an intermediate level of polymorphism (6.1%) while the CAPS

140 125 markers surveyed from tomatomap.net had the highest level of polymorphism (15.4%) (Table 3-8). With respect to the SSRs surveyed for polymorphism, the markers developed by Ohyama et al. (2009), which were identified in publicly available cdna and BAC-end sequences, had the highest level of polymorphism (43.8%) and the markers developed by Tang et al. (2008), which were based on analysis of publicly available and redundant EST sequences, had the lowest level of polymorphism (6.8%). The SSRs found on the Sol Genomics Network ( tomatomap.net, the Solanaceae Genomic Resources website ( ), the SSRs mined from tomato BAC sequence and the SSRs mined from tomato whole genome shotgun sequence had polymorphism levels between 10 and 22%. Table 3-7. Number and percentage of markers that were polymorphic between NCEBR-2 and PSLP153. Marker Type Number of Markers Surveyed Number of Polymorphic Markers SSRs % RFLP % CAPS % Total % Polymorphism Rate Table 3-8. CAPS markers polymorphic between NCEBR-2 and PSLP153 by marker source. SGN indicates that the markers were found on the Sol Genomics Network ( Marker Source Number of Markers Surveyed Number of Polymorphic Markers ESTs % SGN % COSII % Tomatomap.net % Total % Polymorphism Rate Table 3-9. SSR markers polymorphic between NCEBR-2 and PSLP153 by marker source. SGN indicates that the markers were found on the Sol Genomics Network ( Tomatomap.net indicates that the markers were found on the tomatomap.net website, Solanaceae Genomic indicates that the markers were found on the Solanaceae Genomic Resources website

141 ( ), BMC bioinformatics indicates that the markers were identified by Tang et al. (2008), Molecular Breeding indicates that the markers were mapped by Ohyama et al. (2009), Tomato BACs indicates that the markers were designed based on tomato BAC sequence ( and Whole Genome indicates that the markers were designed based on tomato whole genome shotgun sequence ( Number of Markers Surveyed Number of Polymorphic Markers Marker Source SGN % Tomatomap.net % Solanaceae Genomic % BMC Bioinformatics % Molecular Breeding % Tomato BACs % Whole Genome % Total % Polymorphism Rate 126 Table Restriction enzymes used for the polymorphic CAPS markers organized by chromosome. Marker Name Chromosome Restriction Enzyme COSOH47 1 BstUI U MseI cled27e12ca 1 HinFI LEOH10 4 BsaJI COSOH73 5 AluI SP 6 BstNI LEOH1.1 7 Tsp45I ctob9o3 7 HincII clen14f9ca 7 MseI clex10n16ca 9 TaqI clpt4c24ca 9 Hpych4V CT100CA 12 AflIII

142 127 Genotyping of Selected F 2 individuals and Genetic Map Construction The 153 polymorphic markers identified in the parental survey (NCEBR-2 and PSLP153) were genotyped in the 25 selected resistant and 31 selected susceptible F 2 individuals. The genetic map, including 153 DNA markers, spanned 1101 cm of the tomato genome with an average marker density of one DNA marker every 7.2 cm. The chromosomes ranged in length from 39.2 cm (chromosome 7) to cm (chromosome 1), with an average length of 92 cm (Figure 3-3).

143 128 Figure 3-3. F 2 genetic linkage map based on 153 DNA markers genotyped in 25 selected late blight resistant individuals and 31 selected late blight susceptible individuals. The individuals were selected from a large F 2 population (n=986) developed from hybridizations between S. lycopersicum inbred breeding line NCEBR-2 and S. pimpinellifolium accession PSLP153. Marker Segregation Chi-square goodness-of-fit analyses were performed to assess whether markers mapped in the F 2 population fit a 1:2:1 Mendelian segregation ratio. Ten markers on five chromosomes did not meet the expected segregation pattern (Table 3-11). All skewed markers were located at

144 129 chromosome ends. At the top of chromosome 3, the RFLP marker TG132 was skewed toward S. lycopersicum. At the bottom of chromosome 8, there was an excess of heterozygotes at the RFLP marker loci CD40 and CD111. At the top of chromosome 9, the RFLP marker ctof28p11, the previously unmapped SSR marker SSRB9C, and the RFLP marker clec13e21 were skewed toward S. lycopersicum. At the distal end of chromosome 10, there was a dearth of heterozygotes and an excess of homozygous individuals at the SSR74 and SSR223 marker loci. These two marker loci were also associated with LB resistance. At the top of chromosome 11, there was an excess of heterozygotes at the RFLP markers ctof29f6 and CT182. Table Monogenic segregation of DNA markers genotyped in the F 2 population (combined LB resistant and susceptible individuals) derived from a cross between S. lycopersicum and S. pimpinellifolium. Marker loci which exhibited significant deviation from the expected 1:2:1 Mendelian segregation ratio are shown in bold. Genotype a Locus Chromosome l/l l/p p/p χ 2 COSOH SSRM SSR SSRB1BD TMA SSRB1BP SSR TOM SSRB1BL TMA TMA SSRB1AM ctof20p SSR SSRB1AY SSR TG SSRW SSRW SSRW TG

145 SSRW SSRW SSR U217757CA ctoe7j7a SSRW SSRW SSRB1CM cled27e12ca SSRB1CB SSRP SSRB2C SSRB2BC CD3PSU SSR SSRB2BV SSRB2CM SSRB2BH SSRB2CE SSRB2CQ SSRB2S cley1k SSRB2BX SSRB2BW SSRB2AV TG ** SSR SSRB SSR SSR SSRP CT SSRB3Z SSRB3O ctof29j SSRB3G SSR SSR SSR SSRP

146 SSRB4AO SSR SSRB4W TG SSRB4AC SSRB4K LEOH SSRB4R CT SSR SSRB5E TG ctoc2j COSOH SSRB5M cleg49o SSR SSR SSRB6S CT SSRB6A SSRB6M SP SSR SSRB6G LEOH ctob9o3ca TG clen13g SSR SSRM clen14f9ca clec35f clec71i cles6h ctof2l SSR SSRB8B SSRB8D SSR

147 SSR SSR SSR CD ** CT * ctof28p *** SSRB9C *** clec13e ** clex10n clex10n16ca SSRP clpt4c24ca SSRM SSRP SSR SSR SSRM SSRM SSRM SSRB10M ctod4i SSR SSRB10A SSRB10D TMA SSRB10J TMB SSR SSR clen14k TMA LECOV SSRB10AQ TMA SSR *** SSR *** ctof29f ** CT * SSR SSRB11F

148 133 SSRB11G SSRM ctof28i23a cled23k ctof28i23b cled13i SSR CT100CA CT SSRB12H SSRB12G CD *, **, *** significant at the 5%, 1% and 0.1% probability levels, respectively. a l/l Homozygous for S. lycopersicum alleles; l/p Heterozygous, p/p Homozygous for S. pimpinellifolium alleles. Trait-Based Analysis to Identify Genomic Regions Associated with Late Blight Resistance To identify regions of the tomato genome associated with LB resistance, 153 polymorphic DNA markers identified in the parental survey were genotyped in 25 selected resistant and 31 selected susceptible F 2 individuals. The marker allele frequency was calculated for the selected resistant and susceptible classes. The allele frequency difference between classes was calculated and differences greater than three standard errors of the allele frequency difference were indicative of a significant association between a marker locus and LB resistance. Of the 153 DNA markers genotyped in the selected F 2 resistant and susceptible individuals, 11 markers were associated with LB resistance (Table 3-12). Eight of the markers were located on chromosome 1 and the remaining three markers were located at the distal end of chromosome 10 of the F 2 linkage map (Figure 3-3). For the markers associated with LB resistance, chi-square goodness-offit analyses were performed for the LB resistant and susceptible groups separately to assess whether the markers fit a 1:2:1 Mendelian segregation ratio in these groups (Table 3-13). The resistant and susceptible groups did not meet the expected Mendelian segregation ratio for any of

149 134 the marker loci. The recombination fraction between the LB resistance gene and marker locus was also calculated for the 11 markers associated with LB resistance (Table 3-14). The patterns in allele frequency differences on chromosomes 1 and 10 are reported in the two following sections. Table S. pimpinellifolium allele frequency difference between the 25 selected F 2 resistant individuals (q 1 ) and the 31 selected F 2 susceptible individuals (q 2 ) for 153 DNA markers. Markers are listed in order by chromosome. Allele frequency differences greater than three standard errors of the allele frequency difference were considered significant. Significant differences are bolded and italicized. The standard error was calculated using the formula SE = (p 1 q 1 /2N 1 + p 2 q 2 /2N 2 ) ½, where p 1 is the NCEBR-2 allele frequency in the resistant class, q 1 is the PSLP153 allele frequency in the resistant class, p 2 is the NCEBR-2 allele frequency in the susceptible class and q 2 is the PSLP153 allele frequency in the susceptible class. Marker Chromosome q1 q2 q1-q2 3 Standard Errors COSOH SSRM SSR SSRB1BD TMA SSRB1BP SSR TOM SSRB1BL TMA TMA SSRB1AM ctof20p SSR SSRB1AY SSR TG SSRW SSRW SSRW TG SSRW SSRW SSR U217757CA ctoe7j7a SSRW

150 SSRW SSRB1CM cled27e12ca SSRB1CB SSRP SSRB2C SSRB2BC CD3PSU SSR SSRB2BV SSRB2CM SSRB2BH SSRB2CE SSRB2CQ SSRB2S cley1k SSRB2BX SSRB2BW SSRB2AV TG SSR SSRB SSR SSR SSRP CT SSRB3Z SSRB3O ctof29j SSRB3G SSR SSR SSR SSRP SSRB4AO SSR SSRB4W TG SSRB4AC SSRB4K

151 LEOH SSRB4R CT SSR SSRB5E TG ctoc2j COSOH SSRB5M cleg49o SSR SSR SSRB6S CT SSRB6A SSRB6M SP SSR SSRB6G LEOH ctob9o3ca TG clen13g SSR SSRM clen14f9ca clec35f clec71i cles6h ctof2l SSR SSRB8B SSRB8D SSR SSR SSR SSR CD CT ctof28p

152 SSRB9C clec13e clex10n clex10n16ca SSRP clpt4c24ca SSRM SSRP SSR SSR SSRM SSRM SSRM SSRB10M ctod4i SSR SSRB10A SSRB10D TMA SSRB10J TMB SSR SSR clen14k TMA LECOV SSRB10AQ TMA SSR SSR ctof29f CT SSR SSRB11F SSRB11G SSRM ctof28i23a cled23k ctof28i23b cled13i

153 SSR CT100CA CT SSRB12H SSRB12G CD

154 Table Monogenic segregation of DNA markers in selected LB resistant and susceptible F 2 individuals derived from a cross between S. lycopersicum and S. pimpinellifolium. Allele freq. diff. is the difference in allele frequency calculated between resistant and susceptible groups (table 3-12). Marker Chr. Position Resistant Individuals Susceptible Individuals Allele Freq. Diff. l/l l/p p/p Total χ2 l/l l/p p/p Total χ2 SSRW ** * SSRW ** * TG ** * SSRW ** * SSRW * ** SSR ** * U *** ** ctoe7j *** * TMA * ** SSR *** *** SSR *** *** l/l Homozygous for S. lycopsericum allele; l/p Heterozygous; p/p Homozygous for S. pimpinellifolium allele. *, **, *** significant at the 5%, 1% and 0.1% probability levels, respectively. 139 Table Z calculation of the distance from each marker associated with late blight (LB) resistance to a resistance gene. Parental Resis is the number of LB resistant individuals with the parental genotype and phenotype. Parent Sus is the number of LB susceptible individuals with a recombination event between the genotype and phenotype. Recomb Resis is the number of LB resistant individuals with a recombination event between the genotype and phenotype. Recomb Sus is the number of LB susceptible individuals with a recombination event between the genotype and phenotype. Total is the total number of individuals. Z was calculated as the product of the numbers of recombinant individuals divided by the product of the numbers of parental individuals. RF is the recombination fraction. Marker Chr Parental - Resis Parental - Sus Recomb - Resis Recomb - Sus Total Z RF SSRW SSRW TG SSRW SSRW SSR U217757CA ctoe7j

155 140 TMA SSR SSR Chromosome 1 Of the 32 molecular markers mapped to chromosome 1, only eight markers in a 23 cm interval were associated with LB resistance. COSOH47, SSRM10 and SSR92, which were the uppermost markers on chromosome 1, had allele frequency differences skewed toward NCEBR- 2, though the differences were not significant. Moving down chromosome 1 from SSR92 to SSRW8, the allele frequency differences were skewed toward PSLP153, though the differences were not significant. From SSRW11 until ctoe7j7, the allele frequency difference remained skewed toward PSLP153 and the difference was significant. Further down chromosome 1 from SSRW39, the allele frequency difference remained skewed toward PSLP153, however, the difference was not significant. The interval associated with LB resistance was 23.0 cm. The interval associated with LB resistance and the flanking markers SSRW8 and SSRW39 was 30.9 cm. The recombination fraction between the markers associated with LB resistance and the resistance gene was between 36% and 44.5%. Analyzing the graphical genotypes of the selected resistant and susceptible individuals for chromosome 1 also provides insight into the resistance region (Figure 3-4). Fourteen of the twenty-five selected resistant individuals were homozygous for the PSLP153 allele in most, or all, of the entire 23 cm region associated with LB resistance. Of the other 11 resistant individuals, six were heterozygous and five were homozygous for the NCEBR-2 allele. Conversely, 10 of the selected LB susceptible individuals were homozygous for NCEBR-2 at all, or most, of the DNA

156 marker loci associated with LB resistance (Figure 3-4). None of the susceptible individuals was homozygous for PSLP153 in the entire region associated with LB resistance. 141 Figure 3-4. Graphical genotypes of chromosome 1 for the F 2 selected late blight resistant and susceptible individuals. The navy blue segments indicate homozygous for PSLP153, the red regions indicate homozygosity for NCEBR-2, the light blue regions indicate heterozygosity, and the green regions indicate unknown or missing data. The resistant individuals are labeled R1-25 and the susceptible individuals are labeled S1-S32. The yellow box outlines the region associated with late blight resistance. Chromosome 10 The allele frequency difference between the LB resistant and susceptible classes was skewed toward PSLP153 at all 17 DNA markers mapped to chromosome 10. However, the allele frequency difference was only significant at the three most distally located marker loci. The interval associated with LB resistance was at least 37.8 cm. There was no flanking marker beyond SSR223, the most distally mapped marker locus, so the interval size could not be estimated. The allele frequency differences between resistant and susceptible classes for SSR74

157 142 and SSR223 were more than twice as large as the largest allele frequency difference on chromosome 1. The recombination fraction between LB resistance and TMC0040 was 24.8% and the recombination fraction between LB resistance and SSR74 and SSR223 was 0%. Twenty of the twenty-five selected F 2 resistant individuals (80%) were homozygous for PSLP153 at the SSR74 and SSR223 marker loci, which were two of the three marker loci associated with LB resistance on chromosome 10 (Figure 3-5). The other five resistant individuals were heterozygous at these loci. Conversely, 26 of the 31 selected F 2 susceptible individuals (84%) were homozygous for NCEBR-2 at these loci. Of the five remaining susceptible individuals, four were heterozygous at the loci and one was homozygous for PSLP153. Figure 3-5. Graphical genotypes of chromosome 10 for the F 2 selected late blight resistant and susceptible individuals. The navy blue segments indicate homozygous for PSLP153, the red regions indicate homozygosity for NCEBR-2, the light blue regions indicate heterozygosity, and the green regions indicate unknown or missing data. The resistant individuals are labeled R1-25 and the susceptible individuals are labeled S1-S32. The yellow box outlines the region associated with late blight resistance.

158 143 Discussion The reactions of the parental lines (NCEBR-2 and PSLP153) to LB were opposite to each other and extreme. While NCEBR-2 was highly susceptible to LB; PSLP153 was highly resistant. The high level of LB resistance exhibited by S. pimpinellifolium accession PSLP153 makes this accession highly desirable as a source of LB resistance for tomato breeding. The currently available tomato LB resistance genes, Ph-1, Ph-2, and Ph-3, have been overcome by newer and aggressive P. infestans strains, emphasizing the need for new strong and durable sources of resistance (FOOLAD et al. 2008). The strong LB resistance conferred by PSLP153 may provide such desirable resistance. The F 1 individuals were also highly resistant to LB, suggesting that the resistance may be under dominant genetic control. The disease severity frequency distribution for the F 2 population was continuous, though it was not normally distributed. A normally distributed population suggests that a trait may be quantitatively controlled by multiple genes with additive effects. The skewness of the F 2 population toward lower disease severity suggests that the LB resistance is at least partially controlled by dominant, as opposed to additive genetic effects. The nature of the genes conferring LB resistance may be more accurately explored using near isogenic lines (NILs), as the only phenotypic variation is due to a small introgressed segment (FEHR 1993). Therefore, it is necessary to develop near isogenic lines (NILs) to explore the nature of the resistance genes identified in this study. Although qualitative disease resistance is often less desirable than quantitative resistance due to the potential for resistance breakdown, in the case of LB resistance, there has been some evidence of quantitative resistance breakdown. For example, Flier et al. (2003) found evidence that some strains of P. infestans adapted to, and overcame, partial LB resistance during field evaluations conducted over multiple years. In addition, qualitative disease resistance genes can be

159 144 pyramided more easily to provide disease resistance that is potentially durable and broadspectrum based (COLLARD and MACKILL 2008; MELCHINGER 1990; SINGH et al. 2001). Recently two LB resistance genes from the wild potato species S. microdontum and S. berthaultii were pyramided to increase the level and durability of LB resistance (TAN et al. 2010). The potential qualitative nature of the LB resistance conferred by PSLP153 makes this source of resistance desirable for resistance gene pyramiding. Further delineation of the resistance regions will allow identification of PCR-based markers tightly linked to LB resistance and suitable for marker-assisted gene pyramiding. Marker-assisted gene pyramiding is preferred to gene pyramiding based solely on phenotype because the use of molecular markers ensures that all desired alleles are incorporated (COLLARD and MACKILL 2008). Resistance gene pyramiding has been suggested to increase resistance durability (COLLARD and MACKILL 2008). This is particularly important in the case of LB, as McDonald and Linde (2002) hypothesized that the combination of P. infestans rapid disease cycle and the potential for occasional sexual reproduction has greatly increased the risk for host resistance breakdown. Efforts are currently underway in The Pennsylvania State University tomato genetics and breeding program to combine the LB resistance conferred by PSLP153 with other LB resistance genes (MR Foolad et al., unpub.). Of the 1309 molecular markers surveyed for polymorphism between the S. lycopersicum and S. pimpinellifolium parental lines, NCEBR-2 and PSLP153, 153 (11.7%) were polymorphic. This level of polymorphism is much lower than that reported by Chen and Foolad (1999) for another S. lycopersicum x S. pimpinellifolium cross. Chen and Foolad (1999) were the first to develop a genetic map based on hybridizations between S. lycopersicum and S. pimpinellifolium in which the S. pimpinellifolium (LA722) parent was selected due to the presence of traits potentially useful in a plant breeding context, as opposed to a basic science context. They detected a 67% polymorphism rate in RFLP markers previously identified as polymorphic

160 145 between the S. lycopersicum processing tomato line M and S. pimpinellifolium accession LA1589 and a 41% polymorphism rate in RFLP markers previously mapped to the high-density tomato map based on crosses between S. lycopersicum and S. pennellii. More recently, in another S. pimpinellifolium accession (LA2093), Sharma et al. (2008), detected a 54% polymorphism rate in RFLP markers that were polymorphic between S. lycopersicum and S. pimpinellifolium accession LA722 and a 30% polymorphism rate in RFLP markers previously mapped to the highdensity tomato map. In this research, only 6.1% of CAPS markers and 21.7% of SSRs that were mapped to the tomato high-density map were polymorphic between NCEBR-2 and PSLP153 ( Of the RFLP markers mapped by Sharma et al. (2008) and Ashrafi et al. (2009), only 11.8% were polymorphic between NCEBR-2 and PSLP153. This result was unexpected as the S. lycopersicum lines used in these studies, NCEBR-1 and NCEBR-2, have similar pedigrees, except that their early blight resistance was obtained from different sources. These results suggest that PSLP153 may be very closely related to S. lycopersicum. This hypothesis is further supported by the fact that PSLP153, like S. lycopersicum, and unlike many other S. pimpinellifolium accessions, originated in Mexico. The close relationship between S. lycopersicum and PSLP153 is desirable from a breeding perspective, as it suggests that fewer generations may be required to introduce LB resistance conferred by PSLP153 to S. lycopersicum. The low level of marker polymorphism between NCEBR-2 and PSLP153 made discovery of polymorphic markers challenging. However, the public availability of tomato DNA sequences greatly facilitated discovery of some polymorphic markers. For example, Tang et al. (2008) and Ohyama et al. (2009) mined publicly available EST and BAC-end sequence to develop novel SSRs. Furthermore, Tang et al. (2008) strove to discover new SSRs polymorphic within tomato by comparing sequence from different lines and mining for polymorphism between lines. The low level of polymorphism detected between NCEBR-2 and PSLP153 was thus

161 146 unexpected. The release of tomato BAC sequence and preliminary whole genome sequence as part of the International Tomato Genome Sequencing Project while this research was being conducted facilitated development of 51 new SSRs that were polymorphic between NCEBR-2 and PSLP153 (MUELLER et al. 2009; MUELLER et al. 2005b). The increasing availability of BAC and whole genome sequence will further facilitate development of more SSRs for use in finemapping and cloning of the LB resistance regions identified in this study. The F 2 genetic map constructed included 56 individuals that were genotyped with 153 molecular markers. The map spanned 1101 cm of the tomato genome and had an average of one marker every 7.2 cm. The marker density may be misleading as after regions of the tomato genome were associated with LB resistance on chromosomes 1 and 10, more markers were added to these regions. However, this map is of similar size to others constructed based on populations developed from hybridizations between S. lycopersicum and S. pimpinellifolium (ASHRAFI et al. 2009; GRANDILLO and TANKSLEY 1996; SHARMA et al. 2008). For example, Sharma et al. (2008) reported the most recent F 2 map, which included 172 individuals genotyped with 250 DNA markers and spanned 1002 cm of the tomato genome. Ten DNA markers located on five chromosomes were not segregating in the expected 1:2:1 Mendelian ratio (Table 3-10). Skewed segregation has been frequently reported in tomato populations derived from interspecific crosses and has been reported on all chromosomes (ASHRAFI et al. 2009; CHEN and FOOLAD 1999; FOOLAD 1996; GRANDILLO and TANKSLEY 1996; LIPPMAN and TANKSLEY 2001; SHARMA et al. 2008; ZHANG et al. 2003). Skewed segregation can affect marker analyses used to detect regions of the genome associated with trait(s) of interest. Reasons for skewed segregation include: differential phenotypic selection, selfincompatibility, unilateral incongruity, as well as gametophytic, zygotic, and viability selection (ASHRAFI et al. 2009; CHEN and FOOLAD 1999; FOOLAD 1996). Due to the close evolutionary relationship between S. lycopsericum and S. pimpinellifolium, skewed segregation due to causes

162 147 related to mating and reproduction were expected to have minimal impact (CHEN and FOOLAD 1999; FOOLAD 1996). In this research, the only intentional selections made were for a high level of resistance or susceptibility to LB. Marker allele frequency was compared between the selected groups. Furthermore, it was assumed that factors other than selection affected the LB resistant and susceptible groups equally. Due to the fact that nearly 60% of the molecular markers mapped in this population have not been mapped on the tomato high-density map, and that 44% of the molecular markers mapped in this population have not been previously mapped, formal comparison of the this genetic map with others was not feasible. However, all of the markers that had been previously mapped also mapped to the same chromosomes in this population. Previous comparisons of genetic maps developed based on populations derived from hybridizations between S. lycopersicum and S. pimpinellifolium with the high-density tomato map indicated that although genetic distances differed, marker order remained consistent (ASHRAFI et al. 2009; GRANDILLO and TANKSLEY 1996; LIPPMAN and TANKSLEY 2001; SHARMA et al. 2008). Therefore, it was expected that marker order would also be similar for the current genetic map. This genetic map was developed with the purpose of identifying regions of the tomato genome strongly associated with LB resistance. Adequate research has not been conducted to determine the effects of factors such as the proportion of the population selected, the QTL effect, or the marker-qtl distance on the efficiency of QTL detection using trait-based analysis (NAVABI et al. 2009). However, using simulations based on self-pollinated cereal crops, Navabi et al. (2009) purported that if a population of 500 was phenotyped, only 6% of the population needed to be genotyped to reliably detect a marker 25 cm from a QTL that explained 25% of the phenotypic variation. In this research, an F 2 population of 986 individuals was phenotyped for LB resistance, 5.6% of the most LB resistant and susceptible individuals were genotyped with 153 molecular markers on all twelve tomato chromosomes with the intent of identifying regions of the

163 148 tomato genome with large effect on LB resistance. In addition, using such a high level of stringency is purported to provide more than 99% confidence in the accurate detection of genomic regions identified (LEBOWITZ et al. 1987; ZHANG et al. 2003). Based on these two lines of evidence, it was expected that regions of the tomato genome with large effect on LB resistance could be accurately identified via trait-based analysis. Using a trait-based analysis (TBA) approach, two regions of the tomato genome on chromosomes 1 and 10 were detected to be associated with LB resistance. The region on the long arm of chromosome 1 was 23.0 cm long, with the flanking markers 30.9 cm apart. The region on chromosome 10 was located at the distal end of the chromosome, and it was at least 37.8 cm long. The size of the region could not be accurately estimated as there was no flanking marker at the distal-most end of the chromosome. The identification of two regions of the tomato genome is congruous with the hypothesis that LB resistance conferred by PSLP153 is under qualitative resistance gene control. To date, no other LB resistance genes have been localized to chromosome 1, though genes and QTLs conferring resistance to multiple diseases of tomato have been localized to this chromosome. These genes/qtls confer resistance to leaf mold, caused by Cladosporium fulvum (Cf genes) (PARNISKE et al. 1999; SOUMPOUROU et al. 2007), bacterial canker, caused by Clavibacter michiganesis (SANDBRINK et al. 1995) and bacterial spot, caused by Xanthomonas campestris pv. vesicatoria (rx genes) (YU et al. 1995) (for a review, see (FOOLAD 2007)). Although the majority of these resistance genes were mapped to the short arm of chromosome, the rx-3 gene was mapped to the long arm of chromosome 1 (YU et al. 1995). The lack of other LB resistance genes on chromosome 1 indicates that this is a novel region conferring LB resistance in tomato. Therefore, this region has great potential as a new source of LB resistance, emphasizing the benefits of continued germplasm screening to identify novel sources of LB resistance.

164 149 The interval associated with LB resistance on chromosome 1 was 23 cm long, with flanking markers 30.7 cm apart and the recombination fractions between molecular marker loci associated with LB resistance and the resistance gene were between 36 and 44.5%. The large interval associated with LB resistance and the large recombination fractions currently limit the utility of this LB resistance. To increase the value of this region from a breeding perspective, the resistance region on chromosome 1 must be further delineated through the development and analysis of near isogenic lines (NILs). Further delineation of the resistance region will facilitate development of molecular markers tightly linked with the resistance that will be useful for marker-assisted selection (MAS). The region of chromosome 10 associated with LB resistance must be interpreted with some caution due to the skewed segregation of SSR74 and SSR233, which are two of the three molecular markers on chromosome 10 associated with LB resistance. Segregation distortion can lead to false identification of associations between marker loci and LB resistance, though most false associations are eliminated through the use of bi-directional TBA (as opposed to unidirectional TBA) (FOOLAD and JONES 1993; NAVABI et al. 2009). In addition, the high level of stringency applied in the TBA provides greater than 99% confidence in the regions associated with LB resistance (LEBOWITZ et al. 1987; ZHANG et al. 2003). The segregation distortion on chromosome 10 was likely due to selection for the most LB resistant individuals and the most LB susceptible individuals as there was an overabundance of the PSLP153 allele in the LB resistant individuals and an overabundance of the NCEBR-2 allele in the LB susceptible individuals (Table 3-13). Genes conferring potato and tomato LB resistance have been previously located at the distal end of chromosome 10. In the wild potato species, S. berthaultii, Ewing et al. (2000) identified and mapped an LB resistance gene 4.8 cm from the tomato genomic clone TG63, which is location at position 80 of chromosome 10 on the tomato high-density map

165 150 ( In addition, the tomato LB resistance gene, Ph-2, was mapped to an 8.4 cm interval at the distal end of chromosome 10 (MOREAU et al. 1998). TG233, one of the flanking markers, is located at position 86 of chromosome 10 on the tomato high-density map ( CP105, the second flanking marker, is located more proximally, however, it has not been located on the tomato high-density map ( SSR74 and SSR223, two SSR markers tightly associated with LB resistance conferred by PSLP153 are located at positions 74 and 75 on the tomato high-density map ( These map positions indicate that the genomic regions containing the potato LB resistance gene identified by Ewing et al., Ph-2, and LB resistance conferred by PSLP153 may overlap. The potential overlap of these regions makes it possible that these LB resistance genes are the same, are alleles of the same gene, or are part of the same gene family as resistance genes, including LB resistance genes, can occur in clusters (PARK et al. 2005c). Phenotypic evidence suggests that the tomato LB resistance genes may not be the same gene. Moreau et al. (1998) report that Ph-2 slows disease progress to some P. infestans strains. In addition, in our experiments, the resistance conferred by Ph-2 fails in the presence of aggressive P. infestans strain used for screening the F 2 population (FOOLAD et al. 2008). Conversely, the LB resistance conferred by PSLP153 is strong and has been effective against all seven P. infestans races tested to date (MR Foolad, unpub.). However, the high degree of background segregation in the F 2 population makes it difficult to assess the contribution the region on chromosome 10 makes to conferring LB resistance. To observe the effects of the resistance segment on chromosome 10 in isolation, NILs must be developed. In addition to a phenotypic assessment of the degree of similarity in the LB resistance conferred by Ph-2 and the LB resistance region on chromosome 10, genetic analyses must be conducted. To reach a definitive conclusion, the resistance genes should be physically mapped and possibly cloned and the gene sequences

166 151 compared to determine whether the resistance genes are the same gene, alleles of the same gene, or members of the same resistance gene family. To increase the utility of the LB resistance conferred by PSLP153 on the distal end of chromosome 10, more molecular markers must be mapped to this region to attempt to identify a flanking marker at the distal-most part of the region conferring LB resistance. Identification of a second flanking marker will facilitate an assessment of the size of the region conferring LB resistance. The 24.8% recombination fraction between TMC0040 and the LB resistance gene is smaller than any recombination fraction calculated on chromosome 1. Furthermore, the 0% recombination fraction between SSR74 and SSR223 and the recombination fraction is even more promising. This recombination fraction indicates that SSR74 and SSR223 are likely close to the LB resistance gene. However, the 0% recombination fraction may be somewhat misleading. Although there were no recombination events between the SSR74/SSR223 and the LB resistance gene in the resistant individuals, there were five recombination events between SSR74/SSR223 and the LB resistance gene in the susceptible individuals. The product of the number of recombination events in the resistant and susceptible individuals comprises the numerator of the ratio used to calculate z (see statistical analysis in the materials and methods section). The recombination fraction is estimated from the z value. Therefore, the absence of recombination events in the resistance or susceptible classes would lead to a z value of 0. This is particularly important when using small sample sizes, such as those used in this analysis. To further increase the value of this region from a breeding perspective, the resistance region on chromosome 10 is being delineated through the development and analysis of NILs. Further delineation of the resistance region will facilitate development of molecular markers tightly linked with the resistance that will be useful for marker-assisted selection (MAS). The potentially devastating effects of LB to the tomato and the current lack of adequate disease control and prevention measures make the identification and mapping of new LB

167 152 resistance genes, such as those identified in this research, essential. The identification of these genes in an S. pimpinellifolium accession is desirable as S. pimpinellifolium is closely related to the cultivated tomato and interspecific hybridizations can be readily performed. The low level of polymorphism between the parental lines used in this research suggests that these lines are particularly closely related. Despite the low level of polymorphism, 153 molecular markers were identified as polymorphic and used to create an F 2 genetic map. Of the 153 polymorphic markers 117 (76%) were PCR-based, and 56 (37%) were developed specifically for this research. However, the 56 PCR-based markers will likely be polymorphic between S. lycopersicum and S. pimpinellifolium and will thus be useful in other populations. Using trait-based analysis, two regions of tomato chromosomes 1 and 10 were associated with LB resistance. This is the first time that an LB resistance gene has been mapped to tomato chromosome 1. Previously a potato LB resistance gene and the tomato LB resistance gene, Ph-2, were mapped to chromosome 10. Further research must be conducted to determine whether these three genes are the same, alleles of the same gene, or members of the same gene family. Currently, NILs are being developed to study the effects of the LB resistance on chromosome 1 and also the resistance on chromosome 10 in isolation. In addition, NIL development will allow delineation of the LB resistance genes and development of PCR-based markers suitable for MAS.

168 153 References ABREU, F. B., D. J. H. DA SILVA, C. D. CRUZ and E. S. G. MIZUBUTI, 2008 Inheritance of resistance to Phytophthora infestans (Peronosporales, Pythiaceae) in a new source of resistance in tomato (Solanum sp (formerly Lycopersicon sp.), Solanales, Solanaceae). Genetics and Molecular Biology 31: ALEXANDER, L. J., 1953 Progress report of national screening committee for disease resistance in the tomato for Plant Disease Reporter 37: ANDRUS, C. F., 1946 Resistance of tomato varieties to late blight in south carolina. The Plant Disease Reporter 30: ARENS, P., P. ODINOT, A. W. VAN HEUSDEN, P. LINDHOUT and B. VOSMAN, 1995 GATA- and GACA-repeats are not evenly distributed throughout the tomato genome. Genome 38: ARESHCHENKOVA, T., and M. W. GANAL, 2002 Comparative analysis of polymorphism and chromosomal location of tomato microsatellite markers isolated from different sources. Theoretical and Applied Genetics 104: ASHRAFI, H., M. KINKADE and M. R. FOOLAD, 2009 A new genetic linkage map of tomato based on a Solanum lycopersicum x S. pimpinellifolium RIL population displaying locations of candidate pathogen response genes. Genome 52: AYOUB, M., and D. E. MATHER, 2002 Effectiveness of selective genotyping for detection of quantitative trait loci: an analysis of grain and malt quality traits in three barley populations. Genome 45: BAI, Y. L., X. H. FENG, R. VAN DER HULST and P. LINDHOUT, 2004 A set of simple PCR markers converted from sequence specific RFLP markers on tomato chromosomes 9 to 12. Molecular Breeding 13: BECKTELL, M. C., C. A. SMART, C. H. HANEY and W. E. FRY, 2006 Host-pathogen interactions between Phytophthora infestans and the Solanaceous hosts Calibrachoa x Hybridus, Petunia x hybrida, and Nicotiana benthamiana. Plant Disease 90: BERNATZKY, R., and S. D. TANKSLEY, 1986a Genetics of actin-related sequences in tomato. Theoretical and Applied Genetics 72: BERNATZKY, R., and S. D. TANKSLEY, 1986b Methods for detection of single or low copy sequences in tomato on southern blots. Plant Molecular Biology Reporter 4: BERNATZKY, R., and S. D. TANKSLEY, 1986c Toward a saturated linkage map in tomato based on isozymes and random cdna sequences. Genetics 112: BONDE, R., and E. F. MURPHY, 1952 Resistance of certain tomato varieties and crosses to late blight. Maine Agricultural Experiment Station Bulletin 497: BRETO, M. P., M. J. ASINS and E. A. CARBONELL, 1993 Genetic-variability in Lycopersicon species and their genetic-relationships. Theoretical and Applied Genetics 86: BROUN, P., and S. D. TANKSLEY, 1996 Characterization and genetic mapping of simple repeat sequences in the tomato genome. Molecular & General Genetics 250: BROUWER, D. J., E. S. JONES and D. A. ST CLAIR, 2004 QTL analysis of quantitative resistance to Phytophthora infestans (late blight) in tomato and comparisons with potato. Genome 47:

169 BROUWER, D. J., and D. A. ST.CLAIR, 2004 Fine mapping of three quantitative trait loci for late blight resistance in tomato using near isogenic lines (NILs) and sub-nils. Theoretical and Applied Genetics 108: CHEN, G. Q., and M. R. FOOLAD, 1999 A molecular linkage map of tomato based on a cross between Lycopersicon esculentum and L. pimpinellifolium and its comparison with other molecular maps of tomato. Genome 42: CHUNWONGSE, J., C. CHUNWONGSE, L. BLACK and P. HANSON, 2002 Molecular mapping of the Ph-3 gene for late blight resistance in tomato. Journal of Horticultural Science and Biotechnology 77: COLLARD, B. C. Y., and D. J. MACKILL, 2008 Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Philosophical Transactions of the Royal Society B-Biological Sciences 363: CRESTE, S., A. T. NETO and A. FIGUEIRA, 2001 Detection of single sequence repeat polymorphisms in denaturing polyacrylamide sequencing gels by silver staining. Plant Molecular Biology Reporter 19: DARVASI, A., and M. SOLLER, 1992 Selective genotyping for determination of linkage between a marker locus and a quantitative trait locus. Theoretical and Applied Genetics 85: DEAHL, K. L., R. W. GOTH, R. YOUNG, S. L. SINDEN and M. E. GALLEGLY, 1991 Occurrence of the A2 mating type of Phytophthora infestans in potato fields in the United States and Canada. American Potato Journal 68: DOGANLAR, S., A. FRARY, H. M. KU and S. D. TANKSLEY, 2002b Mapping quantitative trait loci in inbred backcross lines of Lycopersicon pimpinellifolium (LA1589). Genome 45: ESHED, Y., and D. ZAMIR, 1995 An introgression line population of Lycopersicon pennellii in the cultivated tomato enables the identification and fine mapping of yield-associated QTL. Genetics 141: EWING, E. E., I. SIMKO, C. D. SMART, M. W. BONIERBALE, E. S. G. MIZUBUTI et al., 2000 Genetic mapping from field tests of qualitative and quantitative resistance to Phytophthora infestans in a population derived from Solanum tuberosum and Solanum berthaultii. Molecular Breeding 6: FAOSTAT, 2005 FAO Statistical Databases, pp. Food and Agriculture Association of the United Nations, Statistics Division. FEHR, W. R., 1993 Principles of Cultivar Development. MacMillan Publishing. FELTUS, F. A., J. WUN, S. R. SCHULZE, J. C. ESTILL, N. JIANG et al., 2004 An SNP resource for rice genetics and breeding based on subspecies indica and japonica Genome Research 14: FISHER, R. A., and B. BALMUKAND, 1928 The estimation of linkage from the offspring of selfed heterozygotes. Journal of Genetics 20: FLIER, W. G., G. B. M. VAN DEN BOSCH and L. J. TURKENSTEEN, 2003 Stability of partial resistance in potato cultivars exposed to aggressive strains of Phytophthora infestans. Plant Pathology 52: FLOR, H. H., 1955 Host-parasite interaction in flax rust - its genetics and other implications. Phytopathology 45: FOOLAD, M. R., 1996 Unilateral incompatibility as a major cause of skewed segregation in the cross between Lycopersicon esculentum and L. pennellii. Plant Cell Reports 15: FOOLAD, M. R., 2007 Genome mapping and molecular breeding of tomato, pp. 52 in International Journal of Plant Genomics. 154

170 FOOLAD, M. R., and R. A. JONES, 1993 Mapping salt-tolerance genes in tomato (Lycopersicon esculentum) using trait-based marker analysis. Theoretical and Applied Genetics 87: FOOLAD, M. R., H. L. MERK and H. ASHRAFI, 2008 Genetics, genomics and breeding of late blight and early blight resistance in tomato. Critical Reviews in Plant Sciences 27: FOOLAD, M. R., T. STOLZ, C. DERVINIS, R. L. RODRIGUEZ and R. A. JONES, 1997 Mapping QTLs conferring salt tolerance during germination in tomato by selective genotyping. Molecular Breeding 3: FRY, W. E., and S. B. GOODWIN, 1997a Re-emergence of potato and tomato late blight in the United States. Plant Disease 81: FRY, W. E., and S. B. GOODWIN, 1997b Resurgence of the Irish potato famine fungus. Bioscience 47: GALLAIS, A., L. MOREAU and A. CHARCOSSET, 2007 Detection of marker-qtl associations by studying change in marker frequencies with selection. Theoretical and Applied Genetics 114: GALLEGLY, M. E., and J. GALINDO, 1958 Mating types and oospores of Phytophthora infestans in nature in Mexico. Phytopathology 48: GALLEGLY, M. E., and M. E. MARVEL, 1955 Inheritance of resistance to tomato race-o of Phytophthora infestans. Phytopathology 45: GANAL, M. W., R. CZIHAL, U. HANNAPPEL, D. U. KLOOS, A. POLLEY et al., 1998 Sequencing of cdna clones from the genetic map of tomato (Lycopersicon esculentum). Genome Research 8: GARDNER, R. G., 1988 NC EBR-1 and NC EBR-2 early blight resistant tomato breeding lines. Hortscience 23: GAVINO, P. D., C. D. SMART, R. W. SANDROCK, J. S. MILLER, P. B. HAMM et al., 2000 Implications of sexual reproduction for Phytophthora infestans in the United States: Generation of an aggressive lineage. Plant Disease 84: GEETHANJALI, S., K. Y. CHEN, D. V. PASTRANA and J. F. WANG, 2010 Development and characterization of tomato SSR markers from genomic sequences of anchored BAC clones on chromosome 6. Euphytica 173: GISI, U., and Y. COHEN, 1996 Resistance to phenylamide fungicides: A case study with Phytophthora infestans involving mating type and race structure. Annual Review of Phytopathology 34: GRANDILLO, S., and S. D. TANKSLEY, 1996 Genetic analysis of RFLPs, GATA microsatellites and RAPDs in a cross between L. esculentum and L. pimpinellifolium. Theoretical and Applied Genetics 92: HAO, Z., X. LIU, X. LI, C. XIE, M. LI et al., 2009 Identification of quantitative trait loci for drought tolerance at seedling stage by screening a large number of introgression lines in maize. Plant Breeding 128: HE, C., V. POYSA and K. YU, 2003 Development and characterization of simple sequence repeat (SSR) markers and their use in determining relationships among Lycopersicon esculentum cultivars. Theoretical and Applied Genetics 106: HOHL, H. R., and K. ISELIN, 1984 Strains of Phytophthora infestans from Switzerland with A2- mating type behavior. Transactions of the British Mycological Society 83: IRZHANSKY, I., and Y. COHEN, 2006 Inheritance of resistance against Phytophtora infestans in Lycopersicon pimpinellifolium L3707. Euphytica 149: JUDELSON, H. S., 1997 The genetics and biology of Phytophthora infestans: Modern approaches to a historical challenge. Fungal Genetics and Biology 22:

171 KIM, M. J., and M. A. MUTSCHLER, 2005 Transfer to processing tomato and characterization of late blight resistance derived from Solanum pimpinellifolium L. L3708. Journal of the American Society for Horticultural Science 130: KIRK, W. W., K. J. FELCHER, D. S. DOUCHES, J. COOMBS, J. M. STEIN et al., 2001 Effect of host plant resistance and reduced rates and frequencies of fungicide application to control potato late blight. Plant Disease 85: KOSAMBI, D. D., 1944 The estimation of map distances from recombination values. Annals of Eugenics 12: LABATE, J. A., and A. M. BALDO, 2005 Tomato SNP discovery by EST mining and resequencing. Molecular Breeding 16: LANDER, E. S., P. GREEN, J. ABRAHAMSON, A. BARLOW, M. J. DALY et al., 1987 MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1: LEBOWITZ, R. J., M. SOLLER and J. S. BECKMANN, 1987 Trait-based analyses for the detection of linkage between marker loci and quantitative trait loci in crosses between inbred lines. Theoretical and Applied Genetics 73: LIPPMAN, Z., and S. D. TANKSLEY, 2001 Dissecting the genetic pathway to extreme fruit size in tomato using a cross between the small-fruited wild species Lycopersicon pimpinellifolium and L. esculentum var. giant heirloom. Genetics 158: MARTIN, G. B., S. H. BROMMONSCHENKEL, J. CHUNWONGSE, A. FRARY, M. W. GANAL et al., 1993 Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science 262: MARTINS, W. S., D. C. S. LUCAS, K. F. S. NEVES and D. J. BERTIOLI, 2009 WebSat - A web software for microsatellite marker development. Bioinformatician 3: MCDONALD, B. A., and C. LINDE, 2002 The population genetics of plant pathogens and breeding strategies for durable resistance. Euphytica 124: MELCHINGER, A. E., 1990 Use of molecular markers in breeding for oligogenic disease resistance. Plant Breeding 104: MILLER, J. C., and S. D. TANKSLEY, 1990 RFLP analysis of phylogenetic-relationships and genetic-variation in the genus Lycopersicon. Theoretical and Applied Genetics 80: MOREAU, P., P. THOQUET, J. OLIVIER, H. LATERROT and N. GRIMSLEY, 1998 Genetic mapping of Ph-2, a single locus controlling partial resistance to Phytophtora infestans in tomato. Molecular Plant-Microbe Interactions 11: MUELLER, L. A., R. K. LANKHORST, S. D. TANKSLEY, J. J. GIOVANNONI, R. WHITE et al., 2009 A snapshot of the emerging tomato genome sequence. The Plant Genome 2: MUELLER, L. A., T. H. SOLOW, N. TAYLOR, B. SKWARECKI, R. BUELS et al., 2005a The SOL Genomics Network. A comparative resource for Solanaceae biology and beyond. Plant Physiology 138: MUELLER, L. A., S. D. TANKSLEY, J. J. GIOVANNONI, J. VAN ECK, S. STACK et al., 2005b The tomato sequencing project, the first cornerstone of the International Solanaceae Project (SOL). Comparative and Functional Genomics 6: NAERSTAD, R., A. HERMANSEN and T. BJOR, 2007 Exploiting host resistance to reduce the use of fungicides to control potato late blight. Plant Pathology 56: NAVABI, A., D. E. MATHER, J. BERNIER, D. M. SPANER and G. N. ATLIN, 2009 QTL detection with bidirectional and unidirectional selective genotyping: marker-based and trait-based analyses. Theoretical and Applied Genetics 118:

172 OHYAMA, A., E. ASAMIZU, S. NEGORO, K. MIYATAKE, H. YAMAGUCHI et al., 2009 Characterization of tomato SSR markers developed using BAC-end and cdna sequences from genome databases. Molecular Breeding 23: PARK, T. H., V. VLEESHOUWERS, R. C. B. HUTTEN, H. J. VAN ECK, E. VAN DER VOSSEN et al., 2005c High-resolution mapping and analysis of the resistance locus Rpi-abpt against Phytophthora infestans in potato. Molecular Breeding 16: PARNISKE, M., B. B. H. WULFF, G. BONNEMA, C. M. THOMAS, D. A. JONES et al., 1999 Homologues of the Cf-9 disease resistance gene (Hcr9s) are present at multiple loci on the short arm of tomato chromosome 1. Molecular Plant-Microbe Interactions 12: PEIRCE, L. C., 1971 Linkage tests with Ph conditioning resistance to race 0, Phytophthora infestans. Tomato Genetics Co-operative Report 21: 30. RICH, A. E., M. C. RICHARDS and E. M. MEADER, 1962 Rockingham, a new tomato variety resistant to late blight. Plant Disease Reporter 46: 130. RICK, C. M., 1982 The Potential of Exotic Germplasm for Tomato Improvement, pp in Plant Improvement and Somatic Cell Genetics, edited by I. K. VASIL, W. R. SCOWCROFT and K. J. FREY. Academic Press. RODRIGUEZ, F., F. N. WU, C. ANE, S. TANKSLEY and D. M. SPOONER, 2009 Do potatoes and tomatoes have a single evolutionary history, and what proportion of the genome supports this history? Bmc Evolutionary Biology 9. ROZEN, S., and H. SKALETSKY (Editors), 2000 Primer3 on the www for general users and for biologist programmers. Humana Press, Inc., Totowa, NJ. RUSSELL, P. E., 2005 A century of fungicide evolution. Journal of Agricultural Sciences 143: SANDBRINK, J. M., J. W. VANOOIJEN, C. C. PURIMAHUA, M. VRIELINK, R. VERKERK et al., 1995 Localization of genes for bacterial canker resistance in Lycopsericon peruvianum using RFLPs. Theoretical and Applied Genetics 90: SEAMAN, A., R. LORIA, W. FRY and T. ZITTER, 2010 Late blight: A serious disease of potatoes and tomatoes, pp. SHARMA, A., L. P. ZHANG, D. NINO-LIU, H. ASHRAFI and M. R. FOOLAD, 2008 A Solanum lycopersicum x Solanum pimpinellifolium linkage map of tomato displaying genomic locations of R-genes, RGAs, and candidate resistance/defense-response ESTs, pp. 18 in International Journal of Plant Genomics. SHTIENBERG, D., R. RAPOSO, S. N. BERGERON, D. E. LEGARD, A. T. DYER et al., 1994 Incorporation of cultivar resistance in a reduced-sprays strategy to suppress early and late blights on potato. Plant Disease 78: SINGH, S., J. S. SIDHU, N. HUANG, Y. VIKAL, Z. LI et al., 2001 Pyramiding three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106. Theoretical and Applied Genetics 102: SMART, C., S. TANKSLEY, H. MAYTON and W. FRY, 2007 Resistance to Phytophthora infestans in Lycopersicon pennellii. Plant Disease 91: SOUMPOUROU, E., M. LAKOVIDIS, L. CHARTRAIN, V. LYALL and C. M. THOMAS, 2007 The Solanum pimpinellifolium Cf-ECP1 and Cf-ECP4 genes for resistance to Cladosporium fulvam are located at the Milky Way locus on the short arm of chromosome 1. Theoretical and Applied Genetics 115: SOUTHERN, E. M., 1975 Detection of specific sequences among DNA fragments separated by gel electrophoresis. Journal of Molecular Biology 98:

173 STUBER, C. W., M. M. GOODMAN and R. H. MOLL, 1982 Improvement of yield and ear number resulting from selection at allozyme loci in a maize population. Crop Science 22: STUBER, C. W., R. H. MOLL, M. M. GOODMAN, H. E. SCHAFFER and B. S. WEIR, 1980 Allozyme frequency changes associated with selection for increased grain-yield in maize (Zea mays L). Genetics 95: TAN, M. Y. A., R. C. B. HUTTEN, R. G. F. VISSER and H. J. VAN ECK, 2010 The effect of pyramiding Phytophthora infestans resistance genes R (Pi-mcd1) and R (Pi-ber) in potato. Theoretical and Applied Genetics 121: TANG, J., S. J. BALDWIN, J. M. E. JACOBS, C. G. VAN DER LINDEN, R. E. VOORRIPS et al., 2008 Large-scale identification of polymorphic microsatellites using an in silico approach. BMC Bioinformatics 9. TANKSLEY, S. D., M. W. GANAL, J. P. PRINCE, M. C. DEVICENTE, M. W. BONIERBALE et al., 1992 High-density molecular linkage maps of the tomato and potato genomes. Genetics 132: TANKSLEY, S. D., and C. M. RICK, 1980 Isozymic gene linkage map of the tomato - applications in genetics and breeding. Theoretical and Applied Genetics 57: THODAY, J. M., 1961 Location of polygenes. Nature 191: 368-&. USDA, 2010 The United States Department of Agriculture, pp. VAN BERLOO, R., 2008 GGT 2.0: Versatile software for visualization and analysis of genetic data. Journal of Heredity 99: VAN DER HOEVEN, R., C. RONNING, J. GIOVANNONI, G. MARTIN and S. TANKSLEY, 2002 Deductions about the number, organization, and evolution of genes in the tomato genome based on analysis of a large expressed sequence tag collection and selective genomic sequencing. Plant Cell 14: VAN DER KNAAP, E., Z. B. LIPPMAN and S. D. TANKSLEY, 2002 Extremely elongated tomato fruit controlled by four quantitative trait loci with epistatic interactions. Theoretical and Applied Genetics 104: VOORRIPS, R. E., 2002 MapChart: Software for the graphical presentation of linkage maps and QTLs. Journal of Heredity 93: WALTER, J. M., and R. A. CONOVER, 1952 Hereditary resistance to late blight of tomato. Phytopathology 42: WANG, D., J. SHI, S. R. CARLSON, P. B. CREGAN, R. W. WARD et al., 2003 A low-cost, highthroughput polyacrylamide gel electrophoresis system for genotyping with microsatellite DNA markers. Crop Science 43: WANG, Y., R. S. VAN DER HOEVEN, R. NIELSEN, L. A. MUELLER and S. D. TANKSLEY, 2005 Characteristics of the tomato nuclear genome as determined by sequencing undermethylated EcoRI digested fragments. Theoretical and Applied Genetics 112: WU, F. N., L. A. MUELLER, D. CROUZILLAT, V. PETIARD and S. D. TANKSLEY, 2006 Combining bioinformatics and phylogenetics to identify large sets of single-copy orthologous genes (COSII) for comparative, evolutionary and systematic studies: A test case in the euasterid plant clade. Genetics 174: YANG, H. A., R. M. LIN, D. RENSHAW, C. D. LI, K. ADHIKARI et al., 2010 Development of sequence-specific PCR markers associated with a polygenic controlled trait for markerassisted selection using a modified selective genotyping strategy: a case study on anthracnose disease resistance in white lupin (Lupinus albus L.). Molecular Breeding 25:

174 YU, Z. H., J. F. WANG, R. E. STALL and C. E. VALLEJOS, 1995 Genomic localization of tomato genes that control a hypersensitive reaction to xanthomonas-campestris pv vesicatoria (DOIDGE) dye. Genetics 141: ZHANG, L. P., G. Y. LIN, D. NINO-LIU and M. R. FOOLAD, 2003 Mapping QTLs conferring early blight (Alternaria solani) resistance in a Lycopersicon esculentum X L. hirsutum cross by selective genotyping. Molecular Breeding 12:

175 Chapter 4 Confirmation of New Tomato Late Blight Resistance Genes and Progress Toward Developing Near Isogenic Lines Abstract Late blight (LB), caused by the oomycete Phythophthora infestans (Mont.) de Bary, is a notorious and devastating disease of tomatoes and potatoes that is capable of wiping out entire crops in several days. Previously, LB was relatively well-controlled through heavy fungicide application, cultural practices, and growing semi-resistant potato cultivars. There are few cultivars with LB resistance and these have only recently been made available. Recently, new and aggressive P. infestans strains have appeared. To regain adequate control of LB, new sources of genetic resistance in the wild tomato species are being identified and characterized. Previous field, greenhouse and growth chamber experiments identified S. pimpinellifolium accession PSLP153 as being highly resistant to LB. PSLP153 was hybridized with the LB susceptible breeding line NCEBR-2 and a large F 2 population was developed. Employing a selective genotyping approach in the F 2 population, molecular markers in two regions of the tomato genome were associated with LB resistance conferred by PSLP153. These segments were located in a 23 cm region of the long arm of chromosome 1 and at the distal end of chromosome 10. Selective genotyping was conducted simultaneously with efforts to introduce the LB resistance to breeding material. To introduce the LB resistance conferred by S. pimpinellifolium accession PSLP153 to valuable breeding material, the regions conferring LB resistance should be delineated as finely as possible and the gene effects determined. The goals of this thesis research were to develop advanced populations to confirm the resistance regions, delineate the resistance regions, and determine gene effects. Delineating the resistance regions allows development and selection

176 161 of tightly linked and reliable DNA markers for use in marker-assisted selection (MAS). To develop advanced populations for resistance gene delineation, progress was made toward developing near isogenic lines (NILs). Because selective genotyping in the F 2 generation and NIL development were conducted simultaneously, more molecular markers were genotyped in later generations. Resistant F 2 individuals were allowed to self-pollinate and F 3 families were evaluated for horticultural characteristics under field conditions. Selected individuals from F 3 families were allowed to self-pollinate and their F 4 progeny were evaluated for LB resistance using phenotypic screening and selection based on an SSR marker on chromosome 1 associated with LB resistance, the only molecular marker associated with LB resistance at the time. A LB resistant F 4 individual homozygous for the LB resistant allele at the SSR marker locus was backcrossed to the recurrent parent, NCEBR-2, to generate F 4 BC 1 progeny. An F 4 BC 1 individual that was resistant to LB was selected for further backcrossing to NCEBR-2 to generate F 4 BC 2 progeny. An F 4 BC 2 individual that was resistant to LB, heterozygous at four marker loci associated with resistance on chromosomes 1 and 10, and with minimal PSLP153 background was selected for further backcrossing to NCEBR-2 to generate F 4 BC 3 progeny. Three F 4 BC 3 individuals were genotyped with three marker loci associated with resistance on chromosomes 1 and 10 and were evaluated for LB resistance to assess the relationship between genotype and response to LB. There was an association between marker genotype on chromosome 10 and LB response, indicating that the segment on chromosome 10 is important for LB resistance. Three LB resistant F 4 BC 3 individuals that were heterozygous at four marker loci associated with LB resistance and with minimal background NCEBR-2 contribution were allowed to self-pollinate and were backcrossed to NCEBR-2 to generate three F 4 BC 3 S 1 populations and three F 4 BC 4 populations. One F 4 BC 3 S 1 population and one F 4 BC 4 population were evaluated for LB resistance and genotyped with six DNA marker loci associated with LB resistance (three on chromosome 1 and three on chromosome 10). The LB resistant segment on chromosome 10 was confirmed and

177 162 accounted for 50.7% of the phenotypic variation in LB response. Furthermore, the resistance segment had additive genetic effects that affected LB disease severity by 35.7% and dominant genetic effects that affected LB disease severity by 5.2%. The strong additive genetic effects of this region make further delineation via fine-mapping essential so that the LB resistance may be introduced into breeding material through MAS. Unfortunately, the LB resistance region on chromosome 1 could not be confirmed. Further experiments need to be conducted to recover this resistance. The potential threat of LB combined with economic value of the tomato make further study of the LB resistance conferred by S. pimpinellifolium accession PSLP153 worthwhile, so that the resistance may be satisfactorily deployed in commercial cultivars. Introduction Significance of the Tomato The cultivated tomato, Solanum lycopersicum L. (formerly Lycopersicum esculentum Mill), is the second most commonly consumed vegetable crop worldwide (after potato) and the second most economically important vegetable crop in the U.S. (after potato) with a farm value greater than $3 billion (FAOSTAT 2005) (USDA 2010). Although the tomato has a relatively low overall nutritional value, it ranks highly in its nutritional contribution to the U.S. diet due to the large volume of fresh tomatoes and tomato products consumed (FOOLAD 2007). The economic and dietary importance of tomatoes makes breeding high quality tomatoes essential. Biotic and abiotic stresses, as well as changes in the environment, and changes in consumer and producer preference make development of new tomato cultivars a constant priority. However, there is little genetic diversity within the cultivated tomato, S. lycopersicum, to explore for use in new cultivar development. In fact, S. lycopersicum is estimated to contain a mere 5% of

178 163 the genetic diversity within tomato species (MILLER and TANKSLEY 1990). The lack of genetic variation within S. lycopersicum has meant that breeders often cannot find a desired phenotype within the species, thereby forcing breeders to search for traits of interest in wild tomato species (RICK 1982; TANKSLEY and RICK 1980). The Use of Related Wild Tomato Species Although wild tomato species harbor some desirable traits, such as disease resistance, salt tolerance, drought tolerance, and cold tolerance, they also possess a large number of undesirable traits, such as indeterminate growth habit, low yield and small fruit size. The biggest drawback to introducing desirable traits from wild species is the introduction of undesirable genes into the cultigen as a result of the initial hybridization with the wild species (TANKSLEY and RICK 1980). To eliminate the undesirable wild traits, a series of backcrosses can be made with a recurrent parent (SOLLER and PLOTKINHAZAN 1977; TANKSLEY and RICK 1980). Half of the wild genetic background is eliminated with each backcross due to Mendelian segregation, except at regions linked to desirable traits (HOSPITAL 2005). These regions can be much more difficult to eliminate, however, the elimination of undesired wild background can be accelerated through the use of marker-assisted backcrossing (HOSPITAL 2005; LECOMTE et al. 2004; TANKSLEY et al. 1981; TANKSLEY and RICK 1980). Molecular marker genotyping at marker loci associated with the gene of interest (foreground regions) can complement or replace phenotypic analyses to retain the desired trait (LANDE and THOMPSON 1990; TANKSLEY 1983). This approach can be particularly successful when molecular markers bracketing the gene of interest (flanking markers) are available because it reduces the chance of losing the gene of interest due to undetected recombination between a linked marker and the gene (HOSPITAL and CHARCOSSET 1997; SOLLER and PLOTKINHAZAN 1977; TANKSLEY 1983). In addition, molecular marker genotyping at marker

179 164 loci distributed throughout regions of the genome not associated with the trait of interest (background regions) and selection based on these marker genotypes can accelerate recovery of the recurrent parent background and may reduce the number of backcross generations required by one to three generations (HOSPITAL and CHARCOSSET 1997; TANKSLEY et al. 1981; TANKSLEY and RICK 1980). Wild tomato species related to S. lycopersicum include S. pimpinellifolium, S. galapagense, S. cheesmanii, S. chmielewskii, S. peruvianum, S. habrochaites, and S. pennellii (MILLER and TANKSLEY 1990; RODRIGUEZ et al. 2009). S. pimpinellifolium is the closest wild relative of S. lycopersicum. It is a red-fruited species, unlike the majority of wild tomato species, which are green-fruited. It is also easily hybridized with S. lycopersicum. These and other qualities make S. pimpinellifolium a desirable species to use as a donor parent. However, the close evolutionary relationship between S. pimpinellifolium and S. lycopersicum means there are relatively few genetic differences between the species, thereby making polymorphic markers difficult to identify. Without sufficient numbers of polymorphic markers, accurate genetic mapping and gene isolation via mapping procedures for desired traits, such as LB resistance, are impossible. Significance of Late Blight Late blight (LB) caused by the oomycete Phytophthora infestans (Mont.) de Bary, is a notorious and devastating plant disease best known for its role in the devastating Irish potato famine, though it can be found worldwide. In addition to affecting potatoes, LB can also affect other members of the Solanaceae, including tomato, nightshade species, eggplant, pepper, and petunia (BECKTELL et al. 2006).

180 165 Late blight can quickly destroy tomato and potato plants, with infection occurring at any time during the plant s life cycle. It can attack any above-ground plant portion, as well as potato tubers and pepper roots. Leaf infection due to LB typically begins at leaflet margins with the appearance of black or dark brown necrotic water-soaked lesions. These lesions may have pale yellow borders that blend into healthy tissues. Under moist conditions, white, fluffy sporangia may develop on the leaf s abaxial side. Eventually, leaflets shrivel and die, and the plant may completely defoliate due to disease. Stem lesions caused by LB typically first appear at the plant s apex or at leaf nodes. The dark brown, soft lesions may subsequently spread down the rest of the stem (SEAMAN et al. 2010). Tomato fruit infected by LB develop brown and greasy lesions at the stem-end and sides of green fruit, rendering the fruit unmarketable. Similarly, infected potato tubers have dry rot and brown or purple depressed lesions, rendering them unmarketable (SEAMAN et al. 2010). Late blight is a notorious and devastating disease due to four characteristics of its causal pathogen, P. infestans. These characteristics are discussed by Fry and Goodwin (1997b) and Foolad et al. (2008). To begin with, low levels of disease are difficult to detect. Thus growers may be initially unaware that their crops are infected. In addition, once LB is detected, it may be too late to save the crop using fungicides, as there is wide-spread fungicide resistance. Nearly all P. infestans isolates are resistant to the systemic metalaxyl fungicides that were in widespread use in the 1970s to control LB (GISI and COHEN 1996). In addition to difficulties detecting LB and fungicide resistance, P. infestans can complete its asexual disease life cycle within five to seven days. Finally, each LB lesions has the potential to produce hundreds of thousands of infectioncausing sporangia per day. The rapid progression of the disease cycle combined with the high potential for dispersal gives P. infestans the potential to destroy crops within seven to ten days of infection. P. infestans potential to rapidly and uncontrollably cause disease and spread disease makes adequate crop protection essential.

181 166 Until the late 1970s, LB was well managed through the use of cultural practices, frequent and timely fungicide application, and growing moderately resistant potato cultivars (FOOLAD et al. 2008). However, LB re-emerged as an important plant disease in Europe in the early 1980s and in North America in the late 1980s. Fry and Goodwin (1997a) discuss the two major reasons why LB s re-emergence is of great concern. First, prior to the 1980s, only the A1 mating type of P. infestans was found outside of Mexico (GALLEGLY and GALINDO 1958). As a heterothallic organism, P. infestans requires the A1 and A2 mating types to be present in order for sexual reproduction to occur (JUDELSON 1997). The A2 mating type was identified in Europe in 1981 and in North America in 1991 (DEAHL et al. 1991; HOHL and ISELIN 1984). The presence of the A1 and A2 mating types together outside of Mexico created opportunity for sexual reproduction to occur and for the generation of new, more aggressive P. infestans isolates. This situation was realized in 1993 with the appearance of the sexually derived US-11 clonal lineage (GAVINO et al. 2000). US-11 was extremely aggressive on tomato crops in the Pacific Northwest, the Northeast, and California (GAVINO et al. 2000). In addition to creating new isolates, P. infestans sexual reproductive cycle produces oospores, which can overwinter in the field, unlike the zoospores produced during asexual reproduction (FOOLAD et al. 2008). If oospores overwinter, they are a source of inoculum for the following growing season (GAVINO et al. 2000). The second concern associated with LB s re-emergence is the appearance of metalaxyl resistant isolates (FRY and GOODWIN 1997a). Although the appearance of metalaxyl resistance nearly coincided with the appearance of the A2 mating type outside of Mexico, there does not appear to be a genetic relationship between the events (GISI and COHEN 1996). Metalaxyl resistance was of great concern because metalaxyl fungicides were the only systemic fungicides available to control LB (GISI and COHEN 1996). Systemic fungicides slow or inhibit disease progress once disease symptoms are apparent. With metalaxyl resistant isolates, disease control

182 167 was futile when disease symptoms were present. To address this problem, metalaxyl fungicides were only made available in combination with at least one other fungicide with a different mode of action, such as mancozeb or chlorothalinol (RUSSELL 2005). In addition, metalaxyl has been replaced by metalaxyl-m (mefenoxam), an optical isomer (RUSSELL 2005). The problems associated with fungicide resistance have made the use of cultivars with genetic LB resistance more attractive and appealing (FOOLAD et al. 2008). In addition to the development of fungicide resistance, frequent fungicide application is undesirable and unsustainable due to high costs and potential hazards to the environment, to individuals applying the fungicide and potentially to consumers. The negative effects associated with fungicide application as well as the potential for new P. infestans isolates make LB control that solely relies on heavy fungicide application undesirable. Using cultivars that are at least partially LB resistant can significantly reduce the number and rate of fungicide application (KIRK et al. 2001; SHTIENBERG et al. 1994). In addition, the greater the genetic resistance, the greater the potential to reduce fungicide use (NAERSTAD et al. 2007). Late Blight Resistance in Tomato Prior to a 1946 LB outbreak of tomato and potato in the U.S., concern for LB s devastating effects focused on potato. Because the 1946 outbreak also affected tomatoes, researchers were prompted to shift their research focus to include tomato, which led to identification of S. pimpinellifolium accessions with varying levels of LB resistance (ALEXANDER 1953; ANDRUS 1946; GALLEGLY and MARVEL 1955). More recent research has led to mapping of major LB resistance genes and QTLs in S. pimpinellifolium, S. habrochaites, and S. pennellii, as discussed below.

183 168 Ph-1, the first reported tomato LB resistance gene, was discovered in S. pimpinellifolium accessions West Virginia 19 and 731 (BONDE and MURPHY 1952; GALLEGLY and MARVEL 1955). Ph-1, originally known as Ph, is a completely dominant gene that confers resistance to P. infestans race T-0, but is susceptible to P. infestans race T-1 (GALLEGLY and MARVEL 1955; RICH et al. 1962; WALTER and CONOVER 1952). In 1962, the LB resistant Rockingham cultivar, containing Ph-1, was released (RICH et al. 1962). Rockingham was subsequently used to map Ph- 1 to the distal end of chromosome 7 using morphological markers (PEIRCE 1971). Currently, P. infestans race T-1 predominates, rendering the LB resistance conferred by Ph-1 of little value in breeding material (FOOLAD et al. 2008). Unlike Ph-1, Ph-2, the second LB resistance gene to be identified, confers resistance to P. infestans race T-1. Ph-2 was discovered in S. pimpinellifolium accession West Virginia 700 (GALLEGLY and MARVEL 1955). Ph-2 confers partial LB resistance, and slows, but does not stop, disease progress (MOREAU et al. 1998). In addition, the resistance conferred by Ph-2 often fails upon exposure to aggressive P. infestans isolates (FOOLAD et al. 2008). The dependence of the resistance on environmental conditions, plant physiological stage, plant organ, and P. infestans isolate has made characterization of Ph-2 difficult (MOREAU et al. 1998). With that said, Ph-2 was mapped to an 8.4 cm interval on the long arm of chromosome 10 between the RFLP markers CP105 and TG233 (MOREAU et al. 1998). Although there have been no recent efforts to finemap or clone Ph-2, it has been introduced into a variety of breeding material (N. Grimsley, CRNS-INRA, pers. comm.) (FOOLAD et al. 2008). Following observations that LB resistance conferred by Ph-1 and Ph-2 was overcome by new P. infestans isolates in Taiwan, Nepal, Indonesia, and the Philippines, further germplasm screenings of S. pimpinellifolium accessions were conducted. These screenings led to identification of S. pimpinellifolium accession L3708 (a.k.a. LA1269 and PI365957) as a new source of LB resistance conferred by a partially dominant gene, named Ph-3 (CHUNWONGSE et

184 169 al. 2002). L3708 conferred resistance to P. infestans isolates that could overcome Ph-1 and Ph-2. Bulked segregant analysis (BSA) was used with amplified fragment length polymorphism (AFLP) markers to identify markers associated with resistance conferred by Ph-3 (CHUNWONGSE et al. 2002). Subsequently, the AFLP markers associated with resistance were mapped to the long arm of chromosome 9 near the RFLP marker TG591a (CHUNWONGSE et al. 2002) using the tomato introgression lines (ILs) developed from a cross between S. lycopersicum cv. M82 and S. pennellii Correl accession LA716 (ESHED and ZAMIR 1995). In addition, Ph-3 has been incorporated into fresh market and processing tomato breeding material in public breeding programs, including Cornell, North Carolina State University, and The Pennsylvania State University (FOOLAD et al. 2008). While developing processing breeding material with Ph-3, Kim and Mutschler (2005) discovered that resistance must be conferred by additional gene(s). Furthermore, P. infestans isolates that overcome Ph-3 were reported as early as 2002 (CHUNWONGSE et al. 2002). In addition to major gene race-specific resistance, race non-specific LB resistance conferred by major genes has also been reported. Irzhansky and Cohen (2006) found evidence that S. pimpinellifolium accession L3707 (PI365951) possesses race non-specific LB resistance conferred by two epistatic genes that are non-allelic to Ph-1, Ph-2, and Ph-3. To date no genes or QTLs for LB resistance have been identified or mapped in this accession. Although all major genes conferring LB resistance have been reported in S. pimpinellifolium, QTLs conferring LB resistance have been reported in S. habrochaites and S. pennellii. QTLs for LB resistance from S. habrochaites accession LA2099 were identified on all twelve tomato chromosomes using composite interval mapping (BROUWER et al. 2004). Using RFLPs common between tomato and potato, Brouwer et al. (2004) compared QTLs detected in their study with previously reported QTLs for LB resistance in potato. They identified common QTLs on chromosomes 3 and 4. Three of the most commonly detected QTLs on chromosomes 4,

185 170 5, and 11 were selected and near isogenic lines (NILs) and subnils were developed to fine-map the QTLs (BROUWER and ST.CLAIR 2004). The initial QTL intervals ranged from 28 to 47 cm and were narrowed to 6.9, 8.8, and 15.1 cm, respectively (BROUWER and ST.CLAIR 2004). The QTL segments also contained undesirable alleles for plant shape, canopy density, maturity, fruit yield, and fruit size, therefore, severe linkage drag prevented these QTLs from being useful in breeding applications (BROUWER and ST.CLAIR 2004). A second study evaluated LB resistance in S. habrochaites accession BGH6902 (ABREU et al. 2008). This results of this study indicated that 28 genes played a role in LB resistance, however, no genes were mapped. A QTL conferring LB resistance from S. pennellii accession LA716 has been mapped to tomato chromosome 6, which was confirmed in the tomato ILs (SMART et al. 2007). The value of this QTL is questionable as in this research LB resistance was defined not as the absence of disease, rather as a relative measure when compared to highly susceptible plants. Despite the considerable time and effort invested into identifying LB resistant material, mapping LB resistance genes, and transferring LB resistance genes to breeding material, few commercially available tomato cultivars have sufficient levels of LB resistance. The Ph-1, Ph-2, and Ph-3 LB resistance genes that have been introduced to commercial cultivars have been overcome by new and aggressive P. infestans strains and the identified QTLs are of little breeding value. In addition, the potential for sexual reproduction to create new P. infestans isolates and the rapid asexual disease cycle give P. infestans a high probability of overcoming LB resistance genes. These issues emphasize the need for new, strong, and durable sources of tomato LB resistance and their introgression into commercial tomato lines and cultivars.

186 171 Prior Research A severe LB outbreak in the northeastern U.S. in summer 2004 prior to my arrival at The Pennsylvania State University prompted research to uncover new sources of tomato LB resistance by The Pennsylvania State University tomato genetics and breeding program. Approximately 70 S. pimpinellifolium accessions, which were previously identified as having potential horticultural value at The Pennsylvania State University, were field screened for LB resistance as a result of a natural LB inoculation. The S. pimpinellifolium accessions were subsequently screened under growth chamber, high tunnel, and greenhouse conditions. Detached leaflets were evaluated in the growth chamber experiments, while whole plants were evaluated in the high tunnel and greenhouse experiments. The growth chamber and greenhouse experiments were replicated with seven P. infestans isolates, all of mating type 2, and belonging to the clonal lineages US-8, US- 13, US-14, and US-15. Several S. pimpinellifolium accessions highly resistant to LB were identified as a result of these screenings. One of these resistant accessions with desirable horticultural characteristics, PSLP153, was selected for further evaluation and genetic characterization. The genetic characterization of the LB resistance conferred by PSLP153 is the focus of my thesis research. As a first step in the characterization of the LB resistance conferred by PSLP153, heritability (h 2 ) for the LB resistance was estimated. Using the parent-progeny correlation method, h 2 was estimated to be 0.68 and 0.76 in two replicated experiments. The moderately-high h 2 value indicates that reasonable selection progress for increasing LB resistance can be achieved. As a result, breeding efforts have been undertaken to introduce the LB resistance conferred by PSLP153 to material in The Pennsylvania State University tomato breeding program. The h 2 for LB resistance conferred by PSLP153 provides insight regarding the nature of the genes

187 172 conferring LB resistance. The moderately-high h 2 value suggests that the resistance may be qualitatively controlled by the action of one or a few genes. To identify regions of the tomato genome associated with the LB resistance conferred by PSLP153, a selective genotyping approach was employed. In a large F 2 population, 986 individuals were evaluated for LB resistance in a controlled greenhouse environment. Twentyfive of the most LB resistant and thirty-one of the most LB susceptible, but surviving, F 2 individuals were selected and genotyped with 153 DNA markers that were polymorphic between the parental lines, NCEBR-2 and PSLP153. The marker allele frequencies were determined for the resistant and susceptible classes. The allele frequency difference between classes was calculated for each marker. Significant differences indicated an association between the marker and LB resistance. Employing this approach, two segments of the tomato genome were associated with LB resistance conferred by PSLP153. The first segment, located on the long arm of chromosome 1, had a minimum size of 23.0 cm and flanking markers 30.9 cm apart. The second segment was located at the distal end of chromosome 10. To confirm the locations conferring LB resistance and proceed toward identifying molecular markers useful for marker-assisted selection (MAS) and cloning the resistance gene(s), more advanced populations were developed. Confirmation of the Late Blight Resistance Segments and Progress Toward Development of Near Isogenic Lines To confirm the segments of the tomato genome associated with LB resistance, estimate gene effects, and to delineate the resistance segments, development of near isogenic lines (NILs) was initiated. Containing a single introgressed fragment from a donor parent, NILs allow gene delineation and fine-mapping as any phenotypic variance is due to the introgressed segment (FEHR 1993). Near isogenic lines have been employed to delineate and fine-map tomato traits,

188 173 including resistance to tobacco mosaic virus (YOUNG et al. 1988), tomato fruit weight (ALPERT and TANKSLEY 1996), tomato fruit shape (VAN DER KNAAP et al. 2004), and LB resistance (BROUWER and ST.CLAIR 2004). Near isogenic lines are developed by making a series of backcrosses with a recurrent parent. The goal of this process is to isolate a small segment contributed by a donor parent. The use of DNA markers can assist in the accuracy and efficiency of NIL development (HOSPITAL and CHARCOSSET 1997; TANKSLEY 1983). To quickly develop NILs, Paterson et al. (1988) recommend making selections for flanking markers surrounding the foreground region and selection against background regions to obtain lines with the desired foreground region and as little of the background regions as possible. Performing background selection can reduce the number of backcross generations required to develop NILs (HOSPITAL and CHARCOSSET 1997). The size of the foreground region delineated depends on the number and spacing of molecular markers within, and flanking the foreground region (PATERSON et al. 1990). Once NILs have been developed, a substitution mapping approach can be used to further delineate regions of interest (BROUWER and ST.CLAIR 2004; PATERSON et al. 1990). In the current research, progress has been made toward developing NILs to confirm the segments of the tomato genome on chromosomes 1 and 10 contributing to LB resistance conferred by PSLP153 in a cultivated tomato background. Foreground selection and background selection were conducted to reduce the number of backcross generations required, while maintaining the foreground segment. In the future, NILs will be used to fine-map the gene(s) conferring LB resistance and identify molecular markers useful for MAS. Near-isogenic lines will also be useful to plant breeders when a desired trait is being introgressed from a wild species. To plant breeders, availability of NILs is advantageous because NILs can greatly assist in elimination of undesired wild background.

189 174 Research Objectives The objectives of this research were: 1) Work toward developing NILs to initiate fine-mapping of the LB resistance genes; 2) Confirm the presence of the LB resistance segments on chromosomes 1 and 10; 3) Estimate the genetic effects of the LB resistance segments. Materials and Methods Plant Materials The parental lines used in this research were NCEBR-2, a S. lycopersicum L. inbred line and PSLP153, an inbred accession of the wild tomato species, S. pimpinellifolium. NCEBR-2, an advanced tomato breeding line developed by R. Gardner at North Carolina State University, Fletcher, NC, combines early blight resistance with desirable horticultural characteristics (GARDNER 1988). However, NCEBR-2 is susceptible to LB. Conversely, PSLP153 is highly resistant to LB, but has undesirable traits, including indeterminate growth habit and small, though red, fruit. Previously, NCEBR-2 (pistillate parent) was hybridized with PSLP153 and F 1 and F 2 progeny were developed (MR Foolad et al. unpubl. data). The F 2, as well as further filial and backcross populations were used for disease screening, marker genotyping, and genetic mapping, as described below. Population Development Nine hundred and eighty-six F 2 individuals were evaluated for LB resistance under controlled greenhouse conditions in the winter of 2006, as described in the previous chapter.

190 175 Using a selective genotyping approach in the F 2 generation, two segments of the tomato genome associated with LB resistance conferred by PSLP153 were identified (as described in the previous chapter). The goal of this research was to work toward isolating the LB resistance segments in a cultivated background to assess the genetic effects and initiate fine-mapping. This was accomplished by developing two further filial generations (F 3 and F 4 ), four backcross populations (F 4 BC 1, F 4 BC 2, F 4 BC 3, F 4 BC 4 ), and an F 4 BC 3 S 1 population. Because molecular marker development and selective genotyping in the F 2 population were conducted alongside further population development, molecular markers were genotyped in the backcross populations as they were identified and genotyped in the F 2 selected individuals. F 3 Families Of the 986 F 2 individuals grown and evaluated for LB resistance, 126 of the most resistant F 2 individuals were self-pollinated to generate F 3 seed. The F 3 families were evaluated under field conditions during summer On May 12, 2006, 18 seeds per family for 126 F 3 families were sown in 72-cell seedling flats. The seedlings were grown under greenhouse conditions until June 22, when the F 3 seedlings were transplanted into a field at The Pennsylvania State University research farm in Rock Springs, PA. The F 3 families were grown to maturity and were visually evaluated on October 3, for horticultural characteristics, including growth habit, plant size, fruit size, shape, and color, yield, and maturity. Selections were made against characteristics from PSLP153, including indeterminate growth habit, very large plant size, and very small fruit size. Selections were made for desirable horticultural characteristics, including determinate growth habit, high yield, and early maturity. Fruits were collected from 13 individuals within F 3 families with desirable characteristics, and self-pollinated F 4 seed was extracted.

191 176 F 4 Families Thirteen F 4 families were evaluated for LB resistance under controlled greenhouse conditions in January, The F 4 families, along with the parental lines (NCEBR-2 and PSLP153), and resistant and susceptible controls were grown in 72-cell seedling flats. Twelve individuals of each F 4 family, parental line, and control were grown. The parental lines and controls were separated into two groups, so that each group had six individuals of each parental line/control. The groups were placed at opposite sides of the greenhouse so that when disease evaluations were conducted, the parental lines/controls could be compared between groups to ensure the inoculation was uniform. Eight-week-old seedlings were used for the inoculation. Inoculum Preparation Rock Springs, an aggressive P. infestans isolate with mating type 2 and belonging to the US-13 clonal lineage, was used as the pathogen source for LB screening. Rock Springs, obtained from S. Kim with the Pennsylvania Department of Agriculture, was originally collected from naturally infected tomato plants growing in Rock Springs, PA during summer To prepare the pathogen for inoculation, Rock Springs was grown on LB susceptible tomato leaflets in 9-cm Petri dishes containing a thin layer of 1.7% water agar. The Petri dishes were placed in a plastic tray with four layers of moistened paper towel on the bottom of the tray to help maintain high humidity. Additionally, the tray was wrapped in a clear plastic bag that was sprayed with distilled water using a spray bottle to further help maintain high humidity. The tray was incubated at temperatures between 14 and 16 C with a 12 h photoperiod provided by cool white fluorescent lamps for 7-10 days in an incubator. After 7-10 days, the tomato leaflets were

192 177 placed in 500 ml of 4 C water in a glass beaker. The water-leaflet mixture was gently shaken using a vortex to dislodge sporangia from the leaflets. The sporangia concentration was estimated by taking the mean of three sporangia counts obtained using a haemacytometer and a light microscope. The sporangia concentration was ~ sporangia/ ml in a 1 L solution. Prior to inoculation, the suspension was chilled at 4 C between 1 and 2 h and the suspension was filtered through cheesecloth to prevent the leaflets from clogging the sprayer. Inoculation, Disease Evaluation and Genotyping On January 10, 2007, seven hours prior to inoculation, black, opaque curtains (blackouts) were lowered to cover the sides and roof of the greenhouse and the lights were turned off. In addition, the temperature was regulated between 16 and 18 C and the relative humidity (RH) kept at 100% using high-pressure foggers and an overhead humidifier. Plastic drop cloths were hung around the greenhouse benches to prevent the plants from being directly exposed to the water from the high-pressure foggers. The over-head humidifier and high-pressure foggers were turned off 30 minutes prior to inoculation. The plastic drop cloths were raised above the plants so that the plants could be sprayed with water using a home-made sprayer. The sprayer consisted of a spray-wand with nozzle connected to a 2 L plastic pop bottle used to hold the inoculum solution. The pop bottle was pressurized using CO 2 regulated from a CO 2 tank. After the plants were sprayed with water, 1 L of inoculum was sprayed uniformly over the plants using the home-made sprayer. Two hours post-inoculation the plastic drop cloths were lowered to cover the plants and the humidity was turned on. The next day, the blackouts were raised. A low temperature and high RH environment was maintained until January 26.

193 178 On January 26, the humidity was turned off and the temperature returned to normal tomato growing conditions. The seedlings were evaluated for LB resistance. Each F 4 family was evaluated as resistant if there was no foliar infection. If there was any foliar infection, the family was considered susceptible and was discarded. Genomic DNA was extracted from each resistant individual using the Qiagen Mini Kit with fresh leaf tissue (Qiagen, Valencia, CA). The resistant individuals were genotyped with SSR308, an SSR marker located on chromosome 1, to identify an F 4 individual homozygous for the PSLP153 allele. At the time that the F 4 families were genotyped, SSR308 was the only PCR-based marker that was identified as associated with LB resistance in the F 2 selected population. Primers were obtained from IDT (Coralville, IA). The primers were resuspended to 100 µm in 1X TE and diluted to 10 µm in nuclease free water. Each 12.5 µl PCR reaction included 2.5 µl of 5X Flexi-Taq buffer, 0.9 µl of 25 µm MgCl 2, 0.3 µl of 10 µm dntps, 0.5 µl of forward primer, 0.5 µl of reverse primer, 0.1 µl of Flexi-Go Taq DNA Polymerase, 2.5 µl of 20 ng/ µl template DNA, and 5.3 µl of nuclease free water. The PCR reactions were carried out using a Bio-Rad PTC100 thermocycler (formerly MJ Research, Hercules, CA) programmed as follows: 1 cycle at 94 C for 5 minutes, 35 cycles of 94 C for 30 s, 50 C for 45 s, and 72 C for 45 s, 72 C for 5 minutes, followed by storage at 4 C. The PCR products were separated using denaturing polyacrylamide gel electrophoresis (PAGE) as described by Creste et al. (2001). One LB resistant F 4 individual that was homozygous for the PSLP153 allele at SSR308 was selected and backcrossed to NCEBR-2 to generate F 4 BC 1 seed. F 4 BC 1 Population Seedlings of 36 F 4 BC 1 individuals, the parental lines, and resistant and susceptible controls were evaluated for LB resistance in April/May The F 4 BC 1 individuals, twelve seedlings of each of the parental lines and control lines were grown in 72-cell seedling flats in an

194 179 isolated and controlled greenhouse. The parental lines and controls were divided into two groups, each with six seedlings of each parental line/control. The groups were placed on opposite ends of the same greenhouse bench so that when the disease evaluations were conducted, the parental lines/controls could be compared between groups to ensure the inoculation was uniform. Eight-week-old plants were inoculated with P. infestans isolate Rock Springs on April 24, 2008, using the procedure described for the F 4 families, except that the sporangia concentration was ~ sporangia/ ml. This inoculation did not lead to development of macroscopic disease symptoms on the NCEBR-2 parental line or susceptible controls, so the plants were re-inoculated on May 14. The concentration of sporangia used for the second inoculation was ~ sporangia/ ml. The F 4 BC 1 individuals, parental lines, and control lines were evaluated for LB foliar infection on May 22 using the same criteria described for the F 4 families. One LB resistant F 4 BC 1 individual with desirable horticultural characteristics was selected and backcrossed to NCEBR-2 (pistillate parent) to generate F 4 BC 2 seed. F 4 BC 2 Population Disease Evaluation Seedlings of 72 F 4 BC 2 individuals, the parental lines, and resistant and susceptible controls were evaluated for LB resistance in October The F 4 BC 2 individuals and twelve seedlings of each of the parental lines and controls were grown in 72-cell seedling flats in an isolated and controlled greenhouse. The parental lines and controls were separated into two groups, each with six seedlings of each parental line/control. The groups were placed at opposite ends of the same greenhouse bench so that when the disease evaluations were conducted, the parental lines/controls could be compared between groups to ensure uniform inoculation. On

195 180 October 7, 2008, six-week-old seedlings were inoculated with P. infestans isolate Rock Springs using the same procedure described for the F 4 families. The sporangia concentration was ~ sporangia/ ml. The F 4 BC 2 individuals, parental lines, and control lines were evaluated for LB foliar infection on October 28. Individuals with disease severity of 15% or less were considered resistant. DNA Extraction Genomic DNA was extracted from the resistant F 4 BC 2 individuals based on a method that was developed by Matt Kinkade (Penn State Tomato Program) and based on the methods described by Collard et al. (2007) and Wang et al. (1993). A leaf punch from each individual was collected from each resistant individual in a 1.5 ml microcentrifuge tube and kept on ice until the punches could be stored at -80 C. To extract the DNA, 80 µl of 0.5 M NaOH was added to each microcentrifuge tube. The leaf tissue was ground using a sterile, plastic micropestle until there were no longer any clumps of tissue present. The mixture was spun for approximately 30 s using a tap centrifuge. The supernatant was transferred to a new 1.5 ml microcentrifuge tube containing 420 µl of 0.1 M Tris buffer (ph 8.0) and used as a source of genomic DNA for molecular marker analysis. Molecular Marker Genotyping All of the resistant F 4 BC 2 individuals were first genotyped with four PCR-based markers that had been associated with LB resistance in the F 2 population (foreground markers). There were two foreground markers located on chromosome 1 (a CAPS marker, U and an SSR marker, SSR308) and two foreground markers located on chromosome 10 (SSR markers SSR74

196 181 and SSR223). Genomic DNA of the resistant individuals was first amplified with the U PCR-primers in a 25 µl reaction volume that included: 12.5 µl of 2X GoTaq Master Mix, 1 µl of U forward primer, 1µL of U reverse primer, 5 µl of 10 ng/µl template DNA, and 5.5 µl of nuclease free water. The PCR reactions were carried out using Bio-Rad PTC100 thermocyclers (formerly MJ Research, Hercules, CA) and Bio-Rad C1000 thermocyclers (Hercules, CA) programmed as follows: 1 cycle at 94 C for 3 minutes, 35 cycles of 94 C for 60 s, 55 C for 60 s, and 72 C for 2 min, 72 C for 5 minutes, followed by storage at 4 C. Following PCR amplification, the PCR products were digested with MseI (New England Biolabs, Ipswich, MA) according to the manufacturer s instructions. The digestion products were separated on 2% agarose gel. The gel was prestained with ethidium bromide (1 µl of 10 mg/ ml ethidium bromide per 100 ml of agarose gel). The resistant individuals were also genotyped with three SSR markers: SSR74, SSR224, and SSR308. Genomic DNA of the resistant individuals was amplified with the SSR primers in a 20 µl reaction volume that included: 10 µl of 2X GoTaq Master Mix, 0.8 µl of forward primer, 0.8 µl of reverse primer, 5 µl of 10 ng/µl template DNA, and 3.4 µl of nuclease free water. The PCR reactions were carried out using Bio-Rad PTC100 thermocyclers (formerly MJ Research, Hercules, CA) and Bio-Rad C1000 thermocyclers (Hercules, CA) programmed as follows: 1 cycle at 94 C for 5 minutes, 35 cycles of 94 C for 30 s, 50 C for 45 s, and 72 C for 45 s, 72 C for 5 minutes, followed by storage at 4 C. The PCR products were separated using 6% non-denaturing PAGE run on a Mega-Gel apparatus (CBS Scientific, Delmar, CA). The protocol was developed by Matt Kinkade based on Wang et al. (2003) and the manufacturer s instructions. Briefly, 10 µl of each samples was separated using 6% non-denaturing PAGE run at 200 V between four and five hours. To stain the gel, 50 µl of 10 mg/ ml ethidium bromide was added to the bottom reservoir of the Mega-Gel apparatus.

197 182 Resistant individuals that were heterozygous at the four foreground loci were identified and selected for background genotyping. At the time this genotyping was conducted, 10 CAPS markers and 13 SSR markers had been identified as PCR-based background markers using the selective genotyping method in the F 2 population, so the aforementioned resistant individuals were genotyped at these marker loci (Table 4-1). These markers did not provide complete coverage of the genome, but they were the only PCR-based markers that had been genotyped in F 2 population. For the CAPS markers, the PCR products were digested with the restriction enzyme listed in Table 4-1 according to the manufacturer s instructions (New England Biolabs, Ipswich, MA and Promega, Madison, WI). Table 4-1. SSR and CAPS background markers genotyped in resistant F 4 BC 2 individuals that were heterozygous at four foreground loci. Markers were assigned as foreground or background markers using a selective genotyping approach in an F 2 population. Marker Name Marker Type Chromosome Restriction Enzyme COSOH47 CAPS 1 BstUI SSR266 SSR 1 NONE SSR134 SSR 1 NONE cled27e12ca CAPS 1 HinFI SSR40 SSR 2 NONE SSR111 SSR 3 NONE SSR22 SSR 3 NONE SSR320 SSR 3 NONE SSR601 SSR 3 NONE SSR603 SSR 4 NONE LEOH10 CAPS 4 BsaJI SSR115 SSR 5 NONE COSOH73 CAPS 5 AluI SP CAPS 6 BstNI LEOH1.1 CAPS 7 Tsp45I SSR45 SSR 7 NONE clen14f9ca CAPS 7 MseI clex10n16ca CAPS 9 TaqI clpt4c24ca CAPS 9 Hpych4V SSR301 SSR 10 NONE SSR526 SSR 10 NONE

198 183 SSR20 SSR 12 NONE CT100CA CAPS 12 AflIII Two resistant F 4 BC 2 individuals that were heterozygous at the foreground loci and that had the highest NCEBR-2 background contribution were selected and backcrossed to NCEBR-2 to generate F 4 BC 3 seed. In addition, the selected individuals were genotyped with 11 additional background SSR markers (Table 4-2). The additional markers were genotyped in the F 2 selected individuals and identified as background markers after backcrosses with NCEBR-2 were initiated and before the F 4 BC 3 individuals were genotyped. Therefore, the two F 4 BC 2 individuals that were backcrossed to NCEBR-2 were genotyped at four foreground loci and 34 background loci. Graphical genotypes for the two selected individuals were constructed using GGT2 Graphical Genotypes software (VAN BERLOO 2008). Although crosses were made with two F 4 BC 2 individuals, only the F 4 BC 3 population derived from the one F 4 BC 2 individual with the highest NCEBR-2 background contribution was grown and used for further studies. Table 4-2. Background SSR markers that were genotyped in the F 4 BC 2 individuals that were selected for backcrossing to NCEBR-2. Markers were assigned as foreground or background markers using a selective genotyping approach in an F 2 population. Marker Name Chromosome SSR92 1 SSRP SSR86 3 SSRB SSRP SSR14 3 SSRM11 7 SSR63 8 SSRP SSRB10A 10 SSRB10D 10

199 184 F 4 BC 3 Population DNA Extraction In spring 2009, seedlings of 300 F 4 BC 3 individuals, the parental lines, and resistant and susceptible controls were evaluated for LB resistance. Genomic DNA was extracted from a leaf punch of tissue collected from each F 4 BC 3 individual, as well as NCEBR-2 and PSLP153 prior to LB evaluation. Tissue was collected into 96-well PCR plates kept on ice. 80 µl of 0.5 M NaOH and a sterile magnetic bead was added to each well. The tissue was lysed for 1 min at frequency 1/30 s using a Qiagen Tissue Lyser (Valencia, CA) at The Pennsylvania State University s Genomics Core Facility (University Park, PA). The plate was rotated and the tissue was lysed for an additional 1 min at frequency 1/30 s. Each plate was briefly centrifuged and 40 µl of lysate was added to 460 µl of 0.1 M Tris (ph 8.0) in a new 96-well plate. Molecular Marker Genotyping The 300 F 4 BC 3 individuals were genotyped with three DNA markers associated with LB resistance (foreground markers) on chromosomes 1 (CAPS marker U217757) and 10 (SSR markers SSR74 and SSR223). Although a second SSR marker, SSR308, was used as a foreground marker in the F 4 BC 2 generation, DNA quality in the F 4 BC 3 generation was not sufficient to allow genotyping with SSR308. The genotyping procedures were the same as those used to genotype the F 4 BC 2 resistant individuals.

200 185 Disease Evaluation In spring 2009, seedlings of 300 F 4 BC 3 individuals, the parental lines, and resistant and susceptible controls were evaluated for LB resistance. The F 4 BC 3 individuals and twelve seedlings of each of the parental lines and controls were grown in 72 cell seedling flats in an isolated and controlled greenhouse. The parental lines and control lines were divided into two groups, each with six seedlings of each parental line/control. The groups were placed on opposite ends of each greenhouse bench so that when the disease evaluations were conducted, the parental lines/ controls could be compared between groups to ensure the inoculation was uniform. On June 12, 2009, ten-and-a-half week old seedlings were inoculated with P. infestans isolate Rock Springs using the same procedures described for the F 4 families. The sporangia concentration was ~ sporangia/ ml. The F 4 BC 3 individuals, parental lines, and control lines were evaluated for LB foliar infection on June 18 using the same criteria described for the F 4 BC 2 individuals by three observers. Data Analysis Genotype frequencies of the foreground DNA markers genotyped in the F 4 BC 3 individuals were calculated and tested for significant deviation from the expected 1:1 segregation pattern for the CAPS marker on chromosome 1 (U217757) and for the SSR markers on chromosome 10 (SSR74 and SSR223) using χ 2 goodness-of-fit analysis. Subsequently, the expected 1:1:1:1 Mendelian genotype segregation pattern for two marker loci was tested using χ 2 goodness-of-fit analysis. Following genotyping at the foreground loci and disease evaluation, a 2x2 contigency table was constructed and a χ 2 goodness-of-fit analysis was conducted to determine whether or not there was a relationship between disease phenotype and genotype.

201 186 Resistant Individuals Genotyping The F 4 BC 3 resistant individuals that were heterozygous at the foreground regions were genotyped with eight SSR markers located in background regions (Table 4-3). SSR markers SSR301, SSR526, and SSR603 were genotyped as the F 4 BC 2 progenitor was heterozygous at these marker loci. The F 4 BC 3 individuals were genotyped with the remaining five SSR markers because they had been genotyped in the F 2 population after genotyping in the F 4 BC 2 generation was complete. The reaction conditions and PCR protocol were the same as described for the F 4 BC 2 resistant individuals. Three F 4 BC 3 resistant individuals that were homozygous for NCEBR-2 at these eight loci were selected and backcrossed to NCEBR-2 (pistillate parent) and allowed to self-pollinate to develop three F 4 BC 4 populations and three F 4 BC 3 S 1 populations, respectively. The three selected individuals (F 4 BC 3-3, F 4 BC 3-28, F 4 BC 3-113) were also subjected to further genotyping with 74 additional SSR markers (Table 4-4). To obtain higher quality DNA for these three individuals, DNA was extracted using Qiagen Mini Kits with fresh leaf tissue (Valencia, CA). The markers were genotyped as they were developed and genotyped in the selected F 2 population, with the exception of SSR308. SSR308 had been previously genotyped in the F 2 population, however, DNA quality obtained from the first time DNA was extraction from the F 4 BC 3 individuals was not sufficient to genotype the individuals with SSR308. The three selected F 4 BC 3 individuals were genotyped with 84 markers; nine foreground markers and seventy-five background markers. Graphical genotypes for the three selected F 4 BC 3 individuals were constructed using GGT Graphical Genotypes 2.0 Software (VAN BERLOO 2008). Although three F 4 BC 4 populations and F 4 BC 3 S 1 populations were developed, only two F 4 BC 4 populations and two F 4 BC 3 S 1 populations were grown (F 4 BC 4-28, F 4 BC 4-113; F 4 BC 3 S 1-28, F 4 BC 3 S 1-113). Table 4-3. Background SSR markers that were genotyped in the resistant F 4 BC 3 individuals. Marker Name Chromosome SSRM8 1

202 187 SSR603 4 SSR38 8 SSR244 8 SSR SSRB10A 10 SSRB10D 10 SSR Table 4-4. Additional SSR markers that were genotyped in the three F 4 BC 3 individuals that were selected for backcrossing to NCEBR-2. F indicates that a marker was located in the foreground and B indicates that a marker was located in the background. Marker Name Chromosome Foreground/Background SSRM10 1 B SSRB1BD 1 B TMA B TOM202 1 B SSRB1BL 1 B TMA B TMA B SSRB1AM 1 B SSRB1AY 1 B SSR75 1 B SSRW8 1 B SSRW11 1 F SSRW22 1 F SSRW23 1 F SSRW25 1 F SSR308 1 F SSRB1CM 1 B SSRB1CB 1 B SSRB2C 2 B SSRB2BC 2 B SSRB2BV 2 B SSRB2CM 2 B SSRB2BH 2 B SSRB2CE 2 B SSRB2CQ 2 B SSRB2S 2 B SSRB2BX 2 B

203 SSRB2BW 2 B SSRB2AV 2 B SSRB B SSRP B SSRB3Z 3 B SSRB3O 3 B SSRB3G 3 B SSRP B SSRB4AO 4 B SSRB4W 4 B SSRB4AC 4 B SSRB4K 4 B SSRB4R 4 B SSRB5E 5 B SSRB5M 5 B SSR48 6 B SSR47 6 B SSRB6S 6 B SSRB6A 6 B SSRB6M 6 B SSRB6G 6 B SSRM11 7 B SSR344 8 B SSRB8B 8 B SSRB8D 8 B SSR38 8 B SSR244 8 B SSRP B SSR383 9 B SSR237 9 B SSRM12 9 B SSRM13 9 B SSRM36 9 B SSRB10M 10 B SSR B SSRB10A 10 B SSRB10D 10 B TMA B SSRB10J 10 B TMB B 188

204 189 SSR B TMA B LECOV15 10 B TMC F SSRB11F 11 B SSRB11G 11 B SSRM7 11 B SSRB12G 12 B F 4 BC 4 and F 4 BC 3 S 1 Populations Backcross and self-seeds of two of the three F 4 BC 3 individuals (F 4 BC 3-28, F 4 BC 3-113), as well as the parental lines and the F 1 were sown on November 23, The seeds were sown in 72 cell seedling flats. From each of the parental lines and F 1, 12 individuals were grown. From the first F 4 BC 3 individual, F 4 BC 3-28, 252 backcross progeny and 372 self progeny were grown. From the second F 4 BC 3 individual, F 4 BC 3-113, 120 backcross progeny and 372 self progeny were grown. In total, 1116 F 4 BC 4 and F 4 BC 3 S 1 progeny were grown. DNA Extraction Genomic DNA was extracted from a leaf punch of tissue collected from each F 4 BC 4 / F 4 BC 3 S 1 individual, as well as NCEBR-2 and PSLP153 prior to LB evaluation. Tissue was collected into 96-well plates kept on ice. 80 µl of 0.5 M NaOH and a sterile magnetic bead was added to each well. The tissue was lysed for 1 min at frequency 1/30 s using a Qiagen Tissue Lyser (Valencia, CA) at The Pennsylvania State University s Genomics Facility (University Park, PA). The plate was rotated and the tissue was lysed for an additional 1 min at frequency 1/30 s. Each plate was briefly centrifuged and 40 µl of lysate was added to 460 µl of 0.1 M Tris (ph 8.0) in a new 96-well plate.

205 190 Disease Evaluation Due to an unfortunate miscommunication, the seedlings accidentally went un-watered between December 24 th and 28 th. On December 28 th, the seedlings were then thoroughly watered and the dead seedlings were removed. The seedlings were allowed to recover until January 22, 2010, when the seedlings were inoculated with P. infestans isolate Rock Springs using the same procedures described for the F 4 families. The sporangia concentration was ~ sporangia/ ml. On January 29 th, the parental lines, F 1, and F 4 BC 4 and F 4 BC 3 S 1 seedlings were evaluated for disease severity based on the severity of the foliage infection on a scale from 0 to 100 by two observers. A score of 0 indicated there was no foliar infection, while a score of 100 indicated that the plant had completely defoliated due to LB infection. Molecular Marker Genotyping The F 4 BC 4 /F 4 BC 3 S 1 individuals not killed due to lack of water were genotyped with a maximum of eleven DNA markers. All individuals were genotyped with four DNA markers on chromosome 1 (SSRW25, SSRW39, SSRW43, and U217757). Markers SSRW25, SSRW39 and SSRW43 were genotyped in the F 2 population after genotyping in the F 4 BC 3 generation was complete (see previous chapter). Markers SSRW25 and U were associated with LB resistance (see previous chapter). All individuals were also genotyped with four SSR markers on chromosome 10 (SSRB10AQ, TMC0040, SSR74, and SSR223). Markers SSRB10AQ and TMC0040 were genotyped in the F 2 population after genotyping in the F 4 BC 3 population was complete (see previous chapter). Markers TMC0040, SSR74, and SSR223 were associated with LB resistance (see previous chapter). The F 4 BC 4-28 and F 4 BC 3 S 1-28 individuals were genotyped with two SSRs located in a background region of chromosome 2 (SSRB2S and SSRB2BC) as

206 191 these markers were heterozygous in F 4 BC The F 4 BC and F 4 BC 3 S individuals were genotyped with LECOV15, an SSR marker located in a background region of chromosome 10 (see previous chapter) as LECOV15 was heterozygous in F 4 BC All of the genotyping was conducted using the same procedures described for the F 4 BC 2 LB resistant individuals. There was concern that the unintentional absence of watering from December may have interfered with accurate disease phenotyping of the F 4 BC 4 /F 4 BC 3 S 1 individuals not killed due to lack of water. To try to compensate for this possibility, 33 backcross progeny and 211 selfprogeny of F 4 BC were grown in 72-cell seedling flats. DNA extraction, genotyping, and disease evaluation were performed in the same manner described for the F 4 BC 4 /F 4 BC 3 S 1 populations. On February 23, 2010, seven-and-a-half-week old seedlings were inoculated with P. infestans isolate Rock Springs. The sporangia concentration was ~ sporangia/ ml. The seedlings were evaluated for LB resistance on March 5. Data Analysis Genotype frequencies of the DNA markers genotyped in the F 4 BC 3 S 1 individuals were calculated and tested for significant deviation from the expected 1:2:1 Mendelian genotype segregation pattern using χ 2 goodness-of-fit analysis. The Ryan-Joiner test was performed using Minitab 15 statistical software (Minitab, State College, PA) to assess whether or not disease severity was normally distributed in the F 4 BC 4 /F 4 BC 3 S 1 populations. In the F 4 BC 3 S 1 population, QTL analysis was performed using the R-QTL package in the R version 2.1 software ( The composite interval mapping (CIM) function using the default parameters was used to identify potential QTLs. To determine the genome-wide LOD threshold for significance (α = 0.01), a permutation test with 1000 permutations was

207 conducted. The LOD threshold was The fitqtl function was used to estimate the genetic effects of the identified QTL. 192 Results F 3 Families One hundred and twenty-six F 3 families were evaluated for horticultural characteristics under field conditions in summer Thirteen individuals from eleven F 3 families with desired characteristics were selected for further evaluation. All selected families had red fruit and acceptable yield. None of the eleven selected F 3 families were fixed for indeterminate growth habit; six were fixed for determinate growth habit and five were segregating for growth habit. Furthermore, six families were fixed for jointless pedicel, two were fixed for jointed pedicel, and three were segregating for jointed/jointless pedicel. Self-progeny (F 4 families) of the 13 selected F 3 individuals were evaluated for LB resistance, as described below. F 4 Families Thirteen F 4 families, each with twelve individuals, were evaluated for resistance to LB in a controlled greenhouse in January Seven of the thirteen F 4 families were resistant to LB. Each of the twelve individuals from each resistant family was genotyped with SSR308, the only marker locus associated with LB resistance at the time. Four families were segregating at the SSR308 locus and three families were homozygous for the PSLP153 allele. One individual that was homozygous for the PSLP153 allele was selected and backcrossed to NCEBR-2, the recurrent parent, to generate F 4 BC 1 seed.

208 193 F 4 BC 1 Population Thirty-six F 4 BC 1 individuals were evaluated for resistance to LB. All individuals were resistant to LB. One F 4 BC 1 individual was selected and backcrossed to NCEBR-2 to generate F 4 BC 2 seed. F 4 BC 2 Population Seventy-two F 4 BC 2 individuals were evaluated for resistance to LB. Seventeen individuals (24%) were resistant to LB. The resistant individuals were subjected to marker genotyping with the four DNA markers associated with LB resistance at the time this population was evaluated (U217757, SSR74, SSR223, and SSR308). All of the resistant individuals were heterozygous at the SSR74 and SSR223 loci, located on chromosome 10. However, only six (35%) of the resistant F 4 BC 2 individuals were heterozygous at all four DNA marker loci associated with LB resistance. The six individuals that were resistant to LB and heterozygous at the four foreground loci were selected for marker genotyping with 23 background markers that provided very limited coverage of the background regions. The known NCEBR-2 background contribution in the six resistant individuals ranged from 67% to 89%, with an average NCEBR-2 contribution of 71%. The individual with 89% background contribution from NCEBR-2 was selected for further backcrossing. This individual had known background contributions from PSLP153 on chromosomes 4 and 10 (Figure 4-1). However, it must be noted that there was incomplete and uneven background coverage of the tomato genome, as designated by the green segments of figure 4-1. For example, at the time these individuals were genotyped, there were no PCR-based markers located on chromosome 11, so there was no genotypic information for chromosome 11 for the F 4 BC 2 individuals.

209 194 Figure 4-1. Graphical genotype of the F 4 BC 2 individual selected for further backcrossing to NCEBR-2. The red segments of the chromosomes indicate homozygosity for NCEBR-2, the light blue segments of the chromosomes indicate heterozygosity, and the green segments of the chromosomes indicate that the genotype is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The purple boxes indicate segments of the genome associated with late blight resistance and the black boxes indicate background regions that are heterozygous. F 4 BC 3 Population Three hundred F 4 BC 3 individuals were genotyped with three DNA markers associated with LB resistance on chromosomes 1 (U217757) and 10 (SSR74 and SSR223). The F 4 BC 3 individuals were also evaluated under controlled greenhouse conditions for their response to LB. Of the 300 individuals evaluated, 293 were successfully genotyped and phenotyped. There were

210 195 three recombination events detected between SSR74 and SSR223. In addition, four individuals could not be genotyped at the marker loci on chromosomes 1 and/or 10. These seven individuals were not included in the analysis. On chromosome 1, U was segregating normally and on chromosome 10, SSR74 and SSR223 were segregating normally (p>0.05) (Table 4-5). When the joint segregation of U and SSR74/SSR223 was considered, the loci were segregating independently (p>0.05) (Table 4-6). Table 4-5. Chi-square calculations to test 1:1 gene segregation pattern for U and SSR74/SSR223. U is located on chromosome 1 and SSR74 and SSR223 are located on chromosome 10. NC represents NCEBR-2. U Observed Expected χ 2 Heterozygous Homozygous NC Total SSR74/SSR223 Observed Expected χ 2 Heterozygous Homozygous NC Total Table 4-6. Genotypic data at the foreground loci for the F 4 BC 3 individuals and phenotype with respect to LB resistance. U is located on chromosome 1 and SSR74 and SSR223 are located on chromosome 10. NC represents NCEBR-2. U SSR74/SSR223 Number of Resistant Individuals Number of Susceptible Individuals Heterozygous Heterozygous Homozygous NC Heterozygous Heterozygous Homozygous NC Homozygous NC Homozygous NC Total Total A contingency table was constructed and analyzed using χ 2 goodness-of-fit analysis to determine whether or not phenotype and genotype at the foreground loci were independent (Table 4-6). Phenotype and genotype at the foreground loci were not independent (χ 2 = 137.3, p<0.001).

211 196 Of the 293 individuals evaluated for LB resistance, 110 (38%) were resistant to LB and 183 (62%) were susceptible to LB (Table 4-6). Of the 110 resistant individuals, 102 (93%) were heterozygous at the foreground loci on chromosome 10 and 62 (56%) were heterozygous at all foreground loci. Of the 183 susceptible individuals, 142 (78%) were homozygous for the NCEBR-2 allele at the foreground loci on chromosome 10 and 71 (39%) were homozygous for the NCEBR-2 allele at all foreground loci. These results indicate that there was an overabundance of resistant individuals that were heterozygous at the foreground loci on chromosome 10 and an overabundance of susceptible individuals that were homozygous for the susceptible allele (NCEBR-2) at the foreground loci on chromosome 10. The 62 individuals that were resistant to LB and heterozygous at all foreground loci were selected for further genotyping with eight SSR markers to obtain an individual with minimal background contribution from PSLP153. The eight background markers were located on chromosomes 1, 4, 8, and 10. The resistant individuals were genotyped with these markers because five of the eight markers were located in background regions of chromosomes 1 and 10. Other regions of chromosomes 1 and 10 were associated with LB resistance. The other three SSR markers were selected because they were unsuccessfully genotyped in the F 4 BC 2 individuals. Three F 4 BC 3 individuals that were homozygous for NCEBR-2 at these eight background loci were selected for further backcrossing to NCEBR-2 and were allowed to self-pollinate to develop three F 4 BC 4 (F 4 BC 4-3, 28, 113) populations and three F 4 BC 3 S 1 (F 4 BC 3 S 1-3, 28, 113) populations. The three selected individuals were also subjected to further genotyping with 74 additional SSR markers as the markers were developed and mapped in the F 2 selected population (see previous chapter). Six of the additional markers were located in foreground regions; five were located on chromosome 1 and the sixth marker was located on chromosome 10. The other 68 markers were located in background regions on all twelve tomato chromosomes.

212 197 Graphical genotypes of the three individuals selected for self-pollination and backcrossing were constructed (Figures 4 2, 3). All individuals were heterozygous at all of the foreground loci on chromosome 10 and two of the three individuals (F 4 BC 3-3, 28) were heterozygous at all of the foreground loci on chromosome 1. The first individual, F 4 BC 3-3, was also heterozygous at two background loci on chromosome 1 and one background locus on chromosome 10. The second individual, F 4 BC 3-28, was homozygous for the NCEBR-2 allele at all background loci. The third individual, F 4 BC 3-113, was homozygous for the NCEBR-2 allele at three of the five foreground loci on chromosome 1 and was heterozygous at one background locus on chromosome 10. Otherwise, the three individuals were homozygous for NCEBR-2 at all loci successfully genotyped.

213 Figure 4-2. Chromosome 1 graphical genotypes of the three F 4 BC 3 individuals selected for further backcrossing to NCEBR-2 and for self-pollination. The red segments indicate homozygosity for NCEBR-2, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment. 198

214 199 Figure 4-3. Chromosome 10 graphical genotypes of the three F 4 BC 3 individuals selected for further backcrossing to NCEBR-2 and for self-pollination. The red segments indicate homozygosity for NCEBR-2, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment. F 4 BC 3 S 1 Populations Although three F 4 BC 3 S 1 populations were developed, only two (F 4 BC 3 S 1-28, 113) were grown and evaluated. Unintentionally, the F 4 BC 3 S 1-28/113 populations that were evaluated for LB resistance in January 2010 were not watered from December 24-28, The populations were segregating for disease severity and had a mean disease severity of 79.0 ± 22.6% and a

215 Frequency 200 median disease severity of 90% (Figure 4-4). Twenty-three F 4 BC 3 S 1-28/113 individuals (6%) had disease severity scores less than 25%; 44 individuals (11%) had disease severity less than 50%; 46 individuals (11%) had disease severity between 50 and 75%, and 314 individuals (77%) had disease severity greater than 75%. Thus, disease severity was skewed toward high disease severity. This phenotypic data were deemed unreliable (see Discussion), so these individuals were not included in further analyses Disease Severity (%) Figure 4-4. Frequency distribution of LB disease severity of F 4 BC 3 S 1-28/113 individuals (n=406) evaluated for LB resistance in January Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions. Additional F 4 BC 3 S individuals were grown to replace the original F 4 BC 3 S 1-28 and F 4 BC 3 S populations. The F 4 BC 3 S population evaluated for LB resistance in March, 2010 was segregating for LB resistance (Figure 4-5). The mean disease severity was 57.2 ± 31.3%. The result of the Ryan-Joiner test for normality indicated that disease severity of the

216 Frequency 201 F 4 BC 3 S population was not normally distributed (p<0.01). Thirty-eight of the 206 F 4 BC 3 S individuals (18%) had disease severity less than 25%; 90 individuals (44%) had disease severity of 50% or less; 37 individuals (18%) had disease severity between 50 and 75%; and 84 individuals (41%) had disease severity greater than 75% Disease Severity (%) Figure 4-5. Frequency distribution of LB disease severity of F 4 BC 3 S individuals (n=206) evaluated for LB resistance in March Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions. The new F 4 BC 3 S population was genotyped with eight DNA markers: two background SSRs on chromosome 1 (SSRW39, SSRW43), two background SSRs on chromosome 10 (LECOV15 and SSRB10AQ), one foreground SSRs on chromosome 1 (SSRW25), one foreground CAPS marker on chromosome 1 (U217757), and three foreground SSRs on chromosome 10 (TMC0040, SSR74, and SSR223) (see previous chapter). All markers were segregating in the population, except SSRW25 (chromosome 1), which was fixed for the

217 202 NCEBR-2 allele. The seven segregating markers all segregated in a 1:2:1 Mendelian ratio (p>0.05). Graphical genotypes were constructed for the eight individuals with disease severity less 10% or less and for the 17 individuals with disease severity 100% (Figures 4-6, 7, 8, 9). All individuals with disease severity 10% or less were: heterozygous or homozygous for the PSLP153 allele at the U locus (associated with LB resistance on chromosome 1), homozygous for the PSLP153 allele at the SSR74 and SSR223 loci (associated with resistance on chromosome 10), and were heterozygous or homozygous for the PSLP153 allele at the TMC0040 locus (associated with resistance on chromosome 10) (Figure 4-6, 4-7). Conversely, 11 of the 17 individuals with disease severity 100% were heterozygous or homozygous for the PSLP153 allele at the U locus (associated with resistance on chromosome 1) (Figure 4-8). Furthermore, 15 of the 17 individuals with disease severity 100% were homozygous for the NCEBR-2 allele at the SSR74 and SSR223 loci (associated with resistance on chromosome 10) (Figure 4-9).

218 Figure 4-6. Chromosome 1 graphical genotypes of F 4 BC 3 S individuals with late blight disease severity 10% or less. The red segments indicate homozygosity for NCEBR-2, the navy segments indicate homozygosity for PSLP153, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment. 203

219 Figure 4-7. Chromosome 10 graphical genotypes of the F 4 BC 3 S individuals with disease severity 10% or less. The red segments indicate homozygosity for NCEBR-2, the navy segments indicate homozygosity for PSLP153, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment. 204

220 Figure 4-8. Chromosome 1 graphical genotypes of F 4 BC 3 S individuals with late blight disease severity 100%. The red segments indicate homozygosity for NCEBR-2, the navy segments indicate homozygosity for PSLP153, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment. 205

221 206 Figure 4-9. Chromosome 10 graphical genotypes of F 4 BC 3 S individuals with disease severity 100%. The red segments indicate homozygosity for NCEBR-2, the navy segments indicate homozygosity for PSLP153, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment. Late blight disease severity depended on the genotype of the SSR74/SSR223 marker loci on chromosome 10 as determined by performing a one-way ANOVA (p<0.001) (Figure 4-10). These loci were previously associated with LB resistance using a selective genotyping approach in an F 2 population (see previous chapter). Average disease severity was lowest in individuals homozygous for the PSLP153 allele (30.9 ± 21.8%), intermediate in heterozygous individuals (57.5 ± 26.1%), and highest in individuals homozygous for the NCEBR-2 allele (92.4 ± 10.5%) (Figure 4-10). Individuals homozygous for the NCEBR-2 allele had disease severity scores that were skewed toward higher disease severity, while individuals homozygous for the PSLP153

222 Frequency allele had disease severity scores that were skewed toward lower disease severity (Figure 4-10). None of the distributions were normally distributed (p<0.05) Homozygous for NCEBR-2 Homozygous for PSLP Heterozygous Figure Disease severity (percent defoliation) of F 4 BC 3 S individuals separated by genotype at the SSR74/SSR223 marker loci on chromosome 10. Using a composite interval mapping approach with stepwise regression, a QTL conferring LB resistance was detected on chromosome 10 (LOD 31.3). This QTL explained 50.7% of the phenotypic variation in disease severity. In addition, the QTL had an additive effect on disease severity of 35.7% and a dominance effect on disease severity of 5.2%. No QTLs affecting LB disease severity were detected on chromosome 1.

223 Frequency 208 F 4 BC 4 Populations Although three F 4 BC 4 populations (F 4 BC 4-3, 28, 113) were developed, only two (F 4 BC 4-28, 113) were grown and evaluated. Unintentionally, the F 4 BC 4-28/113 populations that were evaluated for LB resistance in January 2010 were not watered from December 24-28, The populations were segregating for disease severity and had a mean disease severity of 88.6 ± 11.7% (Figure 4-11). No F 4 BC 4-28/113 individuals had disease severity less than 25%; 7 individuals (3%) had disease severity less than 50%; 15 individuals (5.4%) had disease severity between 50 and 75%; and 255 individuals (92%) had disease severity greater than 75%. This phenotypic data were deemed unreliable (see Discussion), so these individuals were not included in further analyses Disease Severity (%) Figure Frequency distribution of LB disease severity of F 4 BC 4-28/113 individuals (n=277) evaluated for LB resistance in January Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions.

224 Frequency 209 Additional F 4 BC individuals were grown to replace the original F 4 BC 4-28/113 populations. The F 4 BC population evaluated for LB resistance in March, 2010 was segregating for LB resistance (Figure 4-12). The mean disease severity was 68.6 ± 33.6%. Of the 39 F 4 BC 4 individuals, 8(21%) had disease severity 25% or less; 11 (28%) had disease severity less than 50%; 3 (8%) had disease severity between 50 and 75%; and 23 (59%) had disease severity greater than 75% Disease Severity (%) Figure Frequency distribution of LB disease severity of F 4 BC individuals (n=39) evaluated for LB resistance in March Disease severity was measured as percent defoliation of whole plants due to late blight infection under controlled greenhouse conditions. The F 4 BC population was genotyped with eight DNA markers: two background SSRs on chromosome 1 (SSRW39 and SSRW43), two background SSRs on chromosome 10 (LECOV15 and SSRB10AQ), one foreground SSRs on chromosome 1 (SSRW25), one

225 210 foreground CAPS marker on chromosome 1 (U217757), and three foreground SSRs on chromosome 10 (TMC0040, SSR74, and SSR223). All markers were segregating except SSRW25, which was fixed for the NCEBR-2 allele. The seven segregating markers segregated in a 1:1 Mendelian ratio. Late blight disease severity depended on the genotype of the SSR74/SSR223 marker loci on chromosome 10 as determined by performing a one-way ANOVA (p<0.001) (Figure 4-13). These loci were previously associated with LB resistance using a selective genotyping approach in an F 2 population (see previous chapter). Average disease severity was lower in heterozygous individuals (50.8 ± 37.3%) compared with individuals homozygous for the NCEBR-2 allele (87.4 ± 13.9%). Individuals homozygous for the NCEBR-2 allele had disease severity scores that were skewed toward higher disease severity. None of the distributions were normally distributed (p<0.05).

226 Frequency A H Disease Severity Figure Disease severity (percent defoliation) of F 4 BC individuals separated by genotype at the SSR74/SSR223 marker loci on chromosome 10. A indicates that individuals were homozygous for NCEBR-2 and H indicates that individuals were heterozygous. Graphical genotypes were constructed for the F 4 BC individuals (Figure 4-14, 15). Seven of the ten most LB resistant individuals and seven of the ten most LB susceptible individuals were heterozygous at the U locus on chromosome 1. The twelve most LB resistant individuals were heterozygous at the SSR74/SSR223 loci on chromosome 10. Six of these individuals were also heterozygous at the TMA0040 locus on chromosome 10. Conversely, only four of the twelve most LB susceptible individuals were heterozygous at the SSR74/SSR223 loci. Due to the small population size, QTL analyses were not performed.

227 Figure Graphical genotypes of the F 4 BC individuals for chromosome 1. The individuals are organized from lowest to highest disease severity. The red segments indicate homozygosity for NCEBR-2, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment. 212

228 213 Figure Graphical genotypes of the F 4 BC individuals for chromosome 10. The individuals are organized from lowest to highest disease severity. The red segments indicate homozygosity for NCEBR-2, the light blue segments indicate heterozygosity, and the green segments indicate that marker data is unknown (either because marker was RFLP based and these markers were only genotyped in the F 2 population or the marker genotyped could not be reliably determined). The yellow rectangle indicates the foreground segment. Discussion To introduce the LB resistance conferred by S. pimpinellifolium accession PSLP153 to valuable breeding material, the regions conferring LB resistance should be delineated as finely as possible and the gene effects determined. Delineating the resistance regions allows development and selection of the best potential DNA markers for use in MAS (COLLARD and MACKILL 2008). To confirm the resistance regions, delineate the resistance regions, and estimate gene effects, progress was made toward obtaining NILs. This strategy has been used to fine-map tomato traits,