Supplemental Table S1. RT-PCR primers used in this study

Transcription

1 Supplemental Table S1. RT-PCR primers used in this study gene sequence (corresponding nucleotide positions) product size HDAC1 forward: 5'-AACCTGCCTATGCTGATGCTGG-3' ( ) 326 bp reverse: 5'-TCGTCTTCGTCCTCATCG-3' ( ) HDAC2 forward: 5'-ACACAATCCGTAATGTTGCTCG-3' ( ) 261 bp reverse: 5'-CACAGGTAGTCGTCCTGGTCCAAGGAT-3' ( ) HDAC3 forward: 5'-GAACAGCATCTTCTGGAATAGC-3' ( ) 278 bp reverse: 5'-TTTCACAACTATAACAGTTTGGTC-3' ( ) CD11b forward: 5'-ATGGCTCTCAGAGTCCTTCTGTAA-3' ( ) 57 bp reverse: 5'-CATCAAAGAGAACAAGGTTTTGGA-3' ( ) c-fms forward: 5'-TCCAACTACATTGTCAAGGGCAATGCCCGCCT-3' ( ) 36 bp reverse: 5'-CAGATTGGTATAGTCCCGCTCTCTCCTGTCCT-3' ( ) c-mpl forward: 5 -CCTACTGCTGCTAAAGTGGCAAT-3 ( ) 366 bp reverse: 5 -CAATAGCTTAGTGGTAGGTAGGA-3 ( ) GAPDH forward: 5'-CCACCCATGGCAAATTCCATGGCA-3' ( ) 6 bp reverse: 5'-TCTAGACGGCAGGTCAGGTCCACC-3' ( )

2 β

3 Legends to Supplemental Figures Supplemental Figure S1. Differential expression of HDAC proteins in normal hematopoietic cells and AML blasts. The results of immunoblotting for HDACs were quantified using Scion Image software (Scion Corporation, Frederick, MD). Relative HDAC expression means the signal intensities of HDACs against corresponding β-actin signal intensities (setting at 1.). The means ± S.D. (bars) of at least three independent experiments are shown. P-values were calculated by one-way ANOVA with Dunn s multiple comparisons test (* and ** denote P<.5 and P<.1, respectively). Supplemental Figure S2. Expression of HDACs in mitogen-stimulated T-lymphocytes. We isolated T-lymphocytes from the peripheral blood of healthy volunteers, cultured with 2 µg/ml phytohemagglutinin-l (PHA) and 1% FCS, and harvested at the indicated time points for immunoblot analysis of HDAC1, HDAC2, HDAC-3 and β-actin (loading control) expression. Signals were obtained with the ChemiDoc XRS Molecular Imager (BioRad Laboratories, Hercules, CA) and used without digital manipulation. Cell cycle entry was monitored simultaneously using [ 3 H]thymidine incorporation for the final hour of culture. Relative [ 3 H]thymidine uptake indicates a fold increase against the value obtained at 1 hour of culture (T-). Supplemental Figure S3. Differential expression of HDAC mrnas in normal hematopoietic cells and AML blasts. We performed real-time quantitative RT-PCR using the same primer

4 pairs of RT-PCR analysis for HDACs and GAPDH in SYBR Green PCR System (Applied Biosystems, Foster City, CA). Data quantification was carried out by the 2 -Ct method using GAPDH as a reference. The means ± S.D. (bars) of three independent experiments are shown. P-values were calculated by one-way ANOVA with Tukey-Kramer multiple comparisons test (* and ** denote P<.5 and P<.1, respectively). Supplemental Figure S4. Confirmation of bilineage differentiation of K562 cell lines. We cultured K562 cells with phorbol-12-myristate-13-acetate (PMA) and cytosine arabinoside (AraC) to induce megakaryocytic and erythroid differentiation, respectively. Cells were harvested at the indicated time points for CD41 expression on flow cytometry and dianisidine staining to evaluate the induction of differentiation. The means ± S.D. (bars) of three independent experiments are shown. Supplemental Figure S5. Expression of HDAC1 mrnas during erythroid differentiation. We cultured purified human CD34 + bone marrow mononuclear cells in serum-free liquid medium with erythropoietin and stem cell factor to induce erythroid differentiation. Cells were harvested at the indicated time points for morphological observation (Wright-Giemsa staining) and real-time quantitative RT-PCR for HDAC1 and GAPDH mrna expression using SYBR Green PCR System (Applied Biosystems). Relative HDAC1 expression was calculated by the 2 -Ct method using GAPDH as a reference. Data shown are the representative results of three independent experiments.

5 Supplemental Figure S6. The nucleotide sequence of promoter regions of the HDAC1 gene. The nucleotide sequence of the 5'-untranslated region of the HDAC-1 gene is shown. Position +1 (red) indicates the transcription start site determined by primer extension. Protein coding region in exon 1 is shown in italics (+74 to +122). Putative binding sites for Sp1, GATA family proteins, MZF-1 and C/EBPs are underlined, boxed, shaded, and in boldface type, respectively. The nucleotide sequence shown here has been deposited in the DDBJ/EMBL/GenBank database with the accession number of AB Supplemental Figure S7. Validity of HDAC1 expression vector. (A) c-kit + murine bone marrow cells were infected with retroviruses carrying GFP alone (Mock) or HDAC1/GFP (HDAC1) as described in Materials and Methods. After 24 hours, we examined the expression of HDAC1 and β-actin (internal control) with immunoblotting. (B) HEK239 cells were transfected with pgl4.1 vector containing the promoter region of the HDAC3 gene (DDBJ/EMBL/GenBank accession number AB457579) and HDAC1 expression vector at the indicated doses. We measured luciferase activities after 48 hours. Relative HDAC3 promoter activity (y-axis) was calculated as firefly luciferase activities of cells transfected with pgl4.1-hdac3 and an empty expression plasmid setting at 1% after normalization of transfection efficiencies using Renilla luciferase activities. Data shown are the means ± S.D. of three independent experiments. Supplemental Figure S8. HDAC1 modulates the expression of several genes in hematopoietic progenitor cells. c-kit/gfp double-positive cells were isolated from the bone

6 marrow of mice transplanted with mock- and HDAC1-transduced cells after 1 weeks of transplantation, and subjected to DNA microarray analysis. In brief, poly (A) RNAs were prepared from each cell type, labeled with either Cy5 or Cy3 dye, and hybridized to OpArray Mouse Version 4. (Operon Biotechnologies, Huntsville, Alabama), which contains 35,852 oligonucleotide probes corresponding to 22,21 genes. Precise information about the array is available on the company's website ( download.aspx). The arrays were scanned by GenePix4B Array Scanner (Axon Instruments, Concord, ON, Canada). The results were quantified with Array-Pro Analyzer Version 4.5 and analyzed with Array-Ready Oligo Set for Mouse Genome Version 4. software (Media Cybermetrics, Bethesda, MD). See supplemental Table S1 for a list of HDAC1-regulated genes, in which the alteration of expression levels was confirmed by real-time quantitative RT-PCR. Supplemental Figure S9. The correlation of FLT3-ITD mutations with the expression levels of HDAC1 in AML cells. We isolated total cellular RNA from primary AML cells and examined the presence of FLT3-ITD mutations using the following primers: forward 5 -GCAATTTAGGTATGAAAGCCAGC-3 ; reverse 5 -CTTTCAGCATTTTGACGGGAACC-3. This primer pair amplifies 235-bp fragment of wild-type FLT3, and detects FLT3-ITD mutations as larger PCR products (for example, 295-bp in MV4-11 cell line; data not shown). The expression levels of HDAC1 were determined simultaneously by real-time RT-PCR, and quantified by the 2 -Ct method using GAPDH as a reference. Statistical significance was determined by unpaired Student s t-test.

7 Relative HDAC Expression HDAC1 HDAC2 HDAC3 HL-6 K562 AML blasts T-lymphocytes Monocytes Granulocytes CD34 - BMMNC CD34 + BMMNC Supplemental Fig. S1

8 Supplemental Fig. S2 HDAC1 HDAC2 HDAC3 β-actin 25 Relative [ 3 H]Thymidine Uptake Time in Culture with PHA (hours)

9 Relative HDAC Expression HDAC1 HDAC2 HDAC3 HL-6 K562 AML blasts T-lymphocytes Monocytes Granulocytes CD34 - BMMNC CD34 + BMMNC Supplemental Fig. S3

10 Supplemental Fig. S PMA AraC Days in Culture PMA AraC Days in Culture

11 Supplemental Fig. S5 Relative HDAC1 expression Day Day Day 2 Day 4 Culture periods Day 6

12 -117 tcacgcccgtaatctcagcatattgggaggccgaggtgggcggatcctgaggtcaggagttcgagaccacctggaccaacacggagaaacccagtctct -171 accaaaaatacaaaattagccgggcatggtggcacatgcttgtaatcccagctactcgggaggctgaggcaggagaaccgcttgaacacagaggcagag -973 attgtggtgagccgagatcacaccattgcactccagcctgggcaactagagcgaaactcttgtctcaaaaaaaaaaaaaaaaaaaaaaacagggaaaga -874 aaagaaaggaaacctgccctcctatcataggataatcccatttcctcctgtctaaagagacgcctacttagtcatcctgggtgactgcatcagggaggt -775 agattttggagtctgaaaggctgggttctgtcactttgttacagtgcctctggtgcaaagaaagcattttaaaaaccctgtacaattaaaaaattgaat -676 ttaattactttgtgtaactttgaataattcacagaagtctgaacttctttatcctgtcctgtaaaatggaggtaaaaagcccttggccgagagctgttt -577 tgaggaaaaactgaaataacattggtaaagtgtcgcacagtacttggcacacagcagcccctcgacaaacattagctttctttccctttcttgtcggtt -478 tcttcctctccaaacccgcgtgttgcttttctttttaattatttttctgtagccctcctttgcggccacaaactcgctttctaacccaggttcagccct -379 tttattggctgagtgaccttgtgcaagtcacttttcccctgtaggcctcggtttattctccgtaaaatcagaaagttggcctccgatctccaagcacgc -28 ttttcacgacgaagtgggactgttaagtttacagagctgctttcctcccccgggactgatggtacggtccccgggcggctccccacccatctgtcgcag -181 accttggtacaggcccagggggccctcggcggcctctccgggctgcccttgccccctgccgagttccgggcccgtgtctgcgcaagctgattggctgga -82 gcggtgcccgggctgcgcggctataggtgagcccaggaggggacgggcggggcgggccggaggcccgccccctcccccctgggtcggacgctgagcgga +18 gccgcgggcgggagggcggacggaccgactgacggtagggacgggaggcgagcaagatggcgcagacgcagggcacccggaggaaagtctgttactact +117 acgacggtgagcaccgtcctcgcggcgggggcggggccaggccgggccggaccgggaacctggaggctgaggctggagcgccgatgggaggctgcggga +216 ggctgaggcgctggggagaggctcggagaggaggctgcgagggggaagtcgaggctgagggaggaggctgcgaggaagggagatcgaggctgagaccaa +315 gaggggatcgcgtgggggaagcgtgaggtaatcttgatgggaagattctgaggaagtctgatgtggagagtttgagtgggact +397 Supplemental Fig. S6

13 (A) HDAC1 Supplemental Fig. S7 β-actin HDAC1 Mock (B) Relative promoter activity HDAC1 plasmid (µg)

14 mrna expression in Mock-transfected cells 1 1 Down-regulated Genes 1 1 Up-regulated Genes mrna expression in HDAC1-overexpressing cells Supplemental Fig. S8

15 P<.5 Relative HDAC1 mrna expression FLT3-ITD Supplemental Fig. S9