Gene Circuits -2. Shu-Ping Lin, Ph.D. Institute of Biomedical Engineering

Transcription

1 Gene Circuits -2 Shu-Ping Lin, Ph.D. Institute of Biomedical Engineering Website:

2 Genes Flow of information in gene expression from genes in the form of DNA to mrna by transcription and from mrna to proteins in the form of translation. TRANSCRIPTION TRANSLATION DNA mrna Ribosome (a) Prokaryotic cell. In a cell lacking a nucleus, mrna produced by transcription is immediately translated into proteins without additional processing. Polypeptide Nuclear envelope TRANSCRIPTION DNA RNA PROCESSING TRANSLATION mrna Pre-mRNA Ribosome (b) Eukaryotic cell. The nucleus provides a separate compartment for transcription. The original RNA transcript, called pre-mrna, is processed in various ways before leaving the nucleus as mrna. Polypeptide

3 Genes Are Found on Both Strands In eukaryotes, coding regions (exons) are separated noncoding sequences (introns). Exons, introns and regulatory sequences of a gene all lie on the same strand and the start and stop codons are at the 5 and 3 -end of the strand respectively. TRANSCRIPTION RNA PROCESSING DNA Pre-mRNA Pre-mRNA 5 Cap 5 1 Exon Intron Exon Intron Exon Poly-A tail mrna Ribosome Coding segment Introns cut out and exons spliced together TRANSLATION Polypeptide mrna 5 Cap Poly-A tail 5 UTR UTR

4 Gene Anatomy Regulation of gene expression is mostly controlled at transcription. But some level of regulation also occurs post transcription and translation. Prokaryotic Genes: Bacterial DNA contains mostly uninterrupted protein-coding regions in which genes clustered on DNA subunits called Operons. Cluster of Genes lie on the same DNA strand that encode proteins with related functions all controlled by a single Regulatory circuit. Operon consists of promoter (P) and operator (O), regulatory sequences, coding regions of each gene and small spacers between genes. * Lac Operon: (Digestion of the milk sugar lactose, such as gene lacz, lacy, laca)

5 Lac Operon Digestion of milk sugar lactose: lac Z, lac Y, and lac A Lac Z: contains 3075 bases and encodes β-galactosidase, which splits the disaccharide lactose into monosaccharides glucose and galactose Lac Y: 1254 bases and called lactose permease to encode transmembrane protein by using energy of electrochemical gradient across membrane to pump lactose into cell Lac A: 612 b (shortest) and encodes thiogalactoside transacetylase, which degraded small carbon compounds RNA polymerase (RNAp): protein complex, low affinity for DNA but in promoter regions, binds to promoter for initiating transcription Lac I: lac repressor (repressor protein), binds to operator region and then blocks interaction of RNAp with gene-regulatory segment and prevents gene transcription Catabolic gene activating protein (CAP): activator protein (DNA binding protein), binds to promoter to attract/stimulate RNAp to the lac operon and enhance transcription rate

6 Eukaryotic Genes Distribution of eukaryotic genes differs from prokaryotic genes Only a fraction of eukaryotic DNA codes for proteins or RNA molecules: 1.1% of human genome represents protein-coding genes Coding regions are not continuous ( Split genes), contains exons and introns. Introns often account for most of the gene size.: BRCA-1 (Chr 17) 100,000 bp. Codes for a protein of 1863 aa rest is introns (~98%). BRCA-2 (Chr 13) 200,000 bp. Codes for a protein of 3418 aa. Eukaryotic genes may have multiple sequences regulating the same gene. Promoter is the regulatory element closest to the first exon. Regulator sites distant from the first exon are called enhancers. Some of these sequences may be as far as 50,000 bp upstream. Transcription factor (TF): conserved, regulate transcription by binding regulatory sites General TF: many are not specific to a given gene, but function as regulatory proteins for multiple genes Specific TF: regulate cell-signaling pathways, exposing cell to external stimulus can increase synthesis or activation of these TF TFIID binding to TATA box at promoter and concluding with activation of RNA polymerase II (RNApII) Initiate transcription Start codon: placed a few base pairs after transcription initiation site Stop codon (poly A sequence): in last exon

7 DNA Looping Both exons and introns are transcribed into premature mrna. Introns are excised and exons are brought together before mrna leaves nucleus and enters cytoplasm for translation. Activator proteins bound to enhancer transiently bind to RNApII by looping out intervening DNA. Folding DNA enables proteins bound to distant regulatory sites to physically interact with proteins bond to proximal sites. DNA looping might enable transcription factors bound to enhancers to physically interact with the components of the transcription initiation complex assembled at the promoter. Activators: TFs bind to enhancers, opening up DNA at transcription-initiation sites

8 Human Chromosomes Protein-coding genes: linearly arranged on the chromosomes of multicellular organisms Approximate locations of thousands of genes on human chromosomes have been identified. Light (genes are distributed, high GC concentrations ) and dark bands Provide significant information about the function of genes and progression of certain diseases such as cancer Gene mutations cause cancer occur in celldivision-cycle-regulating genes Gene mapping: closely related organisms

9 Karyotyping A test to examine chromosomes in a sample of cells, which can help identify genetic problems as the cause of a disorder or disease. This test can: Count the number of chromosomes Look for structural changes in chromosomes The test can be performed on almost any tissue, including: Amniotic fluid from amniocentesis Blood from venipuncture Bone marrow from bone marrow biopsy Tissue from the organ that develops during pregnancy to feed a growing baby (placenta) from chronic villus sampling Females: 44 autosomes and 2 sex chromosomes (XX), written as 46, XX Males: 44 autosomes and 2 sex chromosomes (XY), written as 46, XY

10 Preparation of Chromosomes Giemsa is specific for the phosphate groups of DNA Quinacrine binds to the adenine-thymine-rich regions

11 Staining of Chromosomes Attention is paid to their length, the position of the centromeres, banding pattern, any differences between the sex chromosomes, and any other physical characteristics. Giemsa,is applied after cells have been arrested during cell division by a solution of colchicine Aseptic precautions Preparation of RPMI 1640 medium Collection of 10ml of blood with heparin Setting of culture 8 ml of medium 0.1 ml of PHA-M 0.5 ml of blood/plasma 2 ml of autologus plasma/fcs Incubate at 37 C for 72 hours Harvesting of culture Spindle inhibitors Colchicine/colcemed (0.1µg/ml) Hypotonic treatment 0.075M KCl Fixation (3:1 methanol : acetic acid) Preparation of slides Slides stained with 4% Giemsa for 20-25min Screening of slides to study the morphology of chromosome Construction of karyotype

12 Basic Cytogenetic Examinations Interphase cells Barr body (sex chromatin) Metaphase cells staining of chromosomes Solid staining G-banding (by Giemsa) R-banding C-banding Q-banding Ag-NOR

13 Gene Circuits Gene expression can be explained through mathematical models based on Boolean networks

14 Regulation of Gene Expression in Prokaryotes E.coli genome decoded copies of proteins depending on the need Transcription rate can vary 1000 fold Regulation of (milk sugar) lactose catabolism: Glucose No lactose β-gal No allolactose Glucose Lactose β -gal Allolactose binds LacR Allolactose

15 High Affinity Regulation of Lac Operon Multiple logic network Involves Catabolic gene activating Protein (CAP): stimulate transcription only when form complex with camp camp signaling molecule (hunger signal): indicate absence of glucose and lead to synthesis of enzymes CAP + camp RNAp Lac Operon also involves feedback control

16 Regulation of Lac Operon Prokaryotic cell structure is simple allowing for rapid movement of ligands affecting gene expression. Lac repressor (R) bound to the operator unless it forms a complex with allolactose (A) in a glucose-poor and lactose-rich environment Blocks transcription Lac Z: contains 3075 bases and encodes β-galactosidase, which splits the disaccharide lactose into monosaccharides glucose and galactose RNAp binds to operator sites and initiates transcription only when CAP protein (form a complex with second messanger camp) binds to promoter

17 Regulatory Logic of Eukaryotic Genes Multiple regulatory switches encode gene-specific transcription factors Include regulatory sites: (A) proximal; (B) distal enhancer and (C) distal repressor Module A, 3 regulatory sites, 2 of which, when occupied with TAs, amplify and relay signals arriving from distal modules to basal promoter (BP) of gene Transcription is represses when both C and A1 are occupied with their specific TFs. A2 occupied Acts as a switch to B Amply signal coming from B and relay to BP A3 dominates signal for transcription.

18 Time Course of Transcription/Regulation Prokaryotic cell structure is simple allowing for rapid movement of ligands affecting gene expression. Within seconds Eukaryotic gene transcription depends on the concentrations of TFs in the nucleus. H form complex with Rab at promoter Pab 1. Polymerase transcribes gene a Produce protein A 2. Enough A binds to Rc Produces C 3. Sufficient C binds to Rb Produces B

19 Bionetworks Proteins and gene regulatory elements that also include metabolic pathways Synthesis of aromatic amino acids - Phe, Tyr, Trp By plants and bacteria (not in humans) A B, B C, C D, D F B E, E E, E F, F G

20

21 DNA molecule Gene 2 Gene 1 Gene 3 DNA strand (template) 3 5 A C C A A A C C G A G T TRANSCRIPTION U G G U U U G G C U C A mrna 5 Codon TRANSLATION 3 Protein Trp Phe Gly Ser Amino acid,,,,,,,,,,, DNA: 3 accgtgattcatcccgccaacaaccgctattatac,,,,,,,,,,,, 5 1. mrna 5 UGG,CAC,UAA,GUA,GGG,CGG,UUG,UUG,GCG,AUA,AUA,UG 3 Amino-acid sequence WH*VGRLLAII 2. mrna 5 U,GGC,ACU,AAG,UAG,GGC,GGU,UGU,UGG,CGA,UAA,UAU,G 3 Amino-acid sequence GTK*GGCWR*Y 3. mrna 5 UG,GCA,CUA,AGU,AGG,GCG,GUU,GUU,GGC,GAU,AAU,AUG 3 Amino-acid sequence ALSRAVVGDNM