Oracle Spreadsheet Add-In for Predictive Analytics for Life Sciences Problems

Size: px
Start display at page:

Download "Oracle Spreadsheet Add-In for Predictive Analytics for Life Sciences Problems"

Transcription

1

2 Oracle Life Sciences eseminar Oracle Spreadsheet Add-In for Predictive Analytics for Life Sciences Problems Meeting Place: US Toll Free: US Only: Asia/Pacific: Europe/M. East/Africa: Meeting ID #: Meeting Password: Charlie Berger (charlie.berger@oracle.com) Sr. Director of Product Management, Life Sciences and Data Mining

3 The future of data mining lies in predictive analytics. The Future of Data Mining Predictive Analytics Article published in DM Review Magazine August 2004 Issue By Lou Agosta

4 Oracle Spreadsheet Add-In for Predictive Analytics Agenda What is Predictive Analytics Life sciences applications for Predictive Analytics Demo Q & A

5 Oracle Life Science Platform 1. Access distributed data Gateways, External Tables, SQL Loader, Streams, Oracle Gateway to Lion SRS, etc. 2. Integrate a variety of data types XML DB, Intermedia, Text, etc. 3. Manage vast quantities of data RAC, Partitioning, Grid, etc. 4. Collaborate securely Collaboration Suite, ifs (Oracle FilesOnline), Portal, Security, etc. 5. Find patterns and insights Data Mining, BLAST, Statistics, Text, etc. Proteomics Proteomics Cheminformatics Cheminformatics Pathways Pathways Genomics Genomics Clinical Clinical

6 What is Predictive Analytics? One click data mining Automatically selects appropriate algorithm Automates all advanced algorithm settings Automates Train, Test, and Apply steps Power data analysts can use Oracle Data Miner (wizard driven gui) PL/SQL API Java API Concept of performing predictive analytics is better than doing nothing

7 Life Sciences Applications for Predictive Analytics (PA) Life Sciences examples Leukemia AML/ALL Golub et al. NCI-60 ChemoSensitivity data Data Mining performed by expert data analyst using a tool Predictive Analytics automates everything Discovery/Development Find factors associated with a disease Predict which patients might respond best to an experimental treatment Database Marketing Predict which doctors are likely to prescribe new drug(s) Predict which patients are most likely to be high value customers Health Care Predicting medical outcomes Find factors associated with high cost Fraud detection

8 Oracle Data Mining Algorithms & Example Applications Attribute Importance Identify most influential attributes for a target Explain attribute PA Easy Button Factors associated Attribute Importance a disease Promising leads A1 A2 A3 A4 A5 A6 A7 Classification and Prediction Predict most likely to: Doctors who prescribe a new drug Patients who respond to a treatment Regression Predict PA Easy Button Classification & Regression Predict a numeric value Predict a value Predict the size tumor reduction

9 5. Discover Patterns and Insights Life Sciences data Functional Genomic Databases Clinical Databases Deductive Analysis Answer complex questions about the relationships in genomic, clinical and pharmacological data Proteomics Database Pharmacological databases Inductive Analysis C A T G Finding relationships for classification, class discovery and prediction

10 metagroup.com Copyright 2004 META Group, Inc. All rights reserved. METAspectrum 60.1

11 D E M O N S T R A T I O N Oracle Spreadsheet Add-In for Predictive Analytics

12 Oracle Spreadsheet Add-In for Predictive Analytics Enables Excel users to mine Oracle or Excel data using one click Predict and Explain predictive analytics features

13 Oracle Spreadsheet Add-In for Predictive Analytics Users select a table or view, or point to data in Excel, and select a target attribute

14 Oracle Spreadsheet Add-In for Predictive Analytics Explain PA finds attributes that have the greatest influence

15 Oracle Spreadsheet Add-In for Predictive Analytics Example applications: identify influential attributes: Patients who develop a disease High value customers People who don t comply with regulations

16 Oracle Spreadsheet Add-In for Predictive Analytics Enables users to make better predictions because the prediction is based on observed data and hidden patterns found by Oracle Data Mining

17 Oracle Spreadsheet Add-In for Predictive Analytics Example applications: Predict Patients likely to develop a disease Size of a tumor People likely to commit fraud Customers with highest lifetime value

18 Oracle Spreadsheet Add-In for Predictive Analytics Example applications: Predict Patients likely to develop a disease Size of a tumor People likely to commit fraud Customers with highest lifetime value

19 Oracle Data Miner Data miner uses Oracle Data Miner to build, evaluate, and apply ODM models Mining Activity Guide Wizards approach Generate Java and SQL code to operationalize applications Integrate insights into other applications

20 10g Oracle Data Mining Wide range of data mining algorithms Feature Selection Attribute Importance Supervised learning (classification and prediction) Naïve Bayes Adaptive Bayes Networks Support Vector Machines (SVM) Decision Trees (10gR2) Unsupervised learning (clustering and associations) Association Rules Orthogonal Partitioning Clustering Enhanced k-means Cluster One Class Classifier SVMs (10gR2) Feature Extraction Non Negative Matrix Factorization A1 A2 A3 A4 A5 A6 A7 F1 F2 F3 F4

21 10g Additional Features Wide range of data mining algorithms Text Mining Ability to combine structured data and unstructured data Application Programming Interfaces (APIs) Java PL/SQL Scoring engine Sequence Matching and Alignment Searches BLAST (Life sciences: genes and proteins) ATGCAATGCCAGGATTTCCA CTGCAAGGCCAGGAAGTTCCA ATGCGTTGCCAC ATTTCCA GGC..TGCAATGCCAGGATGACCA ATGCAATGTTAGGACCTCCA

22 Benefits of Oracle s Approach Oracle Data Mining Platform for Data Mining Applications Benefit Eliminates data movement and security exposure Fastest: Data Information Automated data mining Business users can mine data A predictive model is better than no model at all Multiple platforms Applications development Built on Oracle Technology Grid, RAC, integrated BI, SQL & PL/SQL Leverage existing Oracle skills

23 Q U E S T I O N S A N S W E R S

24

25