nm nm nm nm nm nm. Seed surface. oi-ab. oi-ad. ii-ab. ii-ad/endothelium. endosperm.

Transcription

1 B nm Seed surfce oi nm A nm oi-d ii- ii-d/endothelium nm nm nm 1mm endosperm C oi-d D ii-d/endothelium ii- endosperm

2 Supplementry Figure 1 Cell wll thickness mesurements in seed contining fully expnded emryo. A) Overview of grid segment contining full view of test segment. B) Composite close-up of zone of A, with cell lyers indicted s well s cell wll thickness mesurements (pproximte), from periclinl cell wlls within the test. C) Shows close up of wll 3 (lck rrows). The cells of the inner integument hve strted to collpse y this stge in development. White rrow indictes juxtposed cell wlls from cell of the internl cell lyer of the inner integument, seprted y thin lyer of cell deris. D) Shows close-up imge of the cell wll seprting the seed cot from the endosperm. Scle rs equl 1mm.

3 Supplementry Fig. 2 oi- microtuules oi-d ii- endosperm Propidium iodide stined ovule showing position of microtuule rrys imged in Figure 2. Relevnt cell lyers re lelled. Positions of microtuule rrys in oi- nd oi-d re indicted in yellow, nd the position of wll 3 is indicted in lue.

4 Supplementry Fig. 3 Microtuule orgnistion in the xil epidermis of the outer integument t 96h fter pollintion. () Seed expressing TUA6-GFP. () Seed expressing MAP65-RFP. Scle r = 10 m.

5 Supplementry Fig. 4 Apprtus for silique compression. ) Crtoon of compression pprtus seen from the side. Screws (rown) llow the ppliction of pressure to hnd pollinted siliques (green) held under coverslip (lue). A noncompressed control is shown in the upper pnel, nd compressed silique in the lower pnel. ) Imges of silique compression. Plnts re plced horizontlly during silique compression.

6 Supplementry Fig. 5 Extended compressions do not led to seed dmge. ) Imges of dissected uncompressed control seed (left) nd seed fter 6h of compression in the pprtus shown in Extended Dt Fig. 4 (right). Seeds express Lti6-GFP (green). Upper pnels show centrl focus on oi-, nd lower pnels show focus on oi-d. Both cell lyers remin intct. ) As for ), ut fter 24h of compression. Scle r = 10µm.

7 Supplementry Fig. 6 c d e Seed stging. Clering of seeds from hnd pollinted siliques grown under continuous light t 16 C. ) 2 dys fter pollinistion (dp), ) 3 dp, c) 4 dp, d) 7 dp,e) 9 dp. The endosperm is still uncellulrised t 7 dp under these conditions.

8 Supplementry Fig. 7 oi- oi- oi-d oi-d c oi-d ii- ii- Effects of surgicl removl of the endosperm. ) Lti6-GFP (green) expressing seed prior to surgicl removl of endosperm. ) The sme seed post endosperm removl imged in the presence of propidium iodide (mgent). In ech cse three plnes re shown, the first with centrl focus on the xil epidermis of the outer integument (oi), the second with centrl focus on the dxil epidermis of the outer integument (oi-d), nd the third with centrl focus on the xil epidermis of the inner integument (ii-). In the third cse orthogonl sections in the X nd Y xes re shown. c) Imge of oi-d shown in ) with green chnnel only, highlighting loss of cell integrity in oi-d. Scle r = 10µm.

9 Supplementry Fig Seed size mesurements in zou-4 heterozygous plnts. ) Representtive experiment (repeted three times) showing seed re mesurements for successive siliques from self-fertilized ZOU/zou-4 heterozygous plnt. Mesurements re generted from imges such s tht shown in ), where representtive snps of seeds from silique 26 nd silique 35 (lck rrows in )) re shown. In ech cse seeds contining mutnt (persistent) endosperm (red rrowheds) cn e clerly distinguished from those tht contin norml endosperm nd fully developed emryo. Seeds contining mutnt emryo nd endosperm re clerly lrger thn wild-type in the zone indicted y red doule-heded rrow. = P<0.05, = P<0.01, Student s t-test. Scle r = 100µm.

10 Supplementry Fig. 9 Col-0 zou-4 iku2-2 zou-4 iku2-2 Col-0 zou-4 iku2-2 zou-4 iku2-2 Col-0 zou-4 zou-4 iku2-2 zou-4 iku2-2 zou-4 iku2-2 Mechnicl stresses in the test re incresed during emryo expnsion in iku2-2 nd zou-4 iku2-2 mutnts. ) ELA1 expression is stronger in torpedo stge siliques in iku2-2 mutnt seeds compred to wild-type, nd stronger in zou-4 iku2-2 doule mutnts thn in either single mutnt ckground. Expression of the test specific RGP4 gene is shown s control. Expression of RGP4 is lower in the iku2-2 mutnt ckground, likely due to reduced seed size. Error rs re stndrd errors of three iologicl replictes. = P<0.05, = P<0.01, Student s t-test.. ) Seed phenotypes of iku2-2, zou-4 nd zou-4 iku2-2 doule mutnts. Seeds with urst tests (white sterisks nd lck rrow) re only oserved in the doule zou-4 iku2-2 mutnt ckground.

11 Supplementry Fig. 10 i ii iii iv ELA1 trnscript detection y in situ hyridiztion. ) Detection of ELA1 trnscripts in developing seeds y in situ hyridiztion. i) Gloulr stge, ii) hert stge, iii) torpedo stge, iv) sense control. Red rrowheds show the lue/lck colortion indicting trnscript presence in the test. Bckground stining is rown, nd prticulrly strong in the endothelium in ll seeds. (indicted y lck rrow in iv). Scle r = 50µm ) Expression profiles for ELA1 from the Aridopsis efp rowser (originl dt from Seed Gene Network Wesite ( Our in situ hyridiztion results re in strong ccordnce with these dt.

12 Supplementry Fig. 11 6h compressed 6h uncompressed 24h compressed 24h uncompressed The ELA1 gene does not show ectopic expression in response to compression. ) Compression experiments crried out on plnts expressing the pela1:venus-n7 construction (Fig. 4). Compressed nd uncompressed imges re opticl sections of siliques from the sme plnt. Scle r = 10µm. No ectopic expression is oserved in response to compression. ) Nucleus fluorescence quntifiction from plnts expressing the pela1:venus-n7 construction. N= 1186 in control nd 1134 in compressed smples t 6h (see Fig. 4 for 24h)

13 Supplementry Fig. 12 At5g50570 (RGP4) At1g63300 At5g24900 (ELA2) At3g08900 (RGP3) Compression tretment does not ffect the expression of other seed cot-specific genes, of ELA2 or of the endosperm specific RGP3 gene. Q-RT-PCR experiments crried out on the sme mteril s tht presented in Fig. 4.

14 Supplementry Fig. 13 iii i ii iv ELA2 trnscript detection y in situ hyridiztion. ) Detection of ELA2 trnscripts in developing seeds y in situ hyridiztion. i) Gloulr stge, ii) hert stge, iii) torpedo stge, iv) sense control. Red rrowheds show the lue/lck colortion indicting trnscript presence in the endosperm. Bckground stining is rown, nd prticulrly strong in the endothelium in ll seeds. (indicted y lck rrow in iv). Stining cn lso e seen in the vsculr tissues of the emryo in iii). Detection of ELA2 trnscripts in the test is not cler using this technique due to the high level of vcuolristion of the test ut is clerly indicted y in silico dt from the liner cotyledon stge onwrds (). Scle r = 50µm ) Expression profiles for ELA2 from the Aridopsis efp rowser (originl dt from Seed Gene Network Wesite ( Our in situ hyridiztion results re in ccordnce with these dt.

15 Supplementry Fig. 14 At5g24910 At5g24900 At5g24900 At5g24910 mirnaii Consensus GCAGTGGAGGATGCGGAGGAGTTTAAAGTTGCAAGGCGTGAAGGGTCCTCCACCGTCGATC GCAATGGAGGATGCGGAGGAAGCTGACGATGCAGGGCGTGAAGGGTCCTCCGCCGTCGCTA...TTTTAAGGCGTTTGGTGGCGT... GCAATGGAGGATGCGGAGGAAGCTGACGTTGCAGGGCGTGAGGGGTCCTCCGCCGTCGCTA c Reduction of ELA1 nd ELA2 expression in the seed cot leds to incresed seed re. ) Design of mirna ginst ELA1 (At5g24910) nd ELA2 (At5g24900). Asterisk indictes position in ech gene trgeted y the mirna. Exons re indicted y open rectngles. ) Trnscriptionl nlysis of ELA2 in two independent homozygous trnsgenic lines expressing this mirna under the promoter of ELA1. ELA2 is expressed predominntly in the endosperm nd thus is not expected to show strong glol regultion y test-specific mirna. Error rs re stndrd errors of six iologicl replictes (Smples re those shown in Fig. 4. c) Seed re mesurements corresponding to dt in Fig. 4d. = P< 0,05, = P < 0,01, Student s t-test.

16 Supplementry Tle 1. Primers used in this study Primer nme Sequence Appliction EIF4A-F EIF4A-R At5g24910-F At5g24910-R At5g24900-F At5g24900-R At5g50750-F At5g50750-R At1g63300-L At1g63300-R At3g08900-F At3g08900-R pcyp714a1f-noti pcyp714a1r-bmhi CYP714A1cdsFor CYP714A1cdsRev CYP714A2cdsFor CYP714A2cdsRev CYP2-I mir-s CYP2-II mir- CYP2-III mirs CYP2-IV mir TTCGCTCTTCTCTTTGCTCTC GAACTCATCTTGTCCCTCAAGTA tcgcctctggcttcct cggtttcccttcgctc ccggcgtctctttct ctgctttccccgttggt TCTCGAAAGAATCTGACACTGC TCAATCCAAACCACCATTGC gggtctggcg cctttggctcttctcctc GAAAAGGGTTTGAGTCACATGT GCATAGAGCACATTACACCTTC gggcggccgcgcgcggctttttgg cgcggatcctttcttatctttctttttcttagaaa CACCAGTGCTCGACTATACATATAGCCAAAG TTGTCTCAGAACTCTAATGACAACAC CACCATGGAGAGTTTGGTTGTTCATACG AACAACCCTAATGACAACACCATGT gttttaaggcgtttggtggcgttctctcttttgtttcc gacgccaccaaacgccttaaaatcggtctg gacaccaccaaacggcttaaattccggtcgtgttg gatttaagccgtttggtggtgttctctttttcct RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR RT-qPCR Cloning CYP714A1 promoter Cloning cdna for ISH proe Cloning cdna for ISH proe Cloning mirna