Analysis of Differential Gene Expression in Cattle Using mrna-seq

Size: px
Start display at page:

Download "Analysis of Differential Gene Expression in Cattle Using mrna-seq"

Transcription

1 Analysis of Differential Gene Expression in Cattle Using mrna-seq

2 mrna-seq A rough guide for green horns

3 Animal and Grassland Research and Innovation Centre Animal and Bioscience Research Department Teagasc, Grange, Dunsany, Co. Meath, Ireland

4 Animal and Bioscience Research Department (Grange site) Department head - Richard Dewhurst Research officers - Kieran Meade, David Kenny, Sinead Waters, Orla Keane, Bernie Early, Chris Creevey, David Lynn Research technologists - Matt McCabe

5 NGS Technologies Illumina (Solexa) Genome Analyser II (GAII) UCD, Conway. (part-owned by Teagasc) Roche 454 FLX Teagasc Moorepark

6 Progress 86 polya RNA-seq libraries SR = 12 liver, 48 leukocyte, 21 hypothalamus PE = 5 pooled sheep lymphocyte 14 mi/piwi RNA libraries 16 pooled target enriched DNA libraries Shotgun rumen metagenomic libraries

7 Important traits Feed efficiency Milk yield Fertility Disease resistance

8 Negative energy balance Metabolic disorder affecting high yielding dairy cows in the post partum period imbalance between energy intake and energy requirements for lactation and body maintenance.

9 McCarthy et al. (2010) 12 multiparous cows (parity no. = ) selected randomly from a pool of 24 Holstein-Friesians with average lactation yield of kg Treatment applied morning after 2 nd or 3 rd milking post-parturition MNEB 6 cows were fed grass silage ad libitum with 8 kg/day of a 21% crude protein dairy concentrate and milked once daily SNEB 6 cows were fed 25 kg/day silage with 4 kg/day concentrate and milked 3 x daily Energy balance was calculated Cows slaughtered on days 6-7 of the first follicular wave after calving RNA extracted from endometrium, spleen, liver

10 1 2 3 DNA primary-mrna cytoplasm 5 CAP mature-mrna AAAAA AAAAA AAAAA nucleus 1 3 AAAAA AAAAA

11 Library preparation UCD protocol using individually purchased reagents from Invitrogen and NEB

12 1. 10 ug total RNA (RIN ~ 8.0) 6. End repair (Klenow T4 and E. coli polymerase) 2. mrna (Dynal oligo(dt) beads AAAAA 3. Fragment mrna (Zinc) 4. First strand cdna synth (Superscript II) AAAAA TTTTT 5. Second strand cdna synth 7. Add a single A base A 8. Ligate adaptors T A 9. Gel purify bp adaptor ligated fragments? 10. PCR amplify (12-18 cycles), quantify on Qubit Fluorometer A A T TTTTTTT AAAAA

13 Cattle leukocyte SR mrna library preps Aran O Loughlin Yields = ng/ul (Qubit)

14 Single Read Library Adapter Sequence Adapter: 5' ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) ' 3' TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) ' Adapter: 5' (-) pgatcggaagagctcgtatg CCGTCTTCTGCTTG 3' 3' (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5' PCR Primer: 5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) ' 3' (-) PCR Primer: 5' (-) ' 3' (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5 Result Library: 5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCTCGTATG CCGTCTTCTGCTTG 3' 3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5 Genomic DNA Sequencing Primer: 5' ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) ' 3' (-) '

15 Paired end mrna seq library prep

16 Cattle leukocyte mrna library preps Sheep lymphocyte PE mrna library preps

17 How much coverage? Haploid bovine genome ~2.87 Gb (Elsik et al, 2009) 22,000 protein coding genes 180,000 protein coding exons (~30 Mb) 30 Mb/36 bp reads = 0.83 M reads for 1x coverage Rare transcripts +5 and 3 UTRs? Alternatively spliced isoforms Only 70% reads align to the bovine genome

18 Ran 12 libraries on 3 flowcells libraries 1-6 = MNEB libraries 7-12 = SNEB Lane Flowcell 1 Flowcell 2 Flowcell 3 1 library 1 (4.5 pm)* library 12 (5.5 pm)* library 2 (5.5 pm)* 2 library 1 (5.0 pm)* library 6 (5.5 pm)* library 3 (5.5 pm) 3 library 5 (5.5 pm)* library 2 (5.5 pm)* library 6 (5.5 pm)* 4 library 5 (6.0 pm)* library 7 (5.5 pm)* library 7 (5.5 pm)* 5 library 10 (4.0 pm)* library 9 (5.5 pm) PhiX 6 PhiX PhiX library 8 (5.5 pm) 7 library 10 (5.5 pm)* library 11 (5.5 pm)* library 11 (5.5 pm)* 8 library 10 (6.5 pm)* library 4 (5.5 pm) library 12 (5.5 pm)*

19 Bowtie Alignment (to BCM4) TopHat Splice junction mapper Cufflinks Assembles aligned reads into transcripts Computes expression values

20 Cufflinks

21 1 2 3

22 Short SR 1 2 3

23 Short SR 1 2 3

24 Short SR 1 2 3

25 Alternatively spliced isoforms

26 Alternative splicing predictions generated by Tophat Displayed on Integrative Genomics Viewer

27 Summary data (average for 21 lanes) Total number of reads 13,664,739 Reads with only one alignment and no duplicates 8,539,432 (62%) Number of islands detected 212,491 Number of exon/exon junctions detected 19,606

28 # of unique splice junctions detected for all 21 lanes Total Alternative splicing # of splice junctions for the exon

29 Short PE sequencing 1 2 3

30 Long PE sequencing 1 2 3

31 COST Sequencing kit = 1K SR cluster gen kit = 2K PE cluster gen kit = 4K Short SR = 1 seq kit + 1 SR cluster kit = 3K Long SR = 2 seq kits + 1 SR cluster kit = 4K Short PE = 2 seq kits + 1 PE cluster kit = 6K Long PE = 4 seq kits + 1 PE cluster kit = 8K

32 Microarray vs. mrnaseq RNAseq = 16,720 genes Microarray analysis = 12,679 genes RNAseq + microarray = 10,950 genes RNAseq only = 5,770 genes Microarray analysis only = 1,729 genes

33 Analysis of significantly differentially expressed genes in MNEB and SNEB animals

34 Analysis of significantly differentially expressed genes in MNEB and SNEB animals Expression values FPKM calculated using Cufflinks (Fragments Per Kilobase of exon per Million fragments mapped)

35 FPKM values

36 PCA of FPKM values in all lanes in mild (M) and severe (S) NEB animals

37

38 Analysis of significantly differentially expressed genes in MNEB and SNEB animals 348 SDE genes (<FDR 0.05) 438 SDE genes (<FDR 0.1)

39 Analysis of significantly differentially expressed genes in MNEB and SNEB animals 348 SDE genes (<FDR 0.05) 438 SDE genes (<FDR 0.1) SDE of 350 of these genes was also shown in the microarray

40 Correlation of 350 SDGEs in Microarray and mrnaseq

41 Lane effect Used Edge R to compare FPKM values of libraries run on 2 lanes Libraries 2,5,6,7,9,10,11,12 (1st lane) vs. Libraries 2,5,6,7,9,10,11,12 (2nd lane) found 40 differentially expressed genes!!!

42 Lane effect

43 Pathway analysis IPA analysis of microarray and RNAseq data show same top networks affected by SNEB Innate DB analysis GOseq

44 What next FRT-Seq??

45 Acknowledgements Chris Creevey, David Lynn - Teagasc Paul Cormican -Trinity Amanda Lohan, Alison Murphy - UCD Elaine Kenny -Trinity Sinead Waters, Sean McArthy, Dermot Morris -Teagasc

Wheat CAP Gene Expression with RNA-Seq

Wheat CAP Gene Expression with RNA-Seq Wheat CAP Gene Expression with RNA-Seq July 9 th -13 th, 2018 Overview of the workshop, Alina Akhunova http://www.ksre.k-state.edu/igenomics/workshops/ RNA-Seq Workshop Activities Lectures Laboratory Molecular

More information

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000

More information

SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS

SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop

More information

Experimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis

Experimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing

More information

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit

SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow

More information

RNA Sequencing. Next gen insight into transcriptomes , Elio Schijlen

RNA Sequencing. Next gen insight into transcriptomes , Elio Schijlen RNA Sequencing Next gen insight into transcriptomes 05-06-2013, Elio Schijlen Transcriptome complete set of transcripts in a cell, and their quantity, for a specific developmental stage or physiological

More information

Total RNA isola-on End Repair of double- stranded cdna

Total RNA isola-on End Repair of double- stranded cdna Total RNA isola-on End Repair of double- stranded cdna mrna Isola8on using Oligo(dT) Magne8c Beads AAAAAAA A Adenyla8on (A- Tailing) A AAAAAAAAAAAA TTTTTTTTT AAAAAAA TTTTTTTTT TTTTTTTT TTTTTTTTT AAAAAAAA

More information

Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center

Considerations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping

More information

Transcriptome analysis

Transcriptome analysis Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize

More information

Advanced RNA-Seq course. Introduction. Peter-Bram t Hoen

Advanced RNA-Seq course. Introduction. Peter-Bram t Hoen Advanced RNA-Seq course Introduction Peter-Bram t Hoen Expression profiling DNA mrna protein Comprehensive RNA profiling possible: determine the abundance of all mrna molecules in a cell / tissue Expression

More information

Multiplexed Strand-specific RNA-Seq Library Preparation for Illumina Sequencing Platforms

Multiplexed Strand-specific RNA-Seq Library Preparation for Illumina Sequencing Platforms Multiplexed Strand-specific RNA-Seq Library Preparation for Illumina Sequencing Platforms Important Things to know before you start: This protocol generates strand-specific reads, but may lead to slightly

More information

RNA-Seq data analysis course September 7-9, 2015

RNA-Seq data analysis course September 7-9, 2015 RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive

More information

Joint RuminOmics/Rumen Microbial Genomics Network Workshop

Joint RuminOmics/Rumen Microbial Genomics Network Workshop Joint RuminOmics/Rumen Microbial Genomics Network Workshop Microbiome analysis - Amplicon sequencing Dr. Sinéad Waters Animal and Bioscience Research Department, Teagasc Grange, Ireland Prof. Leluo Guan

More information

Single Cell Transcriptomics scrnaseq

Single Cell Transcriptomics scrnaseq Single Cell Transcriptomics scrnaseq Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Purpose The sequencing of

More information

Matthew Tinning Australian Genome Research Facility. July 2012

Matthew Tinning Australian Genome Research Facility. July 2012 Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Complete Report Catalogue # and Service: IR16001 rrna depletion (human, mouse, or rat) IR11081 Total RNA Sequencing (80 million reads, 2x75 bp PE) Xxxxxxx - xxxxxxxxxxxxxxxxxxxxxx

More information

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center DNA Technologies & Expression Analysis Cores HT Sequencing (Illumina

More information

Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013

Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013 Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification

More information

1. Introduction Gene regulation Genomics and genome analyses

1. Introduction Gene regulation Genomics and genome analyses 1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing

More information

Wet-lab Considerations for Illumina data analysis

Wet-lab Considerations for Illumina data analysis Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina

More information

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013

Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance

More information

Applications of short-read

Applications of short-read Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Genome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression

Genome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression Genome Resequencing De novo genome Sequencing SNPs, Indels CNVs Rearrangements Metagenomics RNA-seq Gene Expression Splice Isoform Abundance High Throughput Short Read Sequencing: Illumina Exome Sequencing

More information

Introduction to Microbial Sequencing

Introduction to Microbial Sequencing Introduction to Microbial Sequencing Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu General rules for preparing

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq

Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments

More information

Finding Genes with Genomics Technologies

Finding Genes with Genomics Technologies PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License

More information

measuring gene expression December 5, 2017

measuring gene expression December 5, 2017 measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA

More information

Deep Sequencing technologies

Deep Sequencing technologies Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University

More information

RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)

RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS) RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their

More information

Genomic & RNA Profiling Core Facility

Genomic & RNA Profiling Core Facility Baylor College of Medicine Genomic & RNA Profiling Core Facility Services Price List Effective July 2018 PLEASE NOTE: All prices listed are for internal Baylor College of Medicine researchers with the

More information

Statistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies

Statistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies Statistical Genomics and Bioinformatics Workshop: Genetic Association and RNA-Seq Studies RNA Seq and Differential Expression Analysis Brooke L. Fridley, PhD University of Kansas Medical Center 1 Next-generation

More information

Library construction for nextgeneration sequencing: Overviews. and challenges

Library construction for nextgeneration sequencing: Overviews. and challenges Library construction for nextgeneration sequencing: Overviews and challenges During this time, as sequencing technologies have improved and evolved, so too have methods for preparing nucleic acids for

More information

Functional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq

Functional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Functional Genomics Research Stream Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Lab Issues Don t leave out boxes of water + ethidium bromide Minimize tip boxes in phenol waste

More information

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?

2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes? 2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics

More information

Next-generation sequencing technologies

Next-generation sequencing technologies Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read

More information

Supplementary Information for:

Supplementary Information for: Supplementary Information for: A streamlined and high-throughput targeting approach for human germline and cancer genomes using Oligonucleotide-Selective Sequencing Samuel Myllykangas 1, Jason D. Buenrostro

More information

Taking Advantage of Long RNA-Seq Reads. Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013

Taking Advantage of Long RNA-Seq Reads. Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013 Taking Advantage of Long RNA-Seq Reads Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013 Overview Proof-of-Principle SMART-cDNA Synthesis PB-SBL size distributions Gene Annotation

More information

ChIP-seq and RNA-seq

ChIP-seq and RNA-seq ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)

More information

ChIP-seq and RNA-seq. Farhat Habib

ChIP-seq and RNA-seq. Farhat Habib ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Obtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina

Obtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina be INSPIRED drive DISCOVERY stay GENINE TECHNICAL NOTE Directional rrna depletion Obtain superior NGS library performance with lower input amounts using the NEBNext ltra II Directional RNA Library Prep

More information

Obtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina

Obtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina be INSPIRED drive DISCOVERY stay GENINE TECHNICAL NOTE Directional rrna depletion Obtain superior NGS library performance with lower input amounts using the NEBNext ltra II Directional RNA Library Prep

More information

How to deal with your RNA-seq data?

How to deal with your RNA-seq data? How to deal with your RNA-seq data? Rachel Legendre, Thibault Dayris, Adrien Pain, Claire Toffano-Nioche, Hugo Varet École de bioinformatique AVIESAN-IFB 2017 1 Rachel Legendre Bioinformatics 27/11/2018

More information

Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento

Next generation sequencing techniques Toma Tebaldi Centre for Integrative Biology University of Trento Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento Mattarello September 28, 2009 Sequencing Fundamental task in modern biology read the information

More information

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA

SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation

More information

TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA

TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in

More information

Computational & Quantitative Biology Lecture 6 RNA Sequencing

Computational & Quantitative Biology Lecture 6 RNA Sequencing Peter A. Sims Dept. of Systems Biology Dept. of Biochemistry & Molecular Biophysics Sulzberger Columbia Genome Center October 27, 2014 Computational & Quantitative Biology Lecture 6 RNA Sequencing We Have

More information

Application of NGS (nextgeneration. for studying RNA regulation. Sung Wook Chi. Sungkyunkwan University (SKKU) Samsung Medical Center (SMC)

Application of NGS (nextgeneration. for studying RNA regulation. Sung Wook Chi. Sungkyunkwan University (SKKU) Samsung Medical Center (SMC) Application of NGS (nextgeneration sequencing) for studying RNA regulation Samsung Advanced Institute of Heath Sciences and Technology (SAIHST) Sungkyunkwan University (SKKU) Samsung Research Institute

More information

Experimental Design Microbial Sequencing

Experimental Design Microbial Sequencing Experimental Design Microbial Sequencing Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu General rules for preparing

More information

Analysis of RNA-seq Data

Analysis of RNA-seq Data Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,

More information

RNA-Seq analysis workshop

RNA-Seq analysis workshop RNA-Seq analysis workshop Zhangjun Fei Boyce Thompson Institute for Plant Research USDA Robert W. Holley Center for Agriculture and Health Cornell University Outline Background of RNA-Seq Application of

More information

Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.

Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART

More information

RNAseq Differential Gene Expression Analysis Report

RNAseq Differential Gene Expression Analysis Report RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample

More information

Illumina s Suite of Targeted Resequencing Solutions

Illumina s Suite of Targeted Resequencing Solutions Illumina s Suite of Targeted Resequencing Solutions Colin Baron Sr. Product Manager Sequencing Applications 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,

More information

Sequence Analysis 2RNA-Seq

Sequence Analysis 2RNA-Seq Sequence Analysis 2RNA-Seq Lecture 10 2/21/2018 Instructor : Kritika Karri kkarri@bu.edu Transcriptome Entire set of RNA transcripts in a given cell for a specific developmental stage or physiological

More information

CBC Data Therapy. Metatranscriptomics Discussion

CBC Data Therapy. Metatranscriptomics Discussion CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu

More information

RNA-Seq Analysis. Simon Andrews, Laura v

RNA-Seq Analysis. Simon Andrews, Laura v RNA-Seq Analysis Simon Andrews, Laura Biggins simon.andrews@babraham.ac.uk @simon_andrews v2018-10 RNA-Seq Libraries rrna depleted mrna Fragment u u u u NNNN Random prime + RT 2 nd strand synthesis (+

More information

To sequence or not to sequence is not a question anymore. BUT

To sequence or not to sequence is not a question anymore. BUT To sequence or not to sequence is not a question anymore. BUT Vladimír Beneš 21 June 2011 http://www.genecore.embl.de More data on their way to you! High GC High GC Low GC Low GC v3 flowcell imaged area

More information

How it All Works. Sample. Data analysis. Library Prepara>on. Sequencing

How it All Works. Sample. Data analysis. Library Prepara>on. Sequencing Library PREP How it All Works Extract DNA Fragment Sample Data analysis Sequencing Library Prepara>on Polymerase Chain Reaction Polymerase Chain Reaction Polymerase Chain Reaction Polymerase Chain Reaction

More information

An introduction to RNA-Seq. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station

An introduction to RNA-Seq. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station An introduction to RNA-Seq Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Doerge, R.W. 2002. Nature Reviews Genetics 3: 43-53. An introduction to RNA-Seq Tissue collection RNA

More information

Applications and Sample Preparation for SOLiD Runs

Applications and Sample Preparation for SOLiD Runs Applications and Sample Preparation for SOLiD Runs 1. ChIP-Seq 3. Whole Transcriptome 4. Small RNA Rob David Field Applications Specialist SOLiD Support MAGnify ChIP-Seq Overview Overview of MAGnify ChIP

More information

Bioinformatics Advice on Experimental Design

Bioinformatics Advice on Experimental Design Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics

More information

Genome Analyzer. RNA ChIP

Genome Analyzer. RNA ChIP Genome Analyzer 2009 11 26 2009 Illumina Inc All rights reserved 2009 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator, Sentrix, GoldenGate, GoldenGate

More information

An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy

An introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular

More information

Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis

Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis -Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification

More information

Introductory Next Gen Workshop

Introductory Next Gen Workshop Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012

Introduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012 Introduction to transcriptome analysis using High Throughput Sequencing technologies D. Puthier 2012 A typical RNA-Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

TECHNICAL NOTE Assay Scheme and Configuration of Chromium Single Cell V(D)J Libraries

TECHNICAL NOTE Assay Scheme and Configuration of Chromium Single Cell V(D)J Libraries TECHNICAL NOTE Assay Scheme and Configuration of Chromium Single Cell V(D)J Libraries INTRODUCTION The Chromium Single Cell V(D)J Solution produces Illumina sequencer-ready libraries for profiling T-cell

More information

Single Cell Genomics

Single Cell Genomics Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell

More information

RNA Sequencing: Experimental Planning and Data Analysis. Nadia Atallah September 12, 2018

RNA Sequencing: Experimental Planning and Data Analysis. Nadia Atallah September 12, 2018 RNA Sequencing: Experimental Planning and Data Analysis Nadia Atallah September 12, 2018 A Next Generation Sequencing (NGS) Refresher Became commercially available in 2005 Construction of a sequencing

More information

454 Sample Prep / Workflow at the BioMedical Genomics Center (BMGC) University of Minnesota. Sushmita Singh

454 Sample Prep / Workflow at the BioMedical Genomics Center (BMGC) University of Minnesota. Sushmita Singh 454 Sample Prep / Workflow at the BioMedical Genomics Center (BMGC) University of Minnesota Sushmita Singh 1 Consultation 2 Sample Prep (client) 3 Sample Prep (Core) Sequencing 4 Data QC 1 Consultation

More information

Genomic Resources and Gene/QTL Discovery in Livestock

Genomic Resources and Gene/QTL Discovery in Livestock Genomic Resources and Gene/QTL Discovery in Livestock Jerry Taylor University of Missouri FAO Intl Tech Conf on Agric Biotech in Dev Count, Guadalajara, March 2 nd 2010 5/7/2010 http://animalgenomics.missouri.edu

More information

Bioinformatics Monthly Workshop Series. Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory

Bioinformatics Monthly Workshop Series. Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory Bioinformatics Monthly Workshop Series Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory Schedule for Fall, 2015 PILM Bioinformatics Web Server (09/21/2015)

More information

Application of NGS (next-generation sequencing) for studying RNA regulation

Application of NGS (next-generation sequencing) for studying RNA regulation Application of NGS (next-generation sequencing) for studying RNA regulation SAIHST, SKKU Sung Wook Chi In this lecturre Intro: Sequencing Technology NGS (Next-Generation Sequencing) Sequencing of RNAs

More information

BST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1

BST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1 BST 226 Statistical Methods for Bioinformatics David M. Rocke March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1 NGS Technologies Illumina Sequencing HiSeq 2500 & MiSeq PacBio Sequencing PacBio

More information

Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit

Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit be INSPIRED drive DISCOVERY stay GENUINE TECHNICAL NOTE Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit Highly sensitive, robust generation of high quality

More information

Why QC? Next-Generation Sequencing: Quality Control. Illumina data format. Fastq format:

Why QC? Next-Generation Sequencing: Quality Control. Illumina data format. Fastq format: Why QC? Next-Generation Sequencing: Quality Control BaRC Hot Topics January 2017 Bioinformatics and Research Computing Whitehead Institute Do you want to include the reads with low quality base calls?

More information

High throughput DNA Sequencing. An Equal Opportunity University!

High throughput DNA Sequencing. An Equal Opportunity University! High throughput DNA Sequencing An Equal Opportunity University! irst Generation DNA sequencing utilize chain terminator technologies (adaptation of Sanger sequencing) Adapt fluorescence chemistry, high-resolution

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through

More information

Supplementary Information

Supplementary Information Supplementary Information Quantifying RNA allelic ratios by microfluidic multiplex PCR and sequencing Rui Zhang¹, Xin Li², Gokul Ramaswami¹, Kevin S Smith², Gustavo Turecki 3, Stephen B Montgomery¹, ²,

More information

cdna CaptureSeq Reveals unappreciated diversity of the transcriptome

cdna CaptureSeq Reveals unappreciated diversity of the transcriptome www.nimblegen.com cdna CaptureSeq Reveals unappreciated diversity of the transcriptome J.A. Jeddeloh, Ph.D. Director, Business Development, Roche NimbleGen jeffrey.jeddeloh@roche.com For Life Science Research

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy

More information

RNA-Sequencing analysis

RNA-Sequencing analysis RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges

More information

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia

RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior

More information

Next-Generation Sequencing: Quality Control

Next-Generation Sequencing: Quality Control Next-Generation Sequencing: Quality Control Bingbing Yuan BaRC Hot Topics January 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Why QC? Do you want to

More information

Single Cell Genomics

Single Cell Genomics Single Cell Genomics Application Cost Platform/Protocol Note 3 mrna-seq Cell capture/rt/library prep $1,990/Sample 10x Genomics Chromium 500-10,000 cells/sample 5 V(D)J + mrna Cell capture/rt/library prep

More information

Procedure & Checklist - Multiplex Isoform Sequencing (Iso-Seq Analysis)

Procedure & Checklist - Multiplex Isoform Sequencing (Iso-Seq Analysis) Procedure & Checklist - Multiplex Isoform Sequencing (Iso-Seq Analysis) Before You Begin Review the template preparation procedure for Iso-Seq analysis here. The procedure provides instructions for constructing

More information

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center DNA Technologies & Expression Analysis Cores HT Sequencing (Illumina

More information

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup

Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup 1. Introduction The data produced by IHEC is illustrated in Figure 1. Figure 1. The space of epigenomic

More information

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist

Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

The Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience

The Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience Building Excellence in Genomics and Computational Bioscience Wheat genome sequencing: an update from TGAC Sequencing Technology Development now Plant & Microbial Genomics Group Leader Matthew Clark matt.clark@tgac.ac.uk

More information

APPLICATION NOTE. Abstract. Introduction

APPLICATION NOTE. Abstract. Introduction From minuscule amounts to magnificent results: reliable ChIP-seq data from 1, cells with the True MicroChIP and the MicroPlex Library Preparation kits Abstract Diagenode has developed groundbreaking solutions

More information

Hashimshony, Wagner, Sher & Yanai. CEL-Seq: Single cell RNA-Seq by multiplexed linear amplification (Cell Reports).

Hashimshony, Wagner, Sher & Yanai. CEL-Seq: Single cell RNA-Seq by multiplexed linear amplification (Cell Reports). CEL-Seq Protocol Hashimshony, Wagner, Sher & Yanai. CEL-Seq: Single cell RNA-Seq by multiplexed linear amplification. 2012 (Cell Reports). Reagents: LoBind tubes 0.5 ml Eppendorf 022431005 Ultra pure RNase

More information

Chapter 7. DNA Microarrays

Chapter 7. DNA Microarrays Bioinformatics III Structural Bioinformatics and Genome Analysis Chapter 7. DNA Microarrays 7.9 Next Generation Sequencing 454 Sequencing Solexa Illumina Solid TM System Sequencing Process of determining

More information

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing

Gene Regulation Solutions. Microarrays and Next-Generation Sequencing Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene

More information

Evaluation of production efficiencies among primiparous suckler cows of diverse genotype at pasture

Evaluation of production efficiencies among primiparous suckler cows of diverse genotype at pasture Evaluation of production efficiencies among primiparous suckler cows of diverse genotype at pasture S. McCabe 1,2, N. McHugh 3, N. O Connell 2 and R. Prendiville 1 EAAP 67th Annual Meeting, Belfast, 29th

More information

The Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience

The Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience Building Excellence in Genomics and Computa5onal Bioscience Resequencing approaches Sarah Ayling Crop Genomics and Diversity sarah.ayling@tgac.ac.uk Why re- sequence plants? To iden

More information