Analysis of Differential Gene Expression in Cattle Using mrna-seq
|
|
- Tobias Henderson
- 6 years ago
- Views:
Transcription
1 Analysis of Differential Gene Expression in Cattle Using mrna-seq
2 mrna-seq A rough guide for green horns
3 Animal and Grassland Research and Innovation Centre Animal and Bioscience Research Department Teagasc, Grange, Dunsany, Co. Meath, Ireland
4 Animal and Bioscience Research Department (Grange site) Department head - Richard Dewhurst Research officers - Kieran Meade, David Kenny, Sinead Waters, Orla Keane, Bernie Early, Chris Creevey, David Lynn Research technologists - Matt McCabe
5 NGS Technologies Illumina (Solexa) Genome Analyser II (GAII) UCD, Conway. (part-owned by Teagasc) Roche 454 FLX Teagasc Moorepark
6 Progress 86 polya RNA-seq libraries SR = 12 liver, 48 leukocyte, 21 hypothalamus PE = 5 pooled sheep lymphocyte 14 mi/piwi RNA libraries 16 pooled target enriched DNA libraries Shotgun rumen metagenomic libraries
7 Important traits Feed efficiency Milk yield Fertility Disease resistance
8 Negative energy balance Metabolic disorder affecting high yielding dairy cows in the post partum period imbalance between energy intake and energy requirements for lactation and body maintenance.
9 McCarthy et al. (2010) 12 multiparous cows (parity no. = ) selected randomly from a pool of 24 Holstein-Friesians with average lactation yield of kg Treatment applied morning after 2 nd or 3 rd milking post-parturition MNEB 6 cows were fed grass silage ad libitum with 8 kg/day of a 21% crude protein dairy concentrate and milked once daily SNEB 6 cows were fed 25 kg/day silage with 4 kg/day concentrate and milked 3 x daily Energy balance was calculated Cows slaughtered on days 6-7 of the first follicular wave after calving RNA extracted from endometrium, spleen, liver
10 1 2 3 DNA primary-mrna cytoplasm 5 CAP mature-mrna AAAAA AAAAA AAAAA nucleus 1 3 AAAAA AAAAA
11 Library preparation UCD protocol using individually purchased reagents from Invitrogen and NEB
12 1. 10 ug total RNA (RIN ~ 8.0) 6. End repair (Klenow T4 and E. coli polymerase) 2. mrna (Dynal oligo(dt) beads AAAAA 3. Fragment mrna (Zinc) 4. First strand cdna synth (Superscript II) AAAAA TTTTT 5. Second strand cdna synth 7. Add a single A base A 8. Ligate adaptors T A 9. Gel purify bp adaptor ligated fragments? 10. PCR amplify (12-18 cycles), quantify on Qubit Fluorometer A A T TTTTTTT AAAAA
13 Cattle leukocyte SR mrna library preps Aran O Loughlin Yields = ng/ul (Qubit)
14 Single Read Library Adapter Sequence Adapter: 5' ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) ' 3' TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) ' Adapter: 5' (-) pgatcggaagagctcgtatg CCGTCTTCTGCTTG 3' 3' (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5' PCR Primer: 5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) ' 3' (-) PCR Primer: 5' (-) ' 3' (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5 Result Library: 5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (N) AGATCGGAAGAGCTCGTATG CCGTCTTCTGCTTG 3' 3' TTACTATGCCGCTGGTGGCT CTAGATGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGA (N) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5 Genomic DNA Sequencing Primer: 5' ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) ' 3' (-) '
15 Paired end mrna seq library prep
16 Cattle leukocyte mrna library preps Sheep lymphocyte PE mrna library preps
17 How much coverage? Haploid bovine genome ~2.87 Gb (Elsik et al, 2009) 22,000 protein coding genes 180,000 protein coding exons (~30 Mb) 30 Mb/36 bp reads = 0.83 M reads for 1x coverage Rare transcripts +5 and 3 UTRs? Alternatively spliced isoforms Only 70% reads align to the bovine genome
18 Ran 12 libraries on 3 flowcells libraries 1-6 = MNEB libraries 7-12 = SNEB Lane Flowcell 1 Flowcell 2 Flowcell 3 1 library 1 (4.5 pm)* library 12 (5.5 pm)* library 2 (5.5 pm)* 2 library 1 (5.0 pm)* library 6 (5.5 pm)* library 3 (5.5 pm) 3 library 5 (5.5 pm)* library 2 (5.5 pm)* library 6 (5.5 pm)* 4 library 5 (6.0 pm)* library 7 (5.5 pm)* library 7 (5.5 pm)* 5 library 10 (4.0 pm)* library 9 (5.5 pm) PhiX 6 PhiX PhiX library 8 (5.5 pm) 7 library 10 (5.5 pm)* library 11 (5.5 pm)* library 11 (5.5 pm)* 8 library 10 (6.5 pm)* library 4 (5.5 pm) library 12 (5.5 pm)*
19 Bowtie Alignment (to BCM4) TopHat Splice junction mapper Cufflinks Assembles aligned reads into transcripts Computes expression values
20 Cufflinks
21 1 2 3
22 Short SR 1 2 3
23 Short SR 1 2 3
24 Short SR 1 2 3
25 Alternatively spliced isoforms
26 Alternative splicing predictions generated by Tophat Displayed on Integrative Genomics Viewer
27 Summary data (average for 21 lanes) Total number of reads 13,664,739 Reads with only one alignment and no duplicates 8,539,432 (62%) Number of islands detected 212,491 Number of exon/exon junctions detected 19,606
28 # of unique splice junctions detected for all 21 lanes Total Alternative splicing # of splice junctions for the exon
29 Short PE sequencing 1 2 3
30 Long PE sequencing 1 2 3
31 COST Sequencing kit = 1K SR cluster gen kit = 2K PE cluster gen kit = 4K Short SR = 1 seq kit + 1 SR cluster kit = 3K Long SR = 2 seq kits + 1 SR cluster kit = 4K Short PE = 2 seq kits + 1 PE cluster kit = 6K Long PE = 4 seq kits + 1 PE cluster kit = 8K
32 Microarray vs. mrnaseq RNAseq = 16,720 genes Microarray analysis = 12,679 genes RNAseq + microarray = 10,950 genes RNAseq only = 5,770 genes Microarray analysis only = 1,729 genes
33 Analysis of significantly differentially expressed genes in MNEB and SNEB animals
34 Analysis of significantly differentially expressed genes in MNEB and SNEB animals Expression values FPKM calculated using Cufflinks (Fragments Per Kilobase of exon per Million fragments mapped)
35 FPKM values
36 PCA of FPKM values in all lanes in mild (M) and severe (S) NEB animals
37
38 Analysis of significantly differentially expressed genes in MNEB and SNEB animals 348 SDE genes (<FDR 0.05) 438 SDE genes (<FDR 0.1)
39 Analysis of significantly differentially expressed genes in MNEB and SNEB animals 348 SDE genes (<FDR 0.05) 438 SDE genes (<FDR 0.1) SDE of 350 of these genes was also shown in the microarray
40 Correlation of 350 SDGEs in Microarray and mrnaseq
41 Lane effect Used Edge R to compare FPKM values of libraries run on 2 lanes Libraries 2,5,6,7,9,10,11,12 (1st lane) vs. Libraries 2,5,6,7,9,10,11,12 (2nd lane) found 40 differentially expressed genes!!!
42 Lane effect
43 Pathway analysis IPA analysis of microarray and RNAseq data show same top networks affected by SNEB Innate DB analysis GOseq
44 What next FRT-Seq??
45 Acknowledgements Chris Creevey, David Lynn - Teagasc Paul Cormican -Trinity Amanda Lohan, Alison Murphy - UCD Elaine Kenny -Trinity Sinead Waters, Sean McArthy, Dermot Morris -Teagasc
Wheat CAP Gene Expression with RNA-Seq
Wheat CAP Gene Expression with RNA-Seq July 9 th -13 th, 2018 Overview of the workshop, Alina Akhunova http://www.ksre.k-state.edu/igenomics/workshops/ RNA-Seq Workshop Activities Lectures Laboratory Molecular
More informationHigh Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000
More informationSO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop
More informationExperimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis
Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing
More informationSOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit
SOLiD Total RNA-Seq Kit SOLiD RNA Barcoding Kit Agenda SOLiD Total RNAseq Kit Overview Kit Configurations Barcoding Kit Introduction New Small RNA and WT Workflow Small RNA Workflow Step-by-step Workflow
More informationRNA Sequencing. Next gen insight into transcriptomes , Elio Schijlen
RNA Sequencing Next gen insight into transcriptomes 05-06-2013, Elio Schijlen Transcriptome complete set of transcripts in a cell, and their quantity, for a specific developmental stage or physiological
More informationTotal RNA isola-on End Repair of double- stranded cdna
Total RNA isola-on End Repair of double- stranded cdna mrna Isola8on using Oligo(dT) Magne8c Beads AAAAAAA A Adenyla8on (A- Tailing) A AAAAAAAAAAAA TTTTTTTTT AAAAAAA TTTTTTTTT TTTTTTTT TTTTTTTTT AAAAAAAA
More informationConsiderations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center
Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping
More informationTranscriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
More informationAdvanced RNA-Seq course. Introduction. Peter-Bram t Hoen
Advanced RNA-Seq course Introduction Peter-Bram t Hoen Expression profiling DNA mrna protein Comprehensive RNA profiling possible: determine the abundance of all mrna molecules in a cell / tissue Expression
More informationMultiplexed Strand-specific RNA-Seq Library Preparation for Illumina Sequencing Platforms
Multiplexed Strand-specific RNA-Seq Library Preparation for Illumina Sequencing Platforms Important Things to know before you start: This protocol generates strand-specific reads, but may lead to slightly
More informationRNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
More informationJoint RuminOmics/Rumen Microbial Genomics Network Workshop
Joint RuminOmics/Rumen Microbial Genomics Network Workshop Microbiome analysis - Amplicon sequencing Dr. Sinéad Waters Animal and Bioscience Research Department, Teagasc Grange, Ireland Prof. Leluo Guan
More informationSingle Cell Transcriptomics scrnaseq
Single Cell Transcriptomics scrnaseq Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Purpose The sequencing of
More informationMatthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
More informationNext Generation Sequencing
Next Generation Sequencing Complete Report Catalogue # and Service: IR16001 rrna depletion (human, mouse, or rat) IR11081 Total RNA Sequencing (80 million reads, 2x75 bp PE) Xxxxxxx - xxxxxxxxxxxxxxxxxxxxxx
More informationHigh Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center DNA Technologies & Expression Analysis Cores HT Sequencing (Illumina
More informationIntegrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification
More information1. Introduction Gene regulation Genomics and genome analyses
1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing
More informationWet-lab Considerations for Illumina data analysis
Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More informationApplications of short-read
Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationGenome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression
Genome Resequencing De novo genome Sequencing SNPs, Indels CNVs Rearrangements Metagenomics RNA-seq Gene Expression Splice Isoform Abundance High Throughput Short Read Sequencing: Illumina Exome Sequencing
More informationIntroduction to Microbial Sequencing
Introduction to Microbial Sequencing Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu General rules for preparing
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationSequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq
Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments
More informationFinding Genes with Genomics Technologies
PLNT2530 Plant Biotechnology (2018) Unit 7 Finding Genes with Genomics Technologies Unless otherwise cited or referenced, all content of this presenataion is licensed under the Creative Commons License
More informationmeasuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
More informationDeep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
More informationRNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)
RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their
More informationGenomic & RNA Profiling Core Facility
Baylor College of Medicine Genomic & RNA Profiling Core Facility Services Price List Effective July 2018 PLEASE NOTE: All prices listed are for internal Baylor College of Medicine researchers with the
More informationStatistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies
Statistical Genomics and Bioinformatics Workshop: Genetic Association and RNA-Seq Studies RNA Seq and Differential Expression Analysis Brooke L. Fridley, PhD University of Kansas Medical Center 1 Next-generation
More informationLibrary construction for nextgeneration sequencing: Overviews. and challenges
Library construction for nextgeneration sequencing: Overviews and challenges During this time, as sequencing technologies have improved and evolved, so too have methods for preparing nucleic acids for
More informationFunctional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq
Functional Genomics Research Stream Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Lab Issues Don t leave out boxes of water + ethidium bromide Minimize tip boxes in phenol waste
More information2/5/16. Honeypot Ants. DNA sequencing, Transcriptomics and Genomics. Gene sequence changes? And/or gene expression changes?
2/5/16 DNA sequencing, Transcriptomics and Genomics Honeypot Ants "nequacatl" BY2208, Mani Lecture 3 Gene sequence changes? And/or gene expression changes? gene expression differences DNA sequencing, Transcriptomics
More informationNext-generation sequencing technologies
Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read
More informationSupplementary Information for:
Supplementary Information for: A streamlined and high-throughput targeting approach for human germline and cancer genomes using Oligonucleotide-Selective Sequencing Samuel Myllykangas 1, Jason D. Buenrostro
More informationTaking Advantage of Long RNA-Seq Reads. Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013
Taking Advantage of Long RNA-Seq Reads Vince Magrini Pacific Biosciences User Group Meeting September 18, 2013 Overview Proof-of-Principle SMART-cDNA Synthesis PB-SBL size distributions Gene Annotation
More informationChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationObtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina
be INSPIRED drive DISCOVERY stay GENINE TECHNICAL NOTE Directional rrna depletion Obtain superior NGS library performance with lower input amounts using the NEBNext ltra II Directional RNA Library Prep
More informationObtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina
be INSPIRED drive DISCOVERY stay GENINE TECHNICAL NOTE Directional rrna depletion Obtain superior NGS library performance with lower input amounts using the NEBNext ltra II Directional RNA Library Prep
More informationHow to deal with your RNA-seq data?
How to deal with your RNA-seq data? Rachel Legendre, Thibault Dayris, Adrien Pain, Claire Toffano-Nioche, Hugo Varet École de bioinformatique AVIESAN-IFB 2017 1 Rachel Legendre Bioinformatics 27/11/2018
More informationNext generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento
Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento Mattarello September 28, 2009 Sequencing Fundamental task in modern biology read the information
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationTECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in
More informationComputational & Quantitative Biology Lecture 6 RNA Sequencing
Peter A. Sims Dept. of Systems Biology Dept. of Biochemistry & Molecular Biophysics Sulzberger Columbia Genome Center October 27, 2014 Computational & Quantitative Biology Lecture 6 RNA Sequencing We Have
More informationApplication of NGS (nextgeneration. for studying RNA regulation. Sung Wook Chi. Sungkyunkwan University (SKKU) Samsung Medical Center (SMC)
Application of NGS (nextgeneration sequencing) for studying RNA regulation Samsung Advanced Institute of Heath Sciences and Technology (SAIHST) Sungkyunkwan University (SKKU) Samsung Research Institute
More informationExperimental Design Microbial Sequencing
Experimental Design Microbial Sequencing Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu General rules for preparing
More informationAnalysis of RNA-seq Data
Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,
More informationRNA-Seq analysis workshop
RNA-Seq analysis workshop Zhangjun Fei Boyce Thompson Institute for Plant Research USDA Robert W. Holley Center for Agriculture and Health Cornell University Outline Background of RNA-Seq Application of
More informationNovel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
More informationRNAseq Differential Gene Expression Analysis Report
RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample
More informationIllumina s Suite of Targeted Resequencing Solutions
Illumina s Suite of Targeted Resequencing Solutions Colin Baron Sr. Product Manager Sequencing Applications 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationSequence Analysis 2RNA-Seq
Sequence Analysis 2RNA-Seq Lecture 10 2/21/2018 Instructor : Kritika Karri kkarri@bu.edu Transcriptome Entire set of RNA transcripts in a given cell for a specific developmental stage or physiological
More informationCBC Data Therapy. Metatranscriptomics Discussion
CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu
More informationRNA-Seq Analysis. Simon Andrews, Laura v
RNA-Seq Analysis Simon Andrews, Laura Biggins simon.andrews@babraham.ac.uk @simon_andrews v2018-10 RNA-Seq Libraries rrna depleted mrna Fragment u u u u NNNN Random prime + RT 2 nd strand synthesis (+
More informationTo sequence or not to sequence is not a question anymore. BUT
To sequence or not to sequence is not a question anymore. BUT Vladimír Beneš 21 June 2011 http://www.genecore.embl.de More data on their way to you! High GC High GC Low GC Low GC v3 flowcell imaged area
More informationHow it All Works. Sample. Data analysis. Library Prepara>on. Sequencing
Library PREP How it All Works Extract DNA Fragment Sample Data analysis Sequencing Library Prepara>on Polymerase Chain Reaction Polymerase Chain Reaction Polymerase Chain Reaction Polymerase Chain Reaction
More informationAn introduction to RNA-Seq. Brian J. Knaus USDA Forest Service Pacific Northwest Research Station
An introduction to RNA-Seq Brian J. Knaus USDA Forest Service Pacific Northwest Research Station 1 Doerge, R.W. 2002. Nature Reviews Genetics 3: 43-53. An introduction to RNA-Seq Tissue collection RNA
More informationApplications and Sample Preparation for SOLiD Runs
Applications and Sample Preparation for SOLiD Runs 1. ChIP-Seq 3. Whole Transcriptome 4. Small RNA Rob David Field Applications Specialist SOLiD Support MAGnify ChIP-Seq Overview Overview of MAGnify ChIP
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationGenome Analyzer. RNA ChIP
Genome Analyzer 2009 11 26 2009 Illumina Inc All rights reserved 2009 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator, Sentrix, GoldenGate, GoldenGate
More informationAn introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy
An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular
More informationExperimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies. D. Puthier 2012
Introduction to transcriptome analysis using High Throughput Sequencing technologies D. Puthier 2012 A typical RNA-Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationTECHNICAL NOTE Assay Scheme and Configuration of Chromium Single Cell V(D)J Libraries
TECHNICAL NOTE Assay Scheme and Configuration of Chromium Single Cell V(D)J Libraries INTRODUCTION The Chromium Single Cell V(D)J Solution produces Illumina sequencer-ready libraries for profiling T-cell
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
More informationRNA Sequencing: Experimental Planning and Data Analysis. Nadia Atallah September 12, 2018
RNA Sequencing: Experimental Planning and Data Analysis Nadia Atallah September 12, 2018 A Next Generation Sequencing (NGS) Refresher Became commercially available in 2005 Construction of a sequencing
More information454 Sample Prep / Workflow at the BioMedical Genomics Center (BMGC) University of Minnesota. Sushmita Singh
454 Sample Prep / Workflow at the BioMedical Genomics Center (BMGC) University of Minnesota Sushmita Singh 1 Consultation 2 Sample Prep (client) 3 Sample Prep (Core) Sequencing 4 Data QC 1 Consultation
More informationGenomic Resources and Gene/QTL Discovery in Livestock
Genomic Resources and Gene/QTL Discovery in Livestock Jerry Taylor University of Missouri FAO Intl Tech Conf on Agric Biotech in Dev Count, Guadalajara, March 2 nd 2010 5/7/2010 http://animalgenomics.missouri.edu
More informationBioinformatics Monthly Workshop Series. Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory
Bioinformatics Monthly Workshop Series Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory Schedule for Fall, 2015 PILM Bioinformatics Web Server (09/21/2015)
More informationApplication of NGS (next-generation sequencing) for studying RNA regulation
Application of NGS (next-generation sequencing) for studying RNA regulation SAIHST, SKKU Sung Wook Chi In this lecturre Intro: Sequencing Technology NGS (Next-Generation Sequencing) Sequencing of RNAs
More informationBST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1
BST 226 Statistical Methods for Bioinformatics David M. Rocke March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1 NGS Technologies Illumina Sequencing HiSeq 2500 & MiSeq PacBio Sequencing PacBio
More informationIncreased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit
be INSPIRED drive DISCOVERY stay GENUINE TECHNICAL NOTE Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit Highly sensitive, robust generation of high quality
More informationWhy QC? Next-Generation Sequencing: Quality Control. Illumina data format. Fastq format:
Why QC? Next-Generation Sequencing: Quality Control BaRC Hot Topics January 2017 Bioinformatics and Research Computing Whitehead Institute Do you want to include the reads with low quality base calls?
More informationHigh throughput DNA Sequencing. An Equal Opportunity University!
High throughput DNA Sequencing An Equal Opportunity University! irst Generation DNA sequencing utilize chain terminator technologies (adaptation of Sanger sequencing) Adapt fluorescence chemistry, high-resolution
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through
More informationSupplementary Information
Supplementary Information Quantifying RNA allelic ratios by microfluidic multiplex PCR and sequencing Rui Zhang¹, Xin Li², Gokul Ramaswami¹, Kevin S Smith², Gustavo Turecki 3, Stephen B Montgomery¹, ²,
More informationcdna CaptureSeq Reveals unappreciated diversity of the transcriptome
www.nimblegen.com cdna CaptureSeq Reveals unappreciated diversity of the transcriptome J.A. Jeddeloh, Ph.D. Director, Business Development, Roche NimbleGen jeffrey.jeddeloh@roche.com For Life Science Research
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory http://collaboratory.lifesci.ucla.edu Workshop Outline ü Day 1 UCLA galaxy
More informationRNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
More informationRNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
More informationNext-Generation Sequencing: Quality Control
Next-Generation Sequencing: Quality Control Bingbing Yuan BaRC Hot Topics January 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Why QC? Do you want to
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protocol Note 3 mrna-seq Cell capture/rt/library prep $1,990/Sample 10x Genomics Chromium 500-10,000 cells/sample 5 V(D)J + mrna Cell capture/rt/library prep
More informationProcedure & Checklist - Multiplex Isoform Sequencing (Iso-Seq Analysis)
Procedure & Checklist - Multiplex Isoform Sequencing (Iso-Seq Analysis) Before You Begin Review the template preparation procedure for Iso-Seq analysis here. The procedure provides instructions for constructing
More informationHigh Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center DNA Technologies & Expression Analysis Cores HT Sequencing (Illumina
More informationData and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup
Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup 1. Introduction The data produced by IHEC is illustrated in Figure 1. Figure 1. The space of epigenomic
More informationWhole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationThe Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience
Building Excellence in Genomics and Computational Bioscience Wheat genome sequencing: an update from TGAC Sequencing Technology Development now Plant & Microbial Genomics Group Leader Matthew Clark matt.clark@tgac.ac.uk
More informationAPPLICATION NOTE. Abstract. Introduction
From minuscule amounts to magnificent results: reliable ChIP-seq data from 1, cells with the True MicroChIP and the MicroPlex Library Preparation kits Abstract Diagenode has developed groundbreaking solutions
More informationHashimshony, Wagner, Sher & Yanai. CEL-Seq: Single cell RNA-Seq by multiplexed linear amplification (Cell Reports).
CEL-Seq Protocol Hashimshony, Wagner, Sher & Yanai. CEL-Seq: Single cell RNA-Seq by multiplexed linear amplification. 2012 (Cell Reports). Reagents: LoBind tubes 0.5 ml Eppendorf 022431005 Ultra pure RNase
More informationChapter 7. DNA Microarrays
Bioinformatics III Structural Bioinformatics and Genome Analysis Chapter 7. DNA Microarrays 7.9 Next Generation Sequencing 454 Sequencing Solexa Illumina Solid TM System Sequencing Process of determining
More informationGene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
More informationEvaluation of production efficiencies among primiparous suckler cows of diverse genotype at pasture
Evaluation of production efficiencies among primiparous suckler cows of diverse genotype at pasture S. McCabe 1,2, N. McHugh 3, N. O Connell 2 and R. Prendiville 1 EAAP 67th Annual Meeting, Belfast, 29th
More informationThe Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience
Building Excellence in Genomics and Computa5onal Bioscience Resequencing approaches Sarah Ayling Crop Genomics and Diversity sarah.ayling@tgac.ac.uk Why re- sequence plants? To iden
More information