NEXTFLEX Small RNA Barcode Primers - Set A (For Illumina Platforms) Catalog #NOVA (Kit contains 96 reactions)

Transcription

1 NEXTFLEX Small RNA Barcode Primers - Set A (For Illumina Platforms) Catalog #NOVA (Kit contains 96 reactions) Bioo Scientific Corp V14.07

2 This product is for research use only. Not for use in diagnostic procedures. This manual is proprietary to Bioo Scientific Corp., and intended only for customer use in connection with the product(s) described herein and for no other purpose. This document and its contents shall not be used or distributed for any other purpose without the prior written consent of Bioo Scientific. Follow the protocol included with the kit. Bioo Scientific, NEXTflex, NextPrep, NextPrep-Mag, AIR, The NGS Experts, qrna, Amplicon Studio, and NanoQ are trademarks or registered trademarks of Bioo Scientific. All other brands and names contained herein are the property of their respective owners.

3 NEXTflex Small RNA Barcode Primers Set A GENERAL INFORMATION 2 Product Overview 2 Contents, Storage and Shelf Life 2 Warnings and Precautions 2 APPENDIX A 3 Oligonucleotide Sequences 3 RELATED PRODUCTS 4 SELECTED REFERENCES 7 NOTES 8 THE NGS EXPERTS 1

4 GENERAL INFORMATION Product Overview The NEXTflex Small RNA Barcode Primers are designed to prepare multiplexed small RNA libraries for sequencing using Illumina platforms. The index is designed within the NEXTflex barcode primers and incorporated during PCR. Pooling of samples may be performed either after PCR or after gel validation. Contents, Storage and Shelf Life The NEXTflex Small RNA Barcode Primers contain 12 barcoded primers with enough material for 8 reactions each when using the NEXTflex Small RNA Sequencing Kit v2 (catalog numbers and ) or 4 reactions each when using the NEXTflex Small RNA Sequencing Kit* (catalog numbers and ). The shelf life of all reagents is 12 months when stored at -20 C. *If using the NEXTflex Small RNA Sequencing Kit (catalog numbers and ) please make sure to use manual version or later. Please contact Bioo Scientific at the phone number or address shown at the end of this document for the latest manual. Kit Contents Amount NEXTflex Barcode Primer µl Warnings and Precautions Bioo Scientific strongly recommends that you read the following warnings and precautions. Periodically, optimizations and revisions are made to the components and manual. Therefore, it is important to follow the protocol included with the kit. If you need further assistance, you may contact your local distributor or Bioo Scientific at nextgen@biooscientific.com. Do not use the kit past the expiration date. Try to maintain a laboratory temperature of C (68 77 F). Vortex and micro centrifuge each tube prior to use, to ensure material has not lodged in the cap or the side of the tube. 2

5 APPENDIX A Oligonucleotide Sequences NAME SEQUENCE (5 3 ) NEXTflex Barcode Primer CAAGCAGAAGACGGCATACGAGATXXXXXX 1 GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA 1 XXXXXX denotes the index region of adapter. The index sequences and their respective reverse complements of each primer are listed below. NEXTflex Barcode Primer Barcode Sequence Reverse Complement* Barcode Primer 1 CGTGAT ATCACG Barcode Primer 2 ACATCG CGATGT Barcode Primer 3 GCCTAA TTAGGC Barcode Primer 4 TGGTCA TGACCA Barcode Primer 5 CACTGT ACAGTG Barcode Primer 6 ATTGGC GCCAAT Barcode Primer 7 GATCTG CAGATC Barcode Primer 8 TCAAGT ACTTGA Barcode Primer 9 CTGATC GATCAG Barcode Primer 10 AAGCTA TAGCTT Barcode Primer 11 GTAGCC GGCTAC Barcode Primer 12 TACAAG CTTGTA *The reverse complement is the sequence that is reported in the index read. THE NGS EXPERTS 3

6 RELATED PRODUCTS Illumina Compatible RNA NGS Kits and Adapters Catalog # Product NEXTflex Rapid RNA-Seq Kit (8 reactions) NEXTflex Rapid RNA-Seq Kit (48 reactions) NEXTflex Rapid Directional RNA-Seq Kit (8 reactions) NEXTflex Rapid Directional RNA-Seq Kit (48 reactions) NEXTflex RNA-Seq Barcodes NEXTflex RNA-Seq Barcodes NEXTflex RNA-Seq Barcodes NEXTflex RNA-Seq Barcodes NEXTflex-96 RNA-Seq Barcodes NEXTflex qrna-seq Kit 4 barcodes (8 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set A (48 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set B (48 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set C (48 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set D (48 reactions) D NEXTflex Rapid Directional qrna-seq Kit 4 barcodes (8 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set A (48 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set B (48 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set C (48 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set D (48 reactions) NEXTflex Small RNA Sequencing Kit (24 reactions) NEXTflex Small RNA Sequencing Kit (48 reactions) NEXTflex Small RNA Sequencing Kit v2 (24 reactions) NEXTflex Small RNA Sequencing Kit v2 (48 reactions) NEXTlfex Small RNA Barcode Primers -12 (Set A) NEXTlfex Small RNA Barcode Primers -12 (Set B) NEXTlfex Small RNA Barcode Primers -12 (Set C) NEXTlfex Small RNA Barcode Primers -12 (Set D) NEXTflex Poly(A) Beads (8 reactions) NEXTflex Poly(A) Beads (48 reactions) NEXTflex Poly(A) Beads (100 reactions) 4

7 Illumina Compatible DNA NGS Kits and Adapters Catalog # Product NEXTflex 16S V4 Amplicon-Seq Kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTlfex 16S V1-V3 Amplicon-Seq Kit NEXTflex DNA Sequencing Kit (8 reactions) NEXTflex DNA Sequencing Kit (48 reactions) NEXTflex Rapid DNA-Seq Kit (8 reactions) NEXTflex Rapid DNA-Seq Kit (48 reactions) NEXTflex Cell Free DNA-Seq Kit (8 reactions) NEXTflex Cell Free DNA-Seq Kit (48 reactions) NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex-96 DNA Barcodes (Plate Format) NEXTflex-96 DNA Barcodes (Tube Format) NEXTflex Dual-Indexed DNA Barcodes (1-96) NEXTflex Dual-Indexed DNA Barcodes (97-192) NEXTflex Bisulfite-Seq kit (8 reactions) NEXTflex Bisulfite-Seq kit (48 reactions) NEXTflex Bisulfite-Seq Barcodes NEXTflex Bisulfite-Seq Barcodes NEXTflex Bisulfite-Seq Barcodes NEXTflex Methyl-Seq 1 Kit (8 reactions) NEXTflex Methyl-Seq 1 Kit (48 reactions) THE NGS EXPERTS 5

8 NEXTflex Msp 1 (8 reactions) NEXTflex Msp 1 (48 reactions) NEXTflex ChIP-Seq Kit (8 reactions) NEXTflex ChIP-Seq Kit (48 reactions) NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex-96 ChIP-Seq Barcodes NEXTflex Pre-Capture Combo Kit (6 barcodes) NEXTflex Pre-Capture Combo Kit (12 barcodes) NEXTflex Pre-Capture Combo Kit (24 barcodes) NEXTflex Pre-Capture Combo Kit (48 barcodes) NEXTflex Pre-Capture Combo Kit (96 barcodes) NEXTflex DNA Barcode Blockers - 6 for SeqCap NEXTflex DNA Barcode Blockers - 12 for SeqCap NEXTflex DNA Barcode Blockers - 24 for SeqCap NEXTflex DNA Barcode Blockers - 48 for SeqCap NEXTflex DNA Barcode Blockers - 96 for SeqCap NEXTflex PCR-Free DNA Sequencing Kit (8 reactions) NEXTflex PCR-Free DNA Sequencing Kit (48 reactions) NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes 48 DNA Fragmentation Catalog # Product AIR DNA Fragmentation Kit (10 reactions) AIR DNA Fragmentation Kit (40 reactions) 6

9 SELECTED REFERENCES 1. Nakashe, P. et al. (2011) Adapter Dimer Reduction in High-Throughput microrna Profiling. OMICS 1(1): THE NGS EXPERTS 7

10 NOTES 8

11 WE WANT TO HEAR FROM YOU! Your feedback is important to us. Tell us what you think of our kits by scanning the QR code or visiting our website at We can t wait to hear from you!

12 THE NGS EXPERTS Bioo Scientific Corporation 7050 Burleson Road, Austin, Texas BiooScientific.com P: F: Bioo Research Products Group Made in the USA