Supporting Information
|
|
- Gabriella Benson
- 5 years ago
- Views:
Transcription
1 Supporting Informtion Time-Resolved Fluorescent Detection of Hg 2+ in Complex Environment y Conjugting Mgnetic Nnoprticles with Triplehelix Moleculr Switch Jing Zheng, Yuhong Nie, Yping Hu, Jishn Li, Yinhui Li, Ying Jing, Ronghu Yng Stte Key Lortory of Chemo/Biosensing nd Chemometrics, College of Chemistry nd Chemicl Engineering, nd College of Mterils nd Engineering, Hunn University, Chngsh , P. R. Chin Experimentl Section: Mterils nd Apprtus. Oligonucleotides used in this study were synthesized y Tkr Biotechnology Co., Ltd. (Dlin, Chin), nd the sequences of ll oligonucleotides (P1-P4) re listed in Tle S1. We otined the stock solution of the oligonucleotides in highly pure wter (sterile Minipore wter, 18.3 MΩ), the DNA concentrtions were estimted y UV sorption using pulished sequence-dependent sorption coefficients. 1 Streptvidin-coted iron oxide nnoprticles of 30 nm were otined from Ocen Nnotech. All work solutions were prepred with MOPS uffer (ph 6.0, 20 mm, 5 mm NNO 3, 5 mm Mg(NO 3 ) 2 ). UV-Vis sorption spectr were recorded in 1.0 cm pth length qurtz cuvettes on Hitchi U-3010 UV/Vis spectrophotometer (Kyoto, Jpn). Both stedy-stted fluorescence nd time-resolved fluorescence were mesured on PTI QM4 Fluorescence System (Photo Technology Interntionl, Birminghm, NJ) with n ccessory of temperture controller. Fluorescence emission spectr were collected S1
2 using ndwidth of 5 nm nd cm 2 qurtz cuvettes contining 500 μl of solution. ph ws mesured y model 868 ph meter (Orion). Conjugtion of Cpture Proes on Mgnetic Nnoprticles. In order to conjugte complementry sequence of MSO (P4, s listed in Tle S1) on the MNPs, the streptvidin-coted iron oxide nnoprticles were dispersed t 0.1 mg/ml in 100 mm phosphte-uffered sline (PBS), ph 7.4. An excess mount of iotin-leled P4 ws then dded. The mixtures were vortexed t room temperture for 1 h followed y wshing 3 times with PBS uffer using centrifugtion t rpm to remove ny P4 tht did not conjugte to the MNPs. The conjugtes were dispersed in PBS nd stored t 4 C. Kinetics Studies. To study the kinetics nd time-dependence of the interctions of THMS nd susequent Hg 2+, the excimer fluorescence intensity of P2 t 458 nm ws recorded. The excimer fluorescence of 500 μl P2 (100 nm) ws monitored for few minutes. Then, MSO ws dded to the MOPS uffer nd the finl concentrtion ws 120 nm, excimer fluorescence ws mesured t room temperture. After confirming tht there ws no chnge of fluorescence with time, P4, Hg 2+ were dded nd the finl concentrtion ws 120 nm nd 2.5 μm, respectively, nd the level of fluorescence ws then recorded with time. Performnce of Hg 2+ Detection. The THMS complex ws formed in the MOPS uffer y dding few μl of P3 to 0.5 ml of 100 nm P2 in centrifuge tue, the ddition ws limited to 25 μl so tht the volume chnge ws insignificnt. For Hg 2+ detection, 400 μl of the THMS formed y P2 nd P3 ws mixed with MNPs- S2
3 conjugted P4 t room temperture. A few μl of Hg 2+ solution of different concentrtions ws then dded to the mixture solution, then incuted t room temperture for 20 min. The tue ws plced on mgnetic seprtor to extrct the mgnetic nnoprticles, nd the fluorescence ws recorded. For performnce of Hg 2+ mesurement in cell medi, 10 μl of 1.0 M N-ethylmleimide s thiol-locking regent ws dded to void the formtion of thiol-hg 2+ complex. Then, the ph ws djusted to 6.0. The susequent steps were the sme s descried ove. Time-resolved Fluorescent Detection of Hg 2+ in Humn Urine. To pply the timeresolved fluorescent mesurement, Hg 2+ in humn urine ws detected. The urine smple ws voluntrily provided y helthy people nd stored t 4 C, the thiols compounds were lso seprted in dvnce y N-ethylmleimide nd the ph ws djusted to 6.0. Before fluorescence detection, the smples were 10-fold diluted with the uffer solution nd spiked with 0, 1.0, 1.5, nd 2.0 μm Hg 2+, respectively.. S3
4 Tle S1. Oligonucleotides Used in This Work* Entry MSO1 for Hg 2+ MSO2 for Hg 2+ MSO3 for Hg 2+ P1 P2 P3 P4 P5 Sequence(5'-3') CTCTCTTTGTTCTTCTTGTTGTTCTCTC CTCTCTCTTTGTTCTTCTTGTTGTTCTCTCTC CTCTCTCTCTTGTTCTTCTTGTTGTCTCTCTCTC Py-TTTTTGAACAATGGAACATTTTTTT-Py Py-GAAGAGAGAGAGAGCTCTTC-Py CTCTCTCTTGTTCTTCTTGTTGTCTCTCTC iotin- AAAAAATCTTCTTGTTGTTCTT TAMAR-CTCTCTTTGTTCTTCTTGTTGTAGAGAG- Dcyl *The oldfce type is the mercury specific DNA sequences, the underlined sequence indictes the ses tht form triplex. * Py represents the fluorophore pyrene. Tle S2. Comprison of opticl sensors for mercury detection. Methods Detection medi Detection limit Signl trnsduction Ref. FRET/MSO uffer solution 40 nm stedy-stted fluorescence 11 Syr Green/MSO uffer solution 1.3 nm stedy-stted fluorescence 11 Hydrogels/MSO uffer solution 10 nm stedy-stted fluorescence 11c Gold Nnorods/MSO uffer solution 0.15 nm circulr dichroism 12 AuNP/MSO uffer solution 40 nm colorimetry 12 Luminol /MSO uffer solution 50 pm chemiluminescence 12c MNP/THMS humn urine 10 nm time-resolved fluorescence this work S4
5 Fluorescence intensity(10 5,.u) Wvelength/nm Figure S1. Fluorescence emission spectr of P1 (100 nm) efore () nd fter () ddition of 5.0 M Hg 2+ in the MOPS uffer solution t 20 C. ex =340 nm. S5
6 Fluorescence intensity(10 5,.u.) [Hg Wvelength/nm Figure S2. Fluorescence emission spectr of 100 nm P2 in the presence of incresing mounts of Hg 2+ in the MOPS uffer. The rrow indictes the signl chnges s incresing in Hg 2+ concentrtions (0, 0.1, 0.5, 1.0, 5.0, 10.0, 30.0 nd 50.0 M Hg 2+ ). ex=340 nm. S6
7 3.5 F 378nm (10 5,.u.) c d Temperture/ o C Figure S3. Fluorescence intensity s function of temperture for P1 with different concentrtions of Hg 2+ (from trce to trce d: 0.2, 0.5, 2.0, nd 5.0 M). ex =340 nm S7
8 7.5 Normlized intensity(10 5,.u.) c d Time/min Figure S4. Kinetic responses of the THMSs with different stem lengths (from trce to trce d: stem lengths of MSOs were 6, 7, 8 nd 9 ses ) towrd of 2.5 M Hg 2+ in MOPS uffer solution fter mgnetic seprtion t 20 C. For comprison, the excimer fluorescence intensity of the THMS efore ddition of Hg 2+ ws normlized to 1.0. Fluorescence emission ws recorded t 458 nm with n excittion wvelength of 340 nm. S8
9 Fluorescence intensity (10 5,.u) A S/B c uffer cell medi Counts B c Wvelength/nm Wvelength/nm Figure S5. (A) Stedy-stte fluorescence spectr of cell medi (), the THMS in cell medi (), nd () M Hg 2+ in cell medi (c). Inset: ptterns of S/B for different rection medi resulting from the spectrl detection t 458 nm. (B) TRES of the cell medi (), the THMS in cell medi (), nd () M Hg 2+ in cell medi (c) with dely time window of 40 ns. ex =340 nm. S9
10 1.0 Normlized counts d 0.2 c Time/ns Figure S6. Fluorescence decy mesurements of cell medium(), () nm P2 (), () nm P nm P4 (c), (c) M Hg 2+ (d). ex=340 nm.. S10