Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG

Transcription

1 Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa Cruz Biotechnology. Quantitative PCR Assay- Total RNA was prepared using Trizol (Gibco-Invitrogen) and used for synthesis first strand cdna with superscript II reverse transcriptase (Invitrogen). Real-time PCR was performed in 25 µl reactions in 96-well plates using 73 Real Time PCR system, Power SYBR Green PCR master mix (Applied Biosystems). Primers for QPCR reactions are summarized in following Table: Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG TopBP1 GCAACTTGCTTTGGCAAATA TTCTCTGACTGGGCCTCTTT BRCA1 TATTGGCAAAGGCATCTCAG CAAGAAAGGATCCTGGGTGT Rad51 AGACTACTCGGGTCGAGGTG CACCAAACTCATCAGCGAGT 53BP1 CCTTGGGCATAGAGGACATT GGAGAGTCACTACGACGCAA SSB2 TCTTAAGGGAAGCCTCCAAA TAGGAAGGAGGAAGGCAGAA Supplemental Figure legends: Figure S1 (A) Endogenous SSB1 and SSB2 are specifically recognized by purified anti-ssb1 or anti-ssb2 antibodies respectively. 293T cells were lysed with NETN-3 buffer and analyzed by Western blotting with anti-ssb1 and anti-ssb2 antibodies respectively. (B) Ionizing radiation slightly induces the protein expression level of SSB1 and SSB2. The protein level of SSB1, SSB2 1

2 and INT3 in Figure 1B and C was examined by NIH Image. Protein level of SSB1, SSB2 and INT3 in absence of IR treatment was set as the standard and compared with that in cells treated with 1 Gy IR. (C) Ionizing radiation slightly induces the SSB1/INT3 and SSB2/INT3 complexes formation. The co-immunoprecipitation results in Figure 1B and C were analyzed by NIH Image. The SSB1/INT3 and SSB2/INT3 complexes amounts in cells without IR treatment was set as the standard and compared with those in cells treated with 1 Gy IR. Figure S2 (A) SSB1 interacts with INT3, but not INT11 or INT12. SFB-tagged INT3, INT11 or INT12 were transiently expressed in 293T cells. Cell lysates were analyzed by IP with anti-ssb1 and Western blotting with anti-flag antibody. The expression levels of exogenous proteins were examined by Western blotting with anti-flag antibody. (B) INT3 associates with SSB1, but not INT11 or INT12. SFB-tagged SSB1, INT11 or INT12 were transiently expressed in 293T cells. Cell lysates were analyzed by IP with anti-int3 and Western blotting with anti-flag antibody. The expression levels of exogenous proteins were examined by western blotting with anti-flag antibody. (C) INT3 does not associate with RNA polymerase II (RBP1/RNA Polymerase II large subunit). 293T cells were lysed with NETN-3 buffer and then analyzed by co-ip and reverse co-ip of the endogenous proteins and Western blotting with indicated antibodies respectively. Irrelevant IgG was used as IP controls. Figure S3 The N-terminal region of INT3 is evolutionarily conserved from C.elegans to Homo sapiens. 2

3 Figure S4 Downregulation of INT3 does not affect mrna level of SSB1, BRCA1, TopBP1, Rad51 and 53BP1. Cells treated with control sirna or INT3 sirna. Total RNA was extracted and analyzed by real-time PCR. mrna level of DNA damage response factors in control sirna treated cells was compared with that in INT3 sirna treated cells. The mrna level of GAPDH was used as an input control. Figure S5 IR-induced foci formation of 53BP1 is independent of INT3. U2OS cells were treated with control sirna or INT3 sirna. Cells were irradiated with 1 Gy of IR. 6 hr after IR, cells were fixed and co-stained with indicated antibodies. Figure S6 Expression level of SSB2 is much lower than that of SSB1. Total RNAs were extracted from U2OS cells and real-time PCR analyses were performed. The expression of GAPDH was used as an input control. 3

4 Supplement Table 1 SSB1 purification Accession number Protein # of peptides NP_ SSB1 7 NP_ INT3 21 NP_ MYH9 27 NP_ MYH1 16 NP_ B-Tubulin 15 NP_ A-Tubulin 1 NP_ HNRPU 2 NP_468.1 ALBU 2 NP_ EFTU 1 NP_ ADT1 1 Peptide sequences of INT3 from SSB1 purification 1. K.DIIHNPQALSPQFTGILQLLQSR.T 2. K.LLFM*TSR.V 3. K.LLFMTSR.V 5. R.EKPSEEMVK.M 4. R.IIPNFYPPLEGHVR.Q 6. R.QGVFSSLNHIVEK.R 7. R.QYLSTPDSQSLR.C 8. R.VLAHLAPLFDNPK.L 9. R.YQDWFQR.Q 1. K.GAAAAAAASGAAGGGGGGAGAGAPGGGR.L 11. K.GKGAAAAAAASGAAGGGGGGAGAGAPGGGR.L 12. K.INQILM*EK.Y 13. K.INQILMEK.Y 14. R.DGM*NIVLNK.I 15. R.DGMNIVLNK.I 16. K.SSILIAM*AVYTYLR.L 17. R.IPEFELLWK.D 18. R.LIVDHHGTAQLQALR.Q 19. R.TQLVWLVR.E 2. K.HDELLAEHIK.S 21. K.LAQLTLEQILEHLDNLR.L * means oxidated Methionine. Supplement Table 2 SSB2 purification Accession number Protein # of peptides Peptide sequences of INT3 from SSB2 purification 1. K.DIIHNPQALSPQFTGILQLLQSR.T NP_ SSB2 4 NP_ INT3 1 NP_ MYH9 28 NP_ COA1 21 NP_911.2 PYC 3 NP_ MCCC2 2 NP_ MCCA 1 4

5 Supplement Figure S1 A kda SSB1 SSB B Relativ protein expression level W/O IR With IR SSB1 Relativ protein expression level W/O IR With IR SSB2 Relativ protein expression level W/O IR With IR INT3 C 2 W/O IR With IR Relativ complex level SSB1-INT3 SSB2-INT3 5

6 Supplement Figure S2 A Flag-INT3 Flag-INT11 Flag-INT12 Blot: anti-flag IP: anti-ssb1 Blot: anti-flag B Flag-SSB1 Flag-INT11 Flag-INT12 Blot: anti-flag IP: anti-int3 Blot: anti-flag C IP RNA pol II IgG INT3 INT3 IgG RNA pol II Blot: anti-rna pol II Blot: anti-int3 6

7 Supplement Figure S3 7

8 Supplement Figure S3 8

9 Supplement Figure S4 Con sirna INT3 sirna 53BP1 γh2ax BP1 foci positive cells (%)1 Control sirna INT3 sirna 9

10 Supplement Figure S5 1 Relative amounts (%) SSB1 TopBP1 BRCA1 Rad51 53BP1 Control sirna INT3 sirna 1

11 Supplement Figure S6 Relative mrna amounts (%) SSB1 SSB2 11