ACCEPTED. Department of Microbiology and Clinical Microbiology, Cerrahpasa Faculty of Medicine, University

Transcription

1 JCM Accepts, published online ahead of print on January 00 J. Clin. Microbiol. doi:./jcm.01-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved Dissemination of CTX-M-1 β-lactamase Genes Carried on Inc FI/II Plasmids among Clinical Isolates of Escherichia coli in a University Hospital in Istanbul, Turkey Nevriye Gonullu, 1*, Zerrin Aktas, Cigdem Bal Kayacan, Melek Salcioglu, Alessandra Carattoli, Dong Eun Yong, and Timothy R. Walsh, Department of Microbiology and Clinical Microbiology, Cerrahpasa Faculty of Medicine, University of Istanbul, Istanbul, 0, Turkey 1 ; Department of Microbiology and Clinical Microbiology, Istanbul Faculty of Medicine, University of Istanbul, 00, Istanbul, Turkey ; formerly at Department of Microbiology and Clinical Microbiology, Istanbul Faculty of Medicine, University of Istanbul, 00, Istanbul, Turkey ; Department of Infectious, Parasitic and Immune-Mediated Diseases, Istituto Superiore di Sanitá, 00 Rome, Italy ; and Department of Medical Microbiology, School of Medicine, Heath Hospital, University of Cardiff, Cardiff CF1 XN, United Kingdom Running Title: Dissemination of CTX-M-1 β-lactamase Genes Carried on Inc FI/II Plasmids among Clinical Isolates of Escherichia coli in a University Hospital in Istanbul, Turkey Key Words: ESBL, CTX-M-1 β-lactamase, Escherichia coli *Corresponding author. Tel.: /. Fax: nevriegonullu@yahoo.com. 1

2 ABSTRACT CTX-M-group-1 was found in.% of the Escherichia coli isolates from Istanbul. A subset study revealed all as bla CTX-M-1 flanked by the IS element ISEcp1. Plasmid typing of transconjugates carrying bla CTX-M-1 showed most to belong to the Inc/rep Group FII, but also FI. CTX-M-type enzymes were reported in Germany and Argentina in 1 and so far, more than CTX-M type β-lactamases have been identified mostly in Escherichia coli, Klebsiella pneumoniae and Salmonella enterica serovar Typhimurium ( The global spread is now a major concern in certain areas such as Latin America, Asia, Europe, Africa and North America (). Data on the prevalence and distribution of CTX-M-type enzymes are very limited in Turkey. Two studies revealed that CTX-M enzymes were present and disseminated in Enterobacteriaceae in Turkey (1, ). The aim of this study was to determine the current prevalence of CTX-M-group-1 in E.coli clinical isolates and their molecular characteristics in a University Hospital in Istanbul, Turkey. A total of consecutive non-repetitive isolates of E.coli obtained from in- and out-patients of the hospital of Istanbul Faculty of Medicine over a two-year period (00-00) were screened for ESBL production, using the double disc synergy test. A total of 1 E.coli isolates ( from inpatients and from outpatients) with an ESBL phenotype were included in this study, the majority of which were from urine and respiratory specimens of patients treated in six different medical and surgical wards.

3 Minimum inhibitory concentrations (MICs) were determined by the agar dilution method. MICs for cefotaxime, ceftriaxone and ceftazidime were determined alone and in combination with µg/ml clavulanic acid for phenotypic detection of ESBL β-lactamases. Conjugation experiments for transfer of cefotaxime resistance were carried out with all CTX-M-1 producing E. coli isolates (). Crude extracts of β-lactamases were subjected to IEF (). All isolates were screened for CTX-M-1 group (1), bla TEM (1) and bla SHV (). Strains which had pi bands at. were submitted to bla OXA-1-like : OXA-1-A: -GAATCGCATTATCACTTATGG- and OXA-1-B: -GATACATGTTCTCTATGG- (this study). PCR amplicons for linking ISEcp1 with bla CTX-M, were obtained by anchoring one primer at the end of bla CTX-M (bla CTX-M reverse: CACTTTGTCGTCTAAGGCG ) and the other to the end of ISEcp1 ( AATACTACCTTGGCTTTCTGA ). Sequencing was carried out on both strands by the dideoxy-chain termination method with a Perkin Elmer Biosystems DNA sequencer. Sequence analysis was performed using the Lasergene DNASTAR software package. Sequence alignments were done using the Clustal W program and the PAM 0 matrix. After isoelectric focusing, a bioassay was assigned to visualize and confirm the hydrolytic activity of the enzymes detected by the IEF (). 1 RAPD analyses were performed using the ERIC- primer () A subset of E. coli had their plasmids fully characterized. Plasmids were isolated by the alkaline lysis method (1) and used to transform E. coli TOPO cells (Invitrogen, Paisley, UK) via electroporation. Transformants were checked by PCR for carriage of the CTX-M type 1 gene. Plasmids were restricted

4 using EcoR1, their size assessed (), and typed according to the method described by Carratoli et al. (). Initially, multiplex PCR was used and then refined with single PCR to obtain clear amplicons for sequencing. Sixty-one (%) out of the E.coli isolates were found positive for the presence of ESBLs in our study. There was a high rate of resistance against ciprofloxacin (0.%). The most active antibiotics for ESBL-producing E. coli were amikacin (1.%) and imipenem (0%). The pi values of the β-lactamases and PCR results for ESBL-encoding genes were shown in table 1. All of the CTX-M-1 group positive E. coli isolates were confirmed to possess cefotaxime-hydrolyzing activity in the subsequent bioassay experiments, corroborating the pi values with cefotaximase activity. Positive amplicons were sequenced and all were shown to be bla CTX-M-1. As bla CTX-M-1 is ubiquitously associated with the insertion element ISEcP1 (1, 1), the genetic context was sought using the PCR strategy as previously described. In all CTX-M-1 positive isolates, bla CTX-M-1 was found directly adjacent to ISEcP1. The results of RAPD analyses indicated that there was no evidence of spread of a single bacterial clone responsible for the high prevalence of CTX-M-1 isolates. Conjugation experiments were performed with all CTX-M-1-group ESBL-producing E. coli strains, examining the rate of transfer. Transconjugants were obtained for isolates (see Table 1). High conjugation efficiency of about recombinants per donor cell (E. coli K 1 :W 1 Rif R Lac) was observed and all transconjugants expressed the ESBL-related resistance phenotypes. 0 1 Plasmid analysis indicated that in all cases the strains possessed more than one plasmid with some strains possessing up to five. The presence of bla CTX-M-1 genes in cefotaxime resistant transconjugates were confirmed by PCR and sequencing. Once confirmed, the transconjugates were randomly selected

5 and plasmids isolated as described. Multiplex PCR was undertaken to determine the plasmids Inc/rep type followed by simplex PCR as previously described (, ). In one isolate (#1) the bla CTX-M-1 was carried on a plasmid of approx. kb and possessed an F1 Inc/rep type. The other plasmids (n=1) that were typed possessed a large plasmid of approx. 10kb which possessed an Inc/rep type of FII (Table 1). Data show that the isolation of CTX-M-1 group positive E. coli accounted for.% of ESBL-positive E. coli isolates. The abundance of different phenotypes and the presence of multiple different enzymes in each strain indicate that the epidemiology of ESBLs in our hospital is complex. The high clinical incidence of bla CTX-M-1 since 00, suggests that the gene pool was well established prior to this date. Interestingly, the transconjugates demonstrating bla CTX-M-1 carriage were predominantly Inc/rep type FII but also FI, and whilst FII and bla CTX-M-1 relation is well established, this is not the case with FI. (, 1). The high prevalence of the CTX-M-1 underlines the need for further surveillance and further investigation for better understanding of the epidemiology and genetic background of this specific resistance trend, but the present results demonstrate that CTX-M-1 has emerged and spread in a very short period in our hospital ACKNOWLEDGMENTS The present work was supported by the Research Fund of Istanbul University, Project No/000 and was presented as a poster at the Microbes in a Changing World Congress of the International Union of Microbiological Societies (IUMS) on - July 00 in San Francisco, USA. TRW thanks

6 Dr. Mark Toleman for molecular analysis. The molecular characterization at Cardiff was funded by LSHM-CT- 0. REFERENCES 1. Aktaş, Z., N. Gönüllü, I. Schneider, Ç. Bal, and A. Bauernfeind. 00. Detection of CTX- M-1 type extended spectrum β-lactamase in an Escherichia coli strain isolated from urine sample of a hospitalized patient. Mikrobiyol. Bul. :1-.. Barton, B. M., G. P. Harding, and A. J. Zuccarelli. 1. A general method for detecting and sizing large plasmids. Anal. Biochem. :-0.. Bauernfeind, A., J. M. Casellas, M. Goldberg, M. Holley, R. Jungwirth, P. Mangold, T. Röhnish, S. Schweighart, and R. Wilhelm. 1. A new plasmidic cefotaximase from patients infected with Salmonella typhimurium. Infection 0:1-1.. Bauernfeind, A., I. Schneider, R. Jungwirth, H. Sahly, U. Ullmann. 1. A novel type of AmpC β-lactamase, ACC-1, produced by a Klebsiella pneumoniae strain causing nosocomial pneumonia. Antimicrob. Agents Chemother. :1-1.. Cantón, R., and T. M. Coque. 00. The CTX-M β-lactamase pandemic. Curr. Opin. Microbiol. :-.. Carattoli, A., V. Miriagou, A. Bertini, A. Loli, C. Colinon, L. Villa, J. M. Whichard, and G. M. Rossolini. 00. Replicon typing of plasmids encoding resistance to newer β-lactams. Emerg. Infect. Dis. 1:-.. Davin-Regli, A., D. Monnet, P. Saux, C. Bosi, R. Charrel, A. Barthelemy, and C. Bollet. 1. Molecular epidemiology of Enterobacter aerogenes acquisition: one-year prospective study in two intensive care units. J. Clin. Microbiol. :1-10.

7 Eckert, C., V. Gautier, M. Saladin-Allard, N. Hidri, C. Verdet, Z. Ould-Hocine, G. Barnaud, F. Delisle, A. Rossier, T. Lambert, A. Philippon, and G. Arlet. 00. Dissemination of CTX-M-type β-lactamases among clinical isolates of Enterobacteriaceae in Paris, France. Antimicrob. Agents Chemother. :1-1.. Gniadkowski, M., I. Schneider, R. Jungwirth, W. Hryniewicz, and A. Bauernfeind. 1. Ceftazidime-resistant Enterobacteriaceae isolates from three Polish hospitals: identification of three novel TEM- and SHV--type extended spectrum β-lactamases. Antimicrob. Agents Chemother. :1-0.. Gulay, Z., G. Terek, B. Eraç, Ç. Bal, D. Gur, I. Köksal, C. Ozakin, M. Ozinel, and B. Sumerkan. 00. High prevalence of CTX-M type extended spectrum β-lactamases in members of Enterobacteriaceae in Turkey. Abstr. 1th European Congress of Clinical Microbiology and Infectious Diseases, abstr. P.. Hopkins, K. L., E. Liebana, L. Villa, M. Batchelor, E. J. Threlfall, and A. Carattoli. 00. Replicon typing of plasmids carrying CTX-M or CMY β-lactamases circulating among Salmonella and Escherichia coli isolates. Antimicrob. Agents Chemother. 0: Jørgensen S.T., J. Grinsted, P. Bennett, and M. H. Richmond. 10. Persistence and spread of a chloramphenicol resistance-mediating plasmid in antigenic types of Escherichia coli, pathogenic for piglets. Plasmid : Karim, A., L. Poirel, S. Nagarajan, and P. Nordmann Plasmid-mediated extendedspectrum β-lactamase (CTX-M- like) from India and gene association with insertion sequence ISEcp1. FEMS Microbiol. Letters 01: Lartigue, M. F., L. Poirel, and P. Nordmann. 00. Diversity of genetic environment of bla CTX-M genes. FEMS Microbiol. Lett. :01-0.

8 Novais, A., R. Cantón, R. Moreira, L. Peixe, F. Baquero, and T. M. Coque. 00. Emergence and dissemination of Enterobacteriaceae isolates producing CTXM-1-like enzymes in Spain are associated with IncFII (CTX-M-1) and broad-host-range (CTX-M-1, - and -) plasmids. Antimicrob. Agents Chemother. 1:-. 1. Poirel, L., I. Le Thomas, T. Naas, A. Karim, and P. Nordmann Biochemical sequence analyses of GES-1, a novel Class A extended-spectrum β-lactamase, and the class 1 integron In from Klebsiella pneumoniae. Antimicrob. Agents Chemother. :-.

9 Table 1. MICs, isoelectric points, PCR results, sequence and plasmid analysis for ESBL positive E. coli isolates. Isolate No CTX MIC (µg/ml) CAZ pi a PCR/Sequencing blatem blashv blactx-m-1 OXA-1-like RAPD-PCR b Conjugation CTX-M-1 c blactx-m-1-inc Type 1 1 (R) 1(I) a + FI 1 (I) (S) b - 1(R) (R) b 1(R) (R) c + FII (R) (S) a + ND (I) (S) d + FII 1(R) (R) (I) (S) e + ND 1(R) (R) c + FII (R) (R) f + FII 1(R) (R) b + FII 1 1(R) 1(I) a - 1 1(R) (R) g + FII 1 1(R) (R) g + FII 1 (I) (R) b + FII 1 (R) (R) a - 1 1(R) (R) h - 1 1(R) 1(R) i + FII 1 (R) (R) i + FII 0 (I) (S) b - 1 (R) 1(R) j - (I) (S) k + ND (R) (R) g + FII 1(R) (R) g + FII 1(R) (R) g - (R) 1(R) g + FII (R) (R) b + ND (R) (R) a - 1(R) 1(R) e + ND 0 1(R) (R) l + ND 1 (R) (R) l + FII

10 (R) (R) m + FII (S) (S) e - 1(R) 1(R) b + ND 1(R) (S) a - (R) (R) l - (R) (S) b - 1(R) (R) k + ND (R) (R) l + FII 0 >1(R) (R) a - 1 (I) (S) a - 1(R) (R) l - 1(R) (R) g 1(I) (S) l - (R) 1(R) l (R) (S) b 1(R) 1(R) l + ND (S) 1(I) b (R) (R) l 0 1(R) (R) l + FII 1 1(R) (R) l - (I) 1(I) b + ND (I) (R) b (R) (R) indefinite bands l - (I) 1(I) indefinite bands k - >1(R) 1(R) l + ND (R) >1(R) b (R) 1(R) (R) 1(R) b - 0 1(R) 1(R) a - 1 (R) (R) l - a: Sequencing was carried out on bla CTX-M amplicons only to confirm the identification as bla CTX-M-1. b: Where there is no +/- given, blactx-m-1 has not been detected. c: Plasmid typing was carried out on transconjugates from selected isolates based on RAPD typing and phenotypic characteristics. (ND) denotes where blactx-m-1 genes were detected from transconjugates but the plasmids remained uncharacterized.