Designer Babies. Baby 1
|
|
- Lambert Lawson
- 5 years ago
- Views:
Transcription
1 Patnes Names: Date: Peiod Designe Babies Diections: Congatulations! You and you patne ae expecting an (imaginay) bundle of joy. In ode to unlock you baby s taits, you will have to go though the pocess of potein synthesis. Use the DNA taits chat (chat #2) to daw o tace you babies beautiful featues in the box below. Baby 1 TACTCGGTACGTCTACAATGGTTTCTCGTTATC Daw o Tace Baby Face Hee
2 Diections: You and you patne will ecod each tiplet of you DNA stand in Chat 1 and then will use you knowledge of tansciption, tanslation, and the mrna codon table to complete the chat. *EACH patne will need to use a diffeent witing utensil to fill in thei pat of the chat. Chat 1 DNA Tiplet mrna Amino Acid trna P a t n e A P a t n e B
3 Diections: Now, use this infomation to detemine the taits fo you imaginay baby. Match the amino acids fom Chat 1 with those in the list below and ecod the taits in Chat 2. *EACH patne will need to use a diffeent witing utensil to fill in thei pat of the chat. Taits Chat 2 Methionine= None/Stat Poducing Taits Alanine= Full Lips DNA Tiplet Amino Acid Tait Lysine= Thin Cheeks Aspatic Acid= Round Nose Cysteine= Unattached Ealobes Glutamic Acid= Shot Eye Lashes Glutamine= Attached Ealobes Glycine= Round Shaped Eyes P a t n e Histidine= Almond Shaped Eyes Isoleucine= Pointy Nose Leucine= Bushy Hai Aspaagine= Chubby Cheeks Phenylalanine= No Feckles Poline= Long Eye Lashes Seine= Staight Hai Theonine= Feckles Typtophan= Thin Lips A P a t n e Tyosine= Mono-Bow Valine= Di-Bow B Stop= None/Stop Poducing Taits
4 Designe Baby Questions 1.) Explain the diffeence between tansciption and tanslation. 2.) Whee does the pocess of tansciption takes place? 3.) What would happen if the mrna was damaged? Would you still be able to cay out potein synthesis? Explain. 4.) Whee does the pocess of tanslation takes place? 5.) What would happen if the ibosomes wee damaged? Explain how it would affect potein poduction. 6.) How could a change in one nitogen base in DNA alte (change) a potein? How could a change in one DNA base NOT alte a potein?
5 What s Wong With Baby? Diections: Oops! While developing, something went wong with you baby s featues this time aound. In ode to discove what went wong, you need to go though the same potein synthesis steps as befoe. Afte filling out the chat on the next page, you need to etun hee and daw you baby s featues in the box below. DRAW Baby Face #2 Hee 1.) What taits ae missing fom you baby? Questions 2.) What do we call mistakes in DNA? 3.) Explain the mistake that occued duing gene expession fo this baby.
6 ? Baby TACTCGGTACGTCTACAATGGATCCTCGTTATC DNA Tiplet mrna Amino Acid Tait Methionine= None/Stat Poducing Taits Alanine= Full Lips Lysine= Thin Cheeks Aspatic Acid= Round Nose Cysteine= Unattached Ealobes Glutamic Acid= Shot Eye Lashes Glutamine= Attached Ealobes Glycine= Round Shaped Eyes Histidine= Almond Shaped Eyes Isoleucine= Pointy Nose Leucine= Bushy Hai Aspaagine= Chubby Cheeks Phenylalanine= No Feckles Poline= Long Eye Lashes Seine= Staight Hai Theonine= Feckles Typtophan= Thin Lips Tyosine= Mono-Bow Valine= Di-Bow Stop= None/Stop Poducing Taits
7 STAAR Pactice Questions: 1 Which of the following descibes the function of DNA? A encoding genetic infomation B stoing enegy in chemical bonds C speeding up biochemical eactions D destoying substances that ente the cell 2 Which of these best descibes the coect sequence in the expession of a tait? A tait gene enzyme B gene potein tait C potein gene tait D gene tait DNA 3 Tansfe RNA molecules pick up amino acids which ae fee in the cytoplasm and cay them to? [NY EOC] A lysosomes B chomosomes C nuclei D ibosomes 4 Which facto most affects the ode of amino acids in a potein? A the DNA located in the nucleus of the cell B the cell in which the potein is located C the amount of ATP available fo the cell s use D the aea in a cell whee poteins ae poduced 5 Looking at the diagam, which label epesents the coding pat of DNA? A 1 B 2 C 3 D all of the above 6 Which molecule is paied with its coect ole in potein synthesis? [TN09 EOC] A nucleus foms peptide bonds D trna tansfes amino acids B ibosome caies DNA instuctions E DNA leaves the nucleus C mrna joins amino acids 7 How do the functions of DNA and RNA diffe? [AR08 EOC] A DNA diects potein tanspot, while RNA aids in enegy poduction. B DNA aids in enegy poduction, while RNA diects potein tanspot. C DNA stoes genetic infomation, while RNA elays genetic infomation fo potein synthesis. D DNA elays genetic infomation fo potein synthesis, while RNA stoes genetic infomation. 8 Which elationship is most simila to the elationship below? trna : ibosome A book : publishe D bake : pie B tuck : factoy E boss : wokes C key : lock 9 Caol and he mom have simila noses, eyes, and hands. Which of the following explains why Caol and he mom have simila taits? A Caol inheited DNA fom he mom only B Caol inheited chomosomes fom he mom only C Caol inheited the genes that code fo these taits fom he mom D Caol inheited the poteins that code fo these taits fom he mom
8 Class Set: Baby Face Taits Diections: Now that you know you imaginay baby s taits, DRAW o TRACE you baby s face into the box on the FIRST page by using the follow template.