Chromosomal location and evolution of a satellite DNA family in seven sturgeon species

Transcription

1 Chromosome Research 9: 47^52, Chromosomal location and evolution of a satellite DNA family in seven sturgeon species M. Lanfredi 1,L.Congiu 1,M.A.Garrido-Ramos 2,R.delaHerrän 2,M.Leis 1,M.Chicca 1,R.Rossi 1, J. Tagliavini 3,C.RuizRejo n 2,M.RuizRejo n 2 &F.Fontana 1 * 1 Department of Biology, University of Ferrara, Via L. Borsari, 46, Ferrara, Italy; Fax: ; fon@unife.it; 2 Departamento de Genëtica, Facultad de Ciencias, Universidad de Granada, Granada, Spain; 3 Department of Evolutionary Biology, University of Parma, Via delle Scienze, Parma, Italy * Correspondence Received 10 July 2000; received in revised form and accepted for publication by M. Schmid 14 September 2000 Key words: Acipenseridae, uorescent in-situ hybridization, satellite DNA Abstract The Hind III satellite DNA family, isolated from the Acipenser naccarii genome, was used as a probe for uorescent in-situ hybridization (FISH) on the karyotype of seven sturgeon species, six belonging to the genus Acipenser and one to Huso. All species except one (A. sturio) exhibit from 8 to 80 chromosome hybridization signals, mainly localized at the pericentromeric regions. Eight chromosomes with weak hybridization signals are present in H. huso and A. ruthenus, which are characterized by a karyotype with about 120 chromosomes. The species with 240^260 chromosomes, A. transmontanus, A naccarii, A. gueldenstaedtii, anda. baerii, show from 50 to 80 signals, prevalently localized around centromeres. Moreover, A. transmontanus and A. gueldenstaedtii show from 4 to 8 chromosomes with a double signal. The phylogenetic and evolutionary relationships among sturgeon species are discussed on the basis of number and morphology of signal-bearing chromosomes and on the localization of signals. Introduction The family Acipenseridae is composed of 25 species, of which 15 have been studied from a karyological point of view (for reviews, see the following URL complied by Fontana: On the basis of chromosome number, the sturgeons can be divided into two groups: the rst includes those with a diploid number of 120 and is presently composed of 9 species; the second includes those with a diploid number of about 240^260 and is presently composed of 7 species. The high chromosome number, the gradual distribution of chromosome size and the presence of numerous microchromosomes makes it very dif cult to characterize the different karyotypes. The classical banding techniques (C-banding and AgNOR) and the study of distribution of telomeric sequences and 25S and 5S ribosome genes by uorescent in-situ hybridization (FISH) allowed the characterization in more detail of the ploidy relationships between the two groups but did not yield any information useful to individually characterize the karyotype

2 48 M. Lanfredi et al. of each species (Fontana et al. 1998a, 1998b, 1999, Tagliavini et al. 1999a). Up to now, some distinctive features, such as recent chromosome rearrangements, have been recognized only in the karyotype of Acipenser gueldenstaedtii but not in the other sturgeon species (Fontana et al. 1996, 1998a). A more recent approach to karyotype characterization is the study of satellite DNA sequences. These sequences are arrays of tandemly repeated families, preferentially localized to the heterochromatin at centromeres and in other heterochromatic regions of chromosomes (Charlesworth et al. 1994). Although no de ned biological role has been established, it has been suggested that satellite DNA is involved in the stability of genome structure and is subjected to evolutionary processes (Miklos 1985). Because of its lower functional constraints, the evolutionary rate of satellite DNA has been proposed to be rapid (Wichman et al. 1991), providing a valuable tool for disclosing taxonomical (Bachmann et al. 1993) and evolutionary relationships between related species (Arnason et al. 1992). Although satellite DNA sequences have been studied in sh species, data on chromosomal locations of these sequences by in-situ hybridization are scarce (reviewed in Phillips & Reed 1996). In the present paper, we analyse the distribution pattern of the HindIII satellite DNA family. This family, previously isolated in the genome of A. naccarii (Garrido-Ramos et al. 1997), was employed to synthesize a probe and to study by uorescent in-situ hybridization (FISH) its localization in the karyotype of three sturgeon species with 120 chromosomes (A. sturio, A. ruthenus, Huso huso) and four with 240^260 chromosomes (A. baerii, A. naccarii, A. transmontanus, A. gueldenstaedtii). The phylogeny of sturgeons and the karyological evolution of this group of sh are discussed on the basis of these results. Materials and methods We have analysed seven sturgeon species: H. huso, A. baerii, A. gueldenstaedtii, A. naccarii, A. ruthenus,a.sturioand A. transmontanus. Specimens for cytogenetic analysis were obtained from ``La Casella'' Aquaculture Plant, Piacenza, Italy (H. huso), the CRIAP breeding station Brescia, Italy (A. gueldenstaedtii and A. transmontanus), the Azienda Agricola V.I.P. owned by Giacinto Giovannini Brescia, Italy (A. ruthenus, A. naccarii, A. baerii) and the Centre National du Machinisme Agricole, CEMAGREF, Bordeaux, France (A. sturio). For cytogenetic analyses, chromosomes of the seven sturgeon species were prepared from cell tissue cultures (Fontana et al. 1997). The preparations ensured a correct chromosome number and euploidy, veri ed by previous use in cytogenetic investigations on the same stock maintained at 70 C (Fontana et al. 1998a, 1998b, 1999, Tagliavini et al. 1999a). Primers for Hind III satellite ampli cation were designed on A. naccarii sequences (Garrido- Ramos et al. 1997). Their sequences are: AAAGCTCGGGGCATTGAAAT (Sat1F) AA- GAACTGTCCTTGCTTGGACATTC (Sat1R). PCR ampli cation was performed in 50 ml reaction mixture, containing 10 pmol of each primer, 200 mmol/l each of dntps, 1 U Taq DNA polymerase and 50 ng of genomic DNA, with 35 cycles of denaturing at 94 C for 45 s, annealing at 50 C for 1 min and extension at 72 C for 2 min. Ampli cation products were analysed by agarose gel electrophoresis on agarose gel and the monomeric band (180 bp) excised and puri ed by Qiaquick Gel Extraction Kit (Qiagen, Hilden, Germany). The puri ed band was reampli ed and cloned, without further puri cation, into the PCR 2.1 vector with a TA Cloning Kit (Invitrogen, Leek, The Netherlands) according to manufacturer's instructions. Positive clones were used as templates to synthesize digoxigenin-labelled probes, by PCR DIG Probe Syntesis Kit (Roche Molecular Biochemicals, Mannheim, Germany). The probes were tested on Southern blotting of A. naccarii genomic DNA, restricted with Hind III, RsaI and Sau3AI. A typical repeating pattern allowed us to con rm that the inserted fragments were a satellite sequence. FISH and detection of FISH signals were performed as previously described (Fontana et al. 1999) with some modi cations. Chromosome preparations were pretreated with RNase and pepsin and dehydrated in a graded ethanol series and then air-dried. An amount of 150 ng of digoxigenated

3 Satellite DNA in sturgeons 49 probe was mixed in 35 ml of hybridization solution (10% dextrane sulphate, 60% formamide, 1 mmol/l EDTA, 0.1% SDS). The chromosomes and the probe were denatured together in an oven at 83 C for 6 min. Slides were then transferred to a wet chamber for overnight hybridization at 37 C. After hybridization, slides were washed in 2 SSC at 72 Cfor2 minandthenin4 SSC plus 0.1% Tween 20 for 15 min. Detection was carried out at 37 C per 1 h with uorescin-labelled antidigoxigenin antibody set (Boehringer, Mannheim, Germany). The chromosomes were counterstained with propidium iodide. Observations were made with a Leitz Orthoplan epi uorescence microscope with appropriate lter combinations. Photographs were taken using with Kodak Ektachrome 400 ASA colour print lm. Results In all metaphase plates of the sturgeon species analysed, except A. sturio, the hybridization signals with the HindIII satellite DNA family probe were clearly visible (Figure 1). Table 1 shows the number of examined plates, the number of spots per metaphase and the type of chromosomes. All photographs depict the real conditions without any arti cial colour enhancement or other modi cations; therefore, some background noise is still present in the preparations. However, the hybridization spots can be clearly discriminated from noise because they appear larger and more de ned, showing a centromeric localization and irregular edges. In all plates, the sturgeon satellite DNA mainly appeared as centromeric heterochromatin blocks on chromosomes, while the intensity of the hybridization signals was quantitatively different among chromosomes. This difference depended on the morphological variability of chromosomes: large hybridization signals were found in all acrocentric chromosomes while in metacentric or submetacentric ones the signals were much weaker. Two species showed double signals on several chromosomes: in A transmontanus (Figure 1a) a double signal was visible on 4^6 chromosomes, and in A. gueldenstaedtii (Figure 1c) on 4^8 chromosomes. Interestingly, A. sturio exhibited no hybridization signal. Discussion All sturgeon species examined except one (A sturio) exhibited chromosome hybridization signals obtained by the HindIII satellite DNA probe. These results support the previous observations by Southern blot and dot^blot hybridization (Garrido-Ramos et al. 1997) and, more recently, by PCR and in-situ hybridization (DelaHerra n et al. submitted) that the HindIII sequences are absent from the A. sturio genome. The above results and other molecular data support the hypothesis that A. sturio diverged from the other species and most likely had an independent evolution (Birstein & desalle 1998, Tagliavini et al. 1999a). However, not all chromosomes from the other species exhibit hybridization signals. The signals change from a minimum of 8 (in H. huso and A. ruthenus) to a maximum of 80 (in A. gueldenstaedtii). The lack of hybridization signals Table 1. Number of examined plates, spots per metaphase and type of chromosomes of the sturgeon species analysed. Species Metaphase plates No. of counted Types of chromosomes analysed spots per metaphase A. naccarii large acrocentrics, small chromosomes A. gueldenstaedtii Medium-small chromosomes A. baerii large acrocentrics, small chromosomes A. transmontanus Medium-small chromosomes A. ruthenus medium-size metacentrics, 4 large acrocentrics, 2 small metacentrics H. huso medium-size metacentrics, 2 large acrocentrics, 4 small metacentrics A. sturio 12 None None

4 50 M. Lanfredi et al. Figure 1. Location of the HindIII satellite DNA by uorescence in-situ hybridization on metaphase chromosomes of A. transmontanus (a), A. naccarii (b), A. gueldenstaedtii (c), A. baerii (d), A. ruthenus (e), H. huso (f). The double signals in (a) and (c) are indicated by arrows. (Scale bars ˆ 10 mm. Images a, b, c and d have the same magni cation).

5 Satellite DNA in sturgeons 51 in centromeric regions of some chromosomes may be due either to the fact that centromeric heterochromatin of these chromosomes contains signi cant variations of HindIII satellite DNA or that more than one satellite DNA family are present (Haaf et al. 1993). The two species exhibiting few signals are both characterized by a karyotype with about 120 chromosomes. Furthermore, their signals, especially those of A. ruthenus, are less intense in comparison with those of the other species with 50^80 signals distributed over a karyotype with 240^250 chromosomes. In these species, the number of chromosomes containing the HindIII sequences is much higher than a simple doubling of diploid chromosome number. These data may indicate that the process of polyploidization is followed by repeat copy ampli cation and that the processes of spreading sequences throughout the chromosomes are highly ef cient. This fact, together with the fact that the chromosomes having HindIII sequences are very heterogeneous in size and shape, could in uence the low sequence homogenization ef ciency found for this satellite DNA family (De la Herra n et al. submitted). The very similar results obtained by FISH in A. ruthenus and H. huso further support the recent view, based on molecular data, that there are no more reasons to separate the genera Huso and Acipenser (Tagliavini et al. 1999b). The other four sturgeon species, A. gueldenstaedtii, A. naccarii, A. baerii,anda. transmontanus,together form a separate group (Tagliavini et al. 1999b). Two of the above species, A. transmontanus and A. gueldenstaedtii, show chromosomes with double signals. Previous results on C-banded metaphases of A. gueldenstaedtii stained with Giemsa showed that four medium-sized biarmed chromosomes were entirely heterochromatic (Fontana et al. 1996). In A. transmontanus,avariable number (2^7) of medium heterochromatic chromosomes were observed after C-banding and staining with Giemsa (Sola et al. 1994) or propidium iodide (Van Eenennaam et al. 1998). Our results show that, at least for what concerns HindIII satellite DNA, these chromosomes in A. transmontanus and A. gueldenstaedtii are not entirely heterochromatic but show only two heterochromatic regions among euchromatic ones. Previous hypotheses suggested that these could represent supernumerary chromosomes (Sola et al. 1994) or that these chromosomes could be composed mainly of facultative heterochromatin (Fontana et al. 1996). However, it is very likely that the presence of multiple regions of satellite DNA on the same chromosome could be attributed to molecular events of ampli cation, such as unequal crossing-over or replication shifts. Concerning the ploidy relationships between the two chromosome groups (2n ˆ 120 and 2n ˆ 240^250) into which the sturgeons can be divided, although chromosome identi cation is dif cult, the results in Table 1 allow the grouping of some chromosomes into pairs in the two 120-chromosome species (H. huso and A. ruthenus) and into multiples of four in the 240^250 chromosome species (A. baerii and A. naccarii). These groups are in agreement with those made with cytological markers, such as silver staining NOR (Fontana 1994, Fontana et al. 1996), 5S and 28S rdna (Fontana et al. 1998b, 1999). Even if it is still commonly maintained that ploidy relationships among sturgeons are tetra/octoploid (Birstein et al. 1997), all our results support the hypothesis of a diplo^tetraploid relationship between the two chromosome groups, as previously suggested (Fontana et al. 1999). Acknowledgements This work was supported by grants from the FEDER founds (1FD ) and the Plan Andaluz de Investigacio n (Group No. CVI0200). This work was also supported by the 4th Triennial Plan ``Aquaculture in Seas and Lagoons'' of the Italian Ministry of Agricultural Policies (4C 141), and by research grants from the Italian Ministry of University and Research. References Arnason U, Gretarsdottir S, Widegren B (1992) Mysticete (baleen whale) relationships based upon the sequence of the common cetacean DNA satellite. Mol Biol Evol 9: 1018^1028. Bachmann L, Schibel JM, Raab M, Sperlich D (1993) Satellite DNA as a taxonomic marker. Biochem Syst Ecol 21: 3^11. Birstein VJ, DeSalle R (1998) Molecular phylogeny of Acipenserinae. Mol Phyl Evol 9: 141^155.

6 52 M. Lanfredi et al. Birstein VJ, Hanner R, DeSalle R (1997) Phylogeny of the Acipenseriformes: cytogenetic and molecular approaches. Environ Biol Fish 48: 127^155. Charlesworth B, Sniegowski P, Stephan W (1994) The evolutionary dynamics of repetitive DNA in eukaryotes. Nature 371: 215^220. Fontana F (1994) Chromosomal nucleolar organizer regions in four sturgeon species as markers of karyotype evolution in Acipenseriformes (Pisces). Genome 37: 888^892. Fontana F, Lanfredi M, Rossi R, Bronzi P, Arlati G (1996) Karyotypic characterization of Acipenser gueldenstaedtii with C-, AgNO 3, and uorescence banding techniques. Ital J Zool 63: 113^118. Fontana F, Rossi R, Lanfredi M, Arlati G, Bronzi P (1997) Cytogenetic characterization of cell lines from three sturgeon species. Caryologia 50: 91^95. Fontana F, Lanfredi M, Chicca M, Aiello V, Rossi R (1998a) Localization of the repetitive telomeric sequence (TTAGGG) n in four sturgeon species. Chromosome Res 6: 303^306. Fontana F, Tagliavini J, Congiu L et al. (1998b) Karyotypic characterization of the great sturgeon, Huso huso, by multiple staining techniques and uorescent in situ hybridization. Mar Biol 132: 495^501. Fontana F, Lanfredi M, Chicca M, Congiu L, Tagliavini J, Rossi R (1999) Fluorescent in situ hybridization with rdna probes on chromosomes of Acipenser ruthenus and Acipenser naccarii (Osteichthyes Acipenseriformes). Genome 42: 1008^1012. Garrido-Ramos MA, Soriguer MC, De la Herrän R et al. (1997) Morphometric and genetic analysis as proof of the existence of two sturgeon species in the Guadalquivir river. Mar Biol 129: 33^39. Haaf T, Schmid M, Steinlein C, Galletti PM Jr, Willard HF (1993) Organization and molecular cytogenetics of a satellite DNA family from Hoplias malabaricus (Pisces, Erythrinidae). Chromosome Res 1: 77^86. Miklos GLG (1985) Localized highly repetitive DNA sequences in vertebrate and invertebrate genomes. In: MacIntyre RJ, ed. Molecular Evolutionary Genetics. New York: Plenum Press, pp 241^321. Phillips RB, Reed KM (1996) Application of uorescence in situ hybridization (FISH) techniques to sh genetics: a review. Aquaculture 140: 197^216. Sola L, Cordisco C, Bressanello S, Cataudella S (1994) Cytogenetic characterization of the North American white sturgeon Acipenser transmontanus (Pisces, Acipenseridae). In: Proceedings of VIII Congress of European Ichthyologists: pp 64^65. Tagliavini J, Williot P, Congiu L et al. (1999a) Molecular cytogenetic analysis of the karyotype of the European Atlantic sturgeon, Acipenser sturio. Heredity 83: 520^525. Tagliavini J, Conterio G, Gandol G, Fontana F (1999b) Mitochondrial DNA sequences of six sturgeon species and phylogenetic relationships within Acipenseridae. J Appl Ichthyol 15: 17^22. Van Eenennaam AL, Murray JD, Medrano JF (1998) Mitotic analysis of the North American white sturgeon, Acipenser transmontanus Richardson (Pisces, Acipenseridae), a sh with a very high chromosome number. Genome 41: 266^271. Wichman HA, Payne CT, Ryder OA, Hamilton MJ, Maltbie M, Baker RJ (1991) Genomic distribution of heterochromatic sequences in equids: implications to rapid chromosomal evolution. J Hered 82: 369^377.