Evaluation of a Short-Term Scientific Mission (STSM) Cost Action ES1406 KEYSOM soil biodiversity of European transect

Transcription

1 Evaluation of a Short-Term Scientific Mission (STSM) Cost Action ES1406 KEYSOM soil biodiversity of European transect Name: KEYSOM soil biodiversity of European transect COST STSM Reference Number: COST-STSM-ES Date of Approval of the Application by the STSM coordinators: 29 of October 2016 Date of Submission of the Final Report: 12 of January 2017 Sending supervisor and institute: Paula Vasconcelos Morais, Department of Life Sciences, Faculty of Sciences and Technology, University of Coimbra Receiving supervisor and institute: Paul Henning Krogh, Department of Bioscience Science and Technology Faculty, Aarhus University Title of the Mission: KEYSOM soil biodiversity of European transect

2 KEYSOM STSM KEYSOM soil biodiversity of a European transect Final Report Pedro Daniel Geadas Farias Summary The objective of the STSM was to the perform metabarcoding to evaluate soil biodiversity of samples with relevance to the KEYSOM project. The work involved PCR of soil DNA and earthworm DNA while employing primers for minibarcodes of main soil taxons, indexing libraries for the Illumina MiSeq NGS platform and bioinformatics. The methodological approach was designed to answer specific questions: Does environmental DNA reveals adaption of earthworms to high concentrations of soil copper contamination? Are the effects of anthropogenic soil copper contamination on earthworm community detectable by metabarcoding? The use of metabarcoding to evaluate soil biodiversity is highly dependent on the genetic marker and the taxonomic reference databases associated with the marker. Identification of the focus organisms, earthworms (Haplotaxidae), was far more accurate using the specific marker previously designed by Bienert et al. (2012) and Pansu et al. (2015) than the general eukaryotic 18S V4 region primers Mahé et al. (2014). Nevertheless, the use of a more common reference marker bypassed the necessity to build a specific database. The biodiversity can be impacted by contamination in soils as it is observed in the taxonomic assignment of amplicons from DNA extracts of a highly copper contaminated soil, that have specific phylum with increased abundance compared to the controlt, i.e. the single cell eukaryotes: Filosa-Granofilosea and Spirotrichea. Evaluation of the earthworm intestinal content, through metabarcording using general 18SrRNA marker for eukaryotic organisms, was effective in differentiating organisms according to genus. a. Achieved objectives The proposed plan for the STSM was based on the sole aim of characterisation of forest and grassland soil biodiversity throughout the extensive KEYSOM European transect by employing metabarcoding. This objective was partly achieved with an evaluation of a subset of soil samples from the Danish grassland study site, Hygum, lat/long , An additional objective was introduced upon starting the STSM work in which the sequencing and bioinformatics pipeline at the edna Center, Risø, was used to evaluate eukaryotic diversity in the earthworm gut. This task allowed us to validate the use of multiple genetic markers using metabarcoding for evaluation of soil biodiversity, as well as introducing this methodology that suited the overall objective of the COST action.

3 b. Summary of the experiments Prior to the beginning of the STSM two tasks were performed, collections of earthworm following the KEYSOM protocol and collection of soils. Earthworms were collected from the control part of Hygum site, using hand-sorting and AITC, to expel worms from below 20 cm. Live material was processed and characterized in the laboratory and stored in 96% ethanol. Soil were collected at the experimental field located at Hygum (55 46 N, 9 27 E), Denmark. Soil samples were categorized as Control in case of Grassland habitat, four plots are identified in the Cu background concentration area; and Hotspot in two Cu contaminated spots, an hotspot and an area with approx. half concentration 10 m north of this transect, 4+4 composite samples were collected. The tasks performed in Risø began with total soil extraction from 10 g of soil, using PowerMax Soil DNA isolation kit (MOBIO). For earthworm DNA was extracted from tail tissue, 0,025g, from one earthworm per species from Hygum collected specimens and from Eisenia fetida from lab culture using DNEasy blood and tissue extraction kit (QIAGEN). DNA yields were varied in both protocols varying from 5.14 to 44.2 ng.μl -1 of soluble DNA. For validation of the sequencing methodology a DNA mock community construction was prepared, in a concentration of 6 ng.μl -1 of DNA from each specimen. DNA pool received the same treatment as the soil samples for ILLUMINA amplicon library construction. For sequencing of general eukaryotic 18S V4 region as described by Mahé et al. (2014), using Illumina MiSeq, sequencing a 1 st PCR amplification was performed using primers TAReukF - 5 -TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCAGCASCYGCGGTAATTCC-3 and TAReukR - 5 -GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACTTTCGTTCTTGATYRA-3. PCR result was confirmed on a 1% agarose gel. A 2 nd PCR (indexing PCR) was performed on resulting amplicons using the primer set Nextera XT Index Primer 1 (N7) and Nextera XT Index 2 Primers (S5). Final PCR products were purified using HighPrep PCR kit (MagBio), and confirmed on a 1% agarose gel. For sequencing of the mitochondrial 16S region as described by Bienert et al. (2012) and Pansu et al. (2015), using Illumina MiSeq sequencing, a 1 st PCR amplification was performed using primers: ILLewD_F 5 - TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATTCGGTTGGGGCGACC-3 and ILLewE_R 5 - TCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCTGTTATCCCTAAGGTAGCTT-3. All sequencing preparation protocols were performed as described above. All PCR from soils and earthworms collected at the Hygum site, both general 18S and mt 16S were positive and the samples proceeded for sequencing. Sequencing of the 18S V4 region was performed according to the protocol from Illumina for running a paired-end sequencing using reagent v3 Illumina Kit on the MiSeq platform (2 x 300bp) (Illumina, San Diego, CA, USA), covering the full length of the amplified V4 region. Sequencing of the 18S V4 region was performed according to the protocol from Illumina for running a paired-end sequencing using reagent v2 Illumina Kit on the MiSeq platform (2 x 100bp) (Illumina, San Diego, CA, USA), covering the full length of the amplified mitochondrial 16S. Resulting reads were analyzed using QUIIME v9.2 and the software package USEARCH. Identification of the mock community was accurate when compared to identification based on visual characteristics and the BLAST identification results of mt16 gene sequencing. An exception was found for Eisenia fetida that was later genetically identified, using mt 16S, as Eisenia andrei.

4 Table1: Identification of earthworm species present in the mock community based on morphology, mt 16S gene sequencing and eukaryotic 18S V4 region gene sequencing (Illumina, MiSeq). Sequencing identifications obtained by BLAST against the NCBI_EMBL database and species names was obtained, with more than 98% similarity. Identification based on visual characteristics Identification based on mt16s sequencing Identification based on 18S sequencing Aporrectodea longa Aporrectodea longa Aporrectodea trapezoides Lumbricus sp. Lumbricus terrestris Eisenia andrei Aporrectodea rosea Aporrectodea rosea Eisenia fetida Eisenia andrei Aporrectodea caliginosa Aporrectodea caliginosa Allobophora chlorotica Allobophora chlorotica The alpha diversity evaluation of the soils calculated using thequiime pipeline, result of sequencing of the 18S V4 region showed a estimation of total OTU in the community higher for control and medium contaminated, chao1>1090, than for hotspot, chao1 992; trend consistent with diversity richness (observed OTUs). Diversity, when comparing Shannon index, between treatments, was relatively higher for Hotspot and Medium contaminated, this was also observed for the evenness of the treatments. Sample coverage was equal between treatments, goods coverage When compared to the alpha diversity evaluation of the soils, result of sequencing of the mt16s region, both estimation of total OTU and diversity richness yielded lower numbers, with higher values for Hotspot soils and lower for Control soils. Diversity index (Shannon) was low, bellow 1, and statistically non-significant, such as evenness. Sample coverage was equal between treatments, goods coverage Table 2. Alpha diversity evaluation of OTUs resulting of sequencing of general eukaryotic 18S marker and mt16s marker, in soil samples from Hygum site with three levels of Cu-contamination: control, medium and hotspot. Values obtained using USEARCH v9 software in QUIIME platform. 18S chao1 observed_otus Shannon goods_coverage equitability Control Medium Hotspot S Control Medium Hotspot Cluster analysis of the taxa assigned by analyses of 18S OTUs, were performed using PAST v3.x software, but resulted in poor clustering of soils according to Cu-treatment, as opposed to analyses of mt16s OTUs that, according to relative abundance of taxa, grouped Hotspot soils with high abundance of Aporectodea sp. much like Control soils, with one outlier, that also have a distinct representation of Enchytraeus sp.

5 Figure 1. Bray-Curtis dissimilatory index analysis, using PAST software, and taxa relative abundance, calculated on Excel. a) Analysis of clean rarefied OTU generated by sequencing and analysis of the 18S gene marker; b) Analysis of clean rarefied OTU generated by sequencing and analysis of mt16s gene marker. a) b) Figure 2. Between group analysis of clean rarefied OTUs from mt16 rrna gene sequencing. Calculated with Monte-Carlo test, simulations. Samples, Control (green), Medium (blue), Hotspot (red).

6 Taxonomy evaluation, by sequencing and BLAST of mt16 gene marker, of earthworms collected at Risø site result in the identification of 20 unique individual, Table 3. Table 3. Identification of specimens collected at Risø site, based on mitochondrial 16S gene sequencing (Illumina, MiSeq). Sequencing identifications obtained by BLAST against the NCBI_EMBL database, identification over 98% similarity. Sample identification based on visual characteristics ID Identification based on m16s sequencing Aporrectodea rosea Rt1 Aporrectodea caliginosa Rt2 Aporrectodea tuberculata Rt3 Aporrectodea caliginosa Rt4 Aporrectodea caliginosa Rt5 Aporrectodea caliginosa Aporrectodea sp. Rt6 Aporrectodea tuberculata Rt7 Aporrectodea tuberculata Rt8 Aporrectodea tuberculata Rt9 Aporrectodea caliginosa Rt11 Aporrectodea tuberculata Allolobophora chlorotica Rt22 Allolobophora chlorotica Rt23 Allolobophora chlorotica Rt24 Allolobophora chlorotica Rt25 Allolobophora chlorotica Lumbricus sp. Rt13 Lumbricus terrestris Rt14 Lumbricus terrestris Rt15 Lumbricus terrestris Rt18 Lumbricus terrestris Rt19 Lumbricus terrestris Rt21 Lumbricus terrestris Between-group analysis (BGA) performed on the original principal component analysis (PCA), calculated with R v3.3.2 software, revealed a statistically significant non-random distribution of the taxonomic profiles according to the Cu soil treatment by analysis of clean and rarefied OTUs of mt16s sequencing analysis.

7 Bray-Curtis dissimilatory index analysis of the taxa attributed by analyses of 18S OTUs, successfully clustered Lumbricus terrestris separately from Aporrectodea sp. and Allobophora sp. individuals, based on associated host eukaryotic community, Figure 4. Based on between-group analysis only Aporrectodea sp. clustered in a statistically nonrandom distribution, while L. terrestris separated in two clusters, one shared with Allobophora chlorotica, Figure 4. Figure 3. Bray-Curtis dissimilatory index analysis, using PAST software, and taxa relative abundance, calculated on Excel. a) Analysis of clean rarefied OUT generated by sequencing and analysis of 18S gene marker; b) Analysis of clean rarefied OUT generated by sequencing and analysis of mt16s gene marker.

8 Figure 4. Between-group analysis of clean rarefied OTUs from mt16 rrna gene sequencing. Calculated with Monte-Carlo test, replicates. Samples; Apporectodea sp. (green), Lumbricus terrestris (light blue), Lumbricus terrestris + Allobophora chlorotica (dark blue). Foreseen publications In collaboration with KEYSOM partners (Estonia, Austria): Effects assessment of copper pollution on microbial communities and earthworm communities in a grassland field using metabarcoding methodology. Additional information The tasks of the work were developed within the timeframe proposed at the submission of the application.

9 Signature of the Participant Signature by the receiving supervisor (Approval of this Report) Silkeborg, January 11, 2017