Implementation of MPS into a Specialist Casework Laboratory. David Ballard

Transcription

1 Implementation of MPS into a Specialist Casework Laboratory David Ballard DNA Evidence to Investigative Insights Berlin, 16

2 Outline ForenSeq STR Validation SNP Validation Relationship/Identification Specialist Uses Mitochondrial DNA Sequencing Ancestry Inference

3 ForenSeq STRs

4 Sequence Variation D2S1338 Allele TGCC TTCC

5 Sequence Variation D2S1338 Allele TGCC TTCC TCCC

6 Sequence Variation D2S1338 Allele TGCC TTCC TCCC GTCC

7 Sequence-specific population frequencies CE data Caucasian Additional alleles from sequencing Caucasian CE data Chinese Additional alleles from sequencing Chinese

8 Addition of West African frequencies D16S539 D2S1338 FGA Penta E VWA Caucasian (n=144)) CE data Chinese (n=169) CE data West African (n=64) CE data Caucasian (n=144)) Additional alleles from sequencing Chinese (n=169) Additional alleles from sequencing West African (n=64) Additional alleles from sequencing

9 Individual mutations No variation observed at DS482 in 650 alleles- all simple [AGAT] repeat unit One sample showing single point mutation in one allele Not useful in terms of population frequencies Could be extremely useful in specific cases ACAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT AGAT

10 Sequence Variation D6S AGAT ACAT

11 Sequence Variation D6S AGAT ACAT

12 Sequence Variation D6S AGAT ACAT

13 Sequence Variation D6S AGAT ACAT

14 Concordance study Data generated must align with STR calls generated using current methodologies So far, over 350 samples genotyped, analysed and compared to CE results from four different STR kits 160 White British (3 discordances) 164 Chinese (no discordances) 60 West African (1 discordance) High level of concordance observed D22S1045, poorly performing marker: samples appearing homozygote but heterozygote using the CE-based method

15 Primer binding site mutations Homozygote at D19S433 using the ForenSeq and PowerPlex kits, and heterozygote using GlobalFiler

16 Flanking region SNPs 1 sample had a 7 allele at D7S8, despite it being a 6.3 with all CE-based methods Due to rare deletion (rs % frequency in Caucasians) in flanking region CACCAAATATTGGTAATTAAATGTTTACTATAGACTATTTAG TGAGATTAAAAAAAACTATCAATCTGTCTATCTATCTATCTA TCTATCTATCTATCGTTAGTTCGTTCTAAACTATGACAAGTG TTCTATCATACCCTTTAT

17 ForenSeq SNPs

18 Identity SNP Markers Autosomal STRs (27) Y STRs (24) X STRs (7) Mix A Identity SNPs (94)

19 Average Read Number per SNP Marker

20 Average Heterozygous Balance

21 SNP concordance One SNP showing a consistent high level of heterozygote imbalance is rs Primer binding site mutation (rs ) identified

22 Copenhagen SNP Proficiency Test 15 ForenSeq SNP calls were compared with those SNaPshot HID-Ion AmpliSeq Idenitiy Panel (PGM) a Qiagen SNP panel ran on the MiSeq 6 laboratories participated 4 samples 367 ForenSeq genotype calls reported - all found concordant SNP rs failed for 2 samples In addition, 7 markers had alleles below the interpretation threshold (30 reads) - when checked 3 of these showed allele dropout.

23 Paternity Trios We have run 35 confirmed paternity trios to check for correct SNP inheritence 6,580 SNP inheritance events (94 SNPs, 2 parents) One discrepancy A trio with probable allele dropout in the mother: Father AA reads Mother GG 39 reads Child AA 489 reads Re-analysed raw data using our bioinformatics pipeline, found 9 A reads (19%) in the mother.

24 SNP Markers Generated allele frequencies Checked for Hardy-Weinberg compliance no significant deviation for any SNP.

25 SNP Pairwise Unrelated Comparisons Analysed 5000 pairwise comparisons of unrelated individuals looking for at least 2 parent-child exclusions Theoretically, it is calculated that 2 or more exclusions will be observed between unrelated pairs in: % of cases when analysing 80 polymorphic SNPs % of cases when analysing 100 polymorphic SNPs

26

27 Complex relationship testing

28 Multiple Mutations Three cases analysed with multiple mutations:

29 Multiple Mutations Three cases analysed with multiple mutations: Case 1 Trio, paternal exclusions in D12S391 & D18S51

30 Multiple Mutations Three cases analysed with multiple mutations: Case 2 Duo, paternal exclusions in SE33 and D12S391

31 Multiple Mutations Three cases analysed with multiple mutations: Case 3 Trio, paternal exclusions in D5S818 & CSF. Maternal or paternal exclusion in D8S1179

32 Cousin Relationship Woman wanting to know if deceased man was her father Nephews of the man submitted samples Trying to establish cousin relationship Kit LR For Cousin LR For Unrelated NGM/ESI Globalfiler CE STRs ForenSeq 57.3

33 Cousin Case 2 Trying to establish cousin relationship LR changed from inconclusive to 17 times more likely to be cousins Kit LR For Cousin LR For Unrelated NGM/ESI Globalfiler CE STRs ForenSeq 17.4

34 Mitochondrial DNA

35 Mitochondrial Hair Analysis A mini-mito protocol 10 amplicons of bp Improved sensitivity with respect to the CE Sanger protocol Successful, correct, sequencing from PCR products failing to display a band when run on a gel A TruSeq type protocol employed

36 Hair Analysis For Art Authentication Two sets of paintings where the authenticity was questioned Hairs extracted from under the paint on the canvas Mini-mito protocol run on the MiSeq Average coverage of 97,000

37 Hair Analysis For Art Authentication Case results Case 1 hair from painting didn t match to the putative maternal relative Case 2 full match between hair and reference EMPOP frequency 22/26,127

38 Ancestry Inference

39 King s Ancestry SNP Panel

40 King s Ancestry SNP Panel

41 King s Ancestry SNP Panel

42 Conclusions We are approaching a situation where NGS can be applied to real-life casework for multiple applications

43 Acknowledgments Laurence Devesse Denise Syndercombe Court Immy Riethorst Federica Giangasparo Anastasia Aliferi Gabriella Mason-Buck

44 DAVID BALLARD DNA ANALYSIS AT KING S KING S COLLEGE LONDON LONDON UK DAVID.BALLARD@KCL.AC.UK