A brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company
|
|
- Ann Gilmore
- 6 years ago
- Views:
Transcription
1 A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company
2 Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine Leucin Protein When genes are expressed, nucleotide sequences from DNA are translated into corresponding amino acids the building blocks of proteins RNA & Proteins carry out all cell functions
3 How Genotype Effects Phenotype Mutations can occur in DNA (e.g. cytosine to adenine or C to A) Some mutations cause a change in the amino acid coding at the protein level Line A Line B DNA ATTGCGCTTGGAC ATTGCGATTGGAC Protein The new protein may have an altered function and the plant a different phenotype Resistant Susceptible
4 What are DNA Markers? Genetic markers are specific DNA sequence differences that can be identified through biochemical assays. There are two main types: Simple Sequence Repeats (SSR) Usually consist of di or tri nucleotide repeats Also known as microsatellites Variation occurs in the number of repeats The difference in the length of each fragment can be measured Co-dominant marker system (more informative when dealing with heterozygotes) t Single Nucleotide Polymorphism (SNP) Based on the allelic variation of single nucleotides Co-dominant marker system Most prolific of all marker types Very efficient and inexpensive to use once developed Line A Line B Line C Line A Line B GTGAGT GT TGGC GTGAGT GT GT TGGC GTGAGT GT GT GT TGGC CCTGTTAA T GGTACATT CCTGTTAACGGTACATT
5 How Genetic Markers Track Genotype DNA markers can occur anywhere across the genome Chromosome picture Raven, PH and GB Johnson Understanding Biology. 2nd Edition. Mosby. St. Louis.
6 How Genetic Markers Track Genotype DNA markers can occur anywhere across the genome The more markers you have, the more useful they become Chromosome picture Raven, PH and GB Johnson Understanding Biology. 2nd Edition. Mosby. St. Louis.
7 How Genetic Markers Track Genotype DNA markers can occur anywhere across the genome The more markers you have, the more useful they become The ultimate goal is a saturated genetic map This allows you to find markers closely linked to any gene of interest Chromosome picture Raven, PH and GB Johnson Understanding Biology. 2nd Edition. Mosby. St. Louis.
8 Applying Genetic markers DNA Fingerprinting g Use a standard set of genetic markers evenly distributed across the genome Fingerprint each line with the same standard set of markers Creates a genetic scorecard that can be used to plan crosses Also widely used for quality control and protection against variety infringement
9 Applying Genetic markers Marker-assisted selection Track traits ts of interest est over generations e using markers that are tightly linked to the trait s gene Most widely used application of genetic markers in plant breeding Possible to screen for single traits, multigenic traits (QTL) and to pyramid multiple desirable traits into a single variety Eliminates environmental effects Accelerates selection process Allows selection of traits that are difficult to evaluate phenotypically
10 Applying Genetic markers Marker-Assisted Backcrossing Uses markers to compare BC progeny to the recurrent parent (RC) Donor F 1 Elite (recurrent) Elite Marker-assisted backcrossing ~1 year Analysis identifies rare progeny with very high similarity to RC BC 1 Elite Possible to find BC 2 progeny with ~95% similarity to the RC Convential backcrossing 2-3+ years BC Elite 2 Many generations BC 20
11 Conclusion Markers have become an essential and affordable tool for a competitive breeding program: Examine your germplasm resources at the genomic level Determine the components of multigenic traits through QTL mapping Manage complex agronomic traits Pyramid multiple traits into elite germplasm through selection and accelerated backcrossing Ensure quality control at the genetic levell Protect your genetic investment once it is in the marketplace Get the best varieties to market faster!
I.1 The Principle: Identification and Application of Molecular Markers
I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.
More informationMAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening.
Marker assisted selection in rice Introduction The development of DNA (or molecular) markers has irreversibly changed the disciplines of plant genetics and plant breeding. While there are several applications
More informationMarker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More informationSolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
More informationAuthors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
More informationUsing molecular marker technology in studies on plant genetic diversity Final considerations
Using molecular marker technology in studies on plant genetic diversity Final considerations Copyright: IPGRI and Cornell University, 2003 Final considerations 1 Contents! When choosing a technique...!
More informationModule 1 Principles of plant breeding
Covered topics, Distance Learning course Plant Breeding M1-M5 V2.0 Dr. Jan-Kees Goud, Wageningen University & Research The five main modules consist of the following content: Module 1 Principles of plant
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationBiology Celebration of Learning (100 points possible)
Name Date Block Biology Celebration of Learning (100 points possible) Matching (1 point each) 1. Codon a. process of copying DNA and forming mrna 2. Genes b. section of DNA coding for a specific protein
More informationTraditional Genetic Improvement. Genetic variation is due to differences in DNA sequence. Adding DNA sequence data to traditional breeding.
1 Introduction What is Genomic selection and how does it work? How can we best use DNA data in the selection of cattle? Mike Goddard 5/1/9 University of Melbourne and Victorian DPI of genomic selection
More informationWhat is a chromosome and where is it located and what does it
What is a chromosome and where is it located and what does it do? A general overview for neophytes A chromosome is one of the components of the cell inside the nucleus which codes for proteins and controls
More information(Very) Basic Molecular Biology
(Very) Basic Molecular Biology (Very) Basic Molecular Biology Each human cell has 46 chromosomes --double-helix DNA molecule (Very) Basic Molecular Biology Each human cell has 46 chromosomes --double-helix
More informationLecture 12. Genomics. Mapping. Definition Species sequencing ESTs. Why? Types of mapping Markers p & Types
Lecture 12 Reading Lecture 12: p. 335-338, 346-353 Lecture 13: p. 358-371 Genomics Definition Species sequencing ESTs Mapping Why? Types of mapping Markers p.335-338 & 346-353 Types 222 omics Interpreting
More informationIdentifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationMap-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
More informationSNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
More informationConifer Translational Genomics Network Coordinated Agricultural Project
Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 2 Genes, Genomes, and Mendel Nicholas Wheeler & David Harry
More informationImage adapted from: National Human Genome Research Institute
Jargon buster Image 1: The structure of DNA A double helix with base pairing 1 Image adapted from: National Human Genome Research Institute Allele An allele is one of two or more versions of a gene. An
More informationUniversity of York Department of Biology B. Sc Stage 2 Degree Examinations
Examination Candidate Number: Desk Number: University of York Department of Biology B. Sc Stage 2 Degree Examinations 2016-17 Evolutionary and Population Genetics Time allowed: 1 hour and 30 minutes Total
More informationWhat is Genetics? Genetics The study of how heredity information is passed from parents to offspring. The Modern Theory of Evolution =
What is Genetics? Genetics The study of how heredity information is passed from parents to offspring The Modern Theory of Evolution = Genetics + Darwin s Theory of Natural Selection Gregor Mendel Father
More informationCBA #4 Practice Exam Genetics. 1) (TEKS 5A) Which of the diagrams below shows the process of transcription:
CBA #4 Practice Exam Genetics 1) (TEKS 5A) Which of the diagrams below shows the process of transcription: 2) (TEKS 5C) All of the following are true statements about cell differentiation EXCEPT A. Cell
More informationGenetics and Heredity Power Point Questions
Name period date assigned date due date returned Genetics and Heredity Power Point Questions 1. Heredity is the process in which pass from parent to offspring. 2. is the study of heredity. 3. A trait is
More informationApplied Practice. Inheritance, Genetic Mutations, and DNA Technology STAAR Biology EOC
Applied Practice Inheritance, Genetic Mutations, and DNA Technology STAAR Biology EOC RESOURCE GUIDE Volume 4 Copyright 2013 by Applied Practice All rights reserved. No part of the Answer Key and Explanations
More informationEcological genomics and molecular adaptation: state of the Union and some research goals for the near future.
Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Louis Bernatchez Genomics and Conservation of Aquatic Resources Université LAVAL! Molecular
More informationSelection and breeding process of the crops. Breeding of stacked GM products and unintended effects
Selection and breeding process of the crops. Breeding of stacked GM products and unintended effects Critical steps in plant transformation Getting the gene into the plant genome Getting the plant cell
More informationSTAT 536: Genetic Statistics
STAT 536: Genetic Statistics Karin S. Dorman Department of Statistics Iowa State University August 22, 2006 What is population genetics? A quantitative field of biology, initiated by Fisher, Haldane and
More informationMolecular Genetics of Disease and the Human Genome Project
9 Molecular Genetics of Disease and the Human Genome Project Fig. 1. The 23 chromosomes in the human genome. There are 22 autosomes (chromosomes 1 to 22) and two sex chromosomes (X and Y). Females inherit
More informationDNA, Genes and Chromosomes. Vocabulary
Vocabulary Big Ideas Heredity and Reproduction Understand and explain that every organism requires a set of instructions that specifies its traits, that this hereditary information (DNA) contains genes
More informationAssociation Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
More informationSTANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID The relationship between biotechnology and classical plant breeding.
STANDER, l.r., Betaseed, Inc. P.O. Box 859, Kimberly, ID 83341. The relationship between biotechnology and classical plant breeding. Plant breeders have been relatively successful over the years. Duvick
More informationAdvanced Plant Technology Program Vocabulary
Advanced Plant Technology Program Vocabulary A Below you ll find a list of words (and their simplified definitions) that our researchers use on a daily basis. Abiotic stress (noun): Stress brought on by
More informationBioinformatics (Lec 19) Picture Copyright: the National Museum of Health
3/29/05 1 Picture Copyright: AccessExcellence @ the National Museum of Health PCR 3/29/05 2 Schematic outline of a typical PCR cycle Target DNA Primers dntps DNA polymerase 3/29/05 3 Gel Electrophoresis
More information4.1. Genetics as a Tool in Anthropology
4.1. Genetics as a Tool in Anthropology Each biological system and every human being is defined by its genetic material. The genetic material is stored in the cells of the body, mainly in the nucleus of
More informationDNA & Genetics. Chapter Introduction DNA 6/12/2012. How are traits passed from parents to offspring?
Section 5.3 DNA & Genetics Chapter Introduction How are traits passed from parents to offspring? Chromatin- DNA in the nucleus loose strands Chromosome- When DNA gets organized before cell division Gene-
More informationLinking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls
Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Colin Dewey cdewey@biostat.wisc.edu Spring 2012 1. Understanding Human Genetic Variation
More informationNew sunflower rust projects in the USDA Sunflower Research Unit
New sunflower rust projects in the USDA Sunflower Research Unit Lili Qi, Tom Gulya, Brent Hulke, Brady Vick USDA-ARS Sunflower Unit Rust is becoming a serious threat to the sunflower industry in North
More informationProtein Synthesis: From Gene RNA Protein Trait
Protein Synthesis: From Gene RNA Protein Trait Human Genome The human genome contains about genes. Each gene is a of DNA (sequence of nitrogen bases) contained within each chromosome. Each chromosome contains
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More information1. An alteration of genetic information is shown below. 5. Part of a molecule found in cells is represented below.
1. An alteration of genetic information is shown below. 5. Part of a molecule found in cells is represented below. A-G-T-A-C-C-G-A-T A-G-T-G-A-T This type of alteration of the genetic information is an
More informationBIOSTAT516 Statistical Methods in Genetic Epidemiology Autumn 2005 Handout1, prepared by Kathleen Kerr and Stephanie Monks
Rationale of Genetic Studies Some goals of genetic studies include: to identify the genetic causes of phenotypic variation develop genetic tests o benefits to individuals and to society are still uncertain
More informationAllele: Chromosome DNA fingerprint: Electrophoresis: Gene:
Essential Vocabulary Allele: an alternate form of a gene; for example, a gene for human hair color may have alleles that cause red or brown hair Chromosome: a cell structure that contains genetic information
More informationChapter 20 Biotechnology and Animal Breeding
Source: NILGS (Japan) I. Reproductive Technologies II. Molecular Technologies Learning Objective: To learn about recent biotechnologies that are currently available and are likely to affect animal breeding.
More informationStructure of DNA. Characteristics of DNA. Carries genetic information for traits in an organism. Twisted, double-helix structure
Structure of DNA Characteristics of DNA Carries genetic information for traits in an organism Twisted, double-helix structure Coding is carried in two sets of complimentary bases: Adenine-Thymine Guanine-Cytosine
More informationDNA Structure & the Genome. Bio160 General Biology
DNA Structure & the Genome Bio160 General Biology Lecture Outline I. DNA A nucleic acid II. Chromosome Structure III. Chromosomes and Genes IV. DNA vs. RNA I. DNA A Nucleic Acid Structure of DNA: Remember:
More informationGenomic Selection in Breeding Programs BIOL 509 November 26, 2013
Genomic Selection in Breeding Programs BIOL 509 November 26, 2013 Omnia Ibrahim omniyagamal@yahoo.com 1 Outline 1- Definitions 2- Traditional breeding 3- Genomic selection (as tool of molecular breeding)
More informationOutline. Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage
Genetics Outline Structure of DNA DNA Functions Transcription Translation Mutation Cytogenetics Mendelian Genetics Quantitative Traits Linkage Chromosomes are composed of chromatin, which is DNA and associated
More informationUtilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection
Utilization of Genomic Information to Accelerate Soybean Breeding and Product Development through Marker Assisted Selection Presented by: Ruth Wagner August 5, 2014 SOY2014 Rico Caldo,Vergel Concibido,
More information11/30/11. Lb output/beef cow. Corn Yields. Corn and Wheat
Dr. Jack Whittier Extension Beef Specialist, Colorado State University XXII Range Beef Cow Symposium, Mitchell, Nebraska November 29, 30 and December 1, 2011 Genomics the basics What it means Is it something
More informationBENG 183 Trey Ideker. Genotyping. To be covered in one 1.5 hr lecture
BENG 183 Trey Ideker Genotyping To be covered in one 1.5 hr lecture Genetic variation: Some basic definitions Allele Alternative form of a genetic locus inherited separately from each parent Polymorphism
More informationGenes and Gene Technology
CHAPTER 7 DIRECTED READING WORKSHEET Genes and Gene Technology As you read Chapter 7, which begins on page 150 of your textbook, answer the following questions. What If...? (p. 150) 1. How could DNA be
More informationGenetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection
Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato
More informationLinking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls
Linking Genetic Variation to Important Phenotypes: SNPs, CNVs, GWAS, and eqtls BMI/CS 776 www.biostat.wisc.edu/bmi776/ Mark Craven craven@biostat.wisc.edu Spring 2011 1. Understanding Human Genetic Variation!
More informationGDMS Templates Documentation GDMS Templates Release 1.0
GDMS Templates Documentation GDMS Templates Release 1.0 1 Table of Contents 1. SSR Genotyping Template 03 2. DArT Genotyping Template... 05 3. SNP Genotyping Template.. 08 4. QTL Template.. 09 5. Map Template..
More informationHigh-density SNP Genotyping Analysis of Broiler Breeding Lines
Animal Industry Report AS 653 ASL R2219 2007 High-density SNP Genotyping Analysis of Broiler Breeding Lines Abebe T. Hassen Jack C.M. Dekkers Susan J. Lamont Rohan L. Fernando Santiago Avendano Aviagen
More informationENGR 213 Bioengineering Fundamentals April 25, A very coarse introduction to bioinformatics
A very coarse introduction to bioinformatics In this exercise, you will get a quick primer on how DNA is used to manufacture proteins. You will learn a little bit about how the building blocks of these
More informationMolecular markers in plant breeding
Molecular markers in plant breeding Jumbo MacDonald et al., MAIZE BREEDERS COURSE Palace Hotel Arusha, Tanzania 4 Sep to 16 Sep 2016 Molecular Markers QTL Mapping Association mapping GWAS Genomic Selection
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationWarm-Up: Check your Answers
Warm-Up 1. What are the 3 components of a nucleotide? 2. What are the 4 nitrogen bases that are found in DNA? 3. What type of bonds are found between 2 nitrogen bases? 4. During DNA replication, what breaks
More informationThe study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
More informationDNA is normally found in pairs, held together by hydrogen bonds between the bases
Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,
More informationUSWBSI Barley CP Milestone Matrix Updated
USWBSI Barley CP Milestone Matrix Updated 10-10-13 RA: Variety Development and Host Resistance (VDHR) CP Objective 2: Map Novel QTL for resistance to FHB in barley BS, KS Dec 2013 Make initial crosses
More informationABSTRACT : 162 IQUIRA E & BELZILE F*
ABSTRACT : 162 CHARACTERIZATION OF SOYBEAN ACCESSIONS FOR SCLEROTINIA STEM ROT RESISTANCE AND ASSOCIATION MAPPING OF QTLS USING A GENOTYPING BY SEQUENCING (GBS) APPROACH IQUIRA E & BELZILE F* Département
More informationChapter 6. Genes and DNA. Table of Contents. Section 1 What Does DNA Look Like? Section 2 How DNA Works
Genes and DNA Table of Contents Section 1 What Does DNA Look Like? Section 1 What Does DNA Look Like? Objectives List three important events that led to understanding the structure of DNA. Describe the
More informationGenomic selection in American chestnut backcross populations
Genomic selection in American chestnut backcross populations Jared Westbrook The American Chestnut Foundation TACF Annual Meeting Fall 2017 Portland, ME Selection against blight susceptibility in seed
More informationSTSs and ESTs. Sequence-Tagged Site: short, unique sequence Expressed Sequence Tag: short, unique sequence from a coding region
STSs and ESTs Sequence-Tagged Site: short, unique sequence Expressed Sequence Tag: short, unique sequence from a coding region 1991: 609 ESTs [Adams et al.] June 2000: 4.6 million in dbest Genome sequencing
More informationUNIT MOLECULAR GENETICS AND BIOTECHNOLOGY
UNIT MOLECULAR GENETICS AND BIOTECHNOLOGY Standard B-4: The student will demonstrate an understanding of the molecular basis of heredity. B-4.1-4,8,9 Effective June 2008 All Indicators in Standard B-4
More informationO C. 5 th C. 3 rd C. the national health museum
Elements of Molecular Biology Cells Cells is a basic unit of all living organisms. It stores all information to replicate itself Nucleus, chromosomes, genes, All living things are made of cells Prokaryote,
More informationPharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001
Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationSept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping
Sept 2. Structure and Organization of Genomes Today: Genetic and Physical Mapping Assignments: Gibson & Muse, pp.4-10 Brown, pp. 126-160 Olson et al., Science 245: 1434 New homework:due, before class,
More informationDNA & Protein Synthesis. The source and the process!
DNA & Protein Synthesis The source and the process! Agenda I. DNA and Genes II. Protein Synthesis III. The Genetic Code I. DNA & Genes: The beauty of DNA Remember: DNA is a macromolecule that stores information
More informationChapter 3: Evolutionary genetics of natural populations
Chapter 3: Evolutionary genetics of natural populations What is Evolution? Change in the frequency of an allele within a population Evolution acts on DIVERSITY to cause adaptive change Ex. Light vs. Dark
More informationGene Mapping in Natural Plant Populations Guilt by Association
Gene Mapping in Natural Plant Populations Guilt by Association Leif Skøt What is linkage disequilibrium? 12 Natural populations as a tool for gene mapping 13 Conclusion 15 POPULATIONS GUILT BY ASSOCIATION
More informationAlgorithms in Bioinformatics ONE Transcription Translation
Algorithms in Bioinformatics ONE Transcription Translation Sami Khuri Department of Computer Science San José State University sami.khuri@sjsu.edu Biology Review DNA RNA Proteins Central Dogma Transcription
More informationMapping and Mapping Populations
Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)
More informationGenomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationIntrogression of shoot fly resistance QTLs into elite postrainy season sorghum varieties using Marker Assisted Backcrossing (MAB)
Introgression of shoot fly resistance QTLs into elite postrainy season sorghum varieties using Marker Assisted Backcrossing (MAB) Sunita Gorthy Research Scholar Sorghum breeding International Crops Research
More informationE. Incorrect! The four different DNA nucleotides follow a strict base pairing arrangement:
AP Biology - Problem Drill 10: Molecular and Human Genetics Question No. 1 of 10 Instructions: (1) Read the problem and answer choices carefully, (2) Work the problems on paper as 1. Which of the following
More informationExome Sequencing Exome sequencing is a technique that is used to examine all of the protein-coding regions of the genome.
Glossary of Terms Genetics is a term that refers to the study of genes and their role in inheritance the way certain traits are passed down from one generation to another. Genomics is the study of all
More informationHCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers.
HCS806 Summer 2010 Methods in Plant Biology: Breeding with Molecular Markers. DNA, the stuff of life. We can think of DNA as a biochemical entity or as a data string. With the advent of high throughput
More informationPhysical Anthropology 1 Milner-Rose
Physical Anthropology 1 Milner-Rose Chapter 3 Genetics: Reproducing Life and Producing Variation Our Origins By Clark Spencer Larsen Natural Selection operates on the levels of the 1. living, behaving
More information10:20-10:50 Gene Editing in Maize and Wheat at CIMMYT: Impact on Smallholder Farmers
Part I. Case examples showing contribution of genome editing 10:20-10:50 Gene Editing in Maize and Wheat at CIMMYT: Impact on Smallholder Farmers Dr. Kanwarpal Dhugga, Principal Scientist, Head, Biotechnology
More informationThe what, why and how of Genomics for the beef cattle breeder
The what, why and how of Genomics for the beef cattle breeder Este van Marle-Köster (Pr. Anim. Sci) 25 January 2019 Waguy info day 2 Today s talk Focus on what is genomics Brief definition & references
More informationDanika Bannasch DVM PhD. School of Veterinary Medicine University of California Davis
Genetics 101 Danika Bannasch DVM PhD Maxine Adler Endowed Chair in Genetics School of Veterinary Medicine University of California Davis Outline Basic genetics: The Rules Not so basic genetics: The exceptions
More informationName: Family: Date: Monday/Tuesday, March 9,
Name: Family: Date: Monday/Tuesday, March 9,10 2015 Select the best answer for each question: Part 1: Multiple Choice (2 points each) 1. Protein Synthesis involves which two processes? a. DNA Replication
More informationBiology Evolution Dr. Kilburn, page 1 Mutation and genetic variation
Biology 203 - Evolution Dr. Kilburn, page 1 In this unit, we will look at the mechanisms of evolution, largely at the population scale. Our primary focus will be on natural selection, but we will also
More informationCourse Syllabus for FISH/CMBL 7660 Fall 2008
Course Syllabus for FISH/CMBL 7660 Fall 2008 Course title: Molecular Genetics and Biotechnology Course number: FISH 7660/CMBL7660 Instructor: Dr. John Liu Room: 303 Swingle Hall Lecture: 8:00-9:15 a.m.
More informationWhat is DNA??? DNA = Deoxyribonucleic acid IT is a molecule that contains the code for an organism s growth and function
Review DNA and RNA 1) DNA and RNA are important organic compounds found in cells, called nucleic acids 2) Both DNA and RNA molecules contain the following chemical elements: carbon, hydrogen, oxygen, nitrogen
More informationDNA RNA PROTEIN. Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted
DNA RNA PROTEIN Professor Andrea Garrison Biology 11 Illustrations 2010 Pearson Education, Inc. unless otherwise noted DNA Molecule of heredity Contains all the genetic info our cells inherit Determines
More informationBundle 5 Test Review
Bundle 5 Test Review DNA vs. RNA DNA Replication Gene Mutations- Protein Synthesis 1. Label the different components and complete the complimentary base pairing. What is this molecule called? _Nucleic
More informationIntroduction to some aspects of molecular genetics
Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...
More informationLecture 1. Basic Definitions and Nucleic Acids. Basic Definitions you should already know
Lecture 1. Basic Definitions and Nucleic Acids Basic Definitions you should already know apple DNA: Deoxyribonucleic Acid apple RNA: Ribonucleic Acid apple mrna: messenger RNA: contains the genetic information(coding
More informationLECTURE 1 : GENETICS
LECTURE 1 : GENETICS Introduction to Genetics and heredity Gregor Mendel Genetic terminology (glossary) Monohybrid crosses Patterns of inheritance Dihybrid crosses Test cross Introduction to Genetics GENETICS
More informationTACKLING NEW CHALLENGES FOR EUROPEAN SORGHUM THROUGH GENETICS AND NEW BREEDING STRATEGIES
1 ST EUROPEAN SORGHUM CONGRESS WORKSHOP INNOVATIVE RESEARCH TOWARDS GENETIC PROGRESS TACKLING NEW CHALLENGES FOR EUROPEAN SORGHUM THROUGH GENETICS AND NEW BREEDING STRATEGIES OPTIMIZING GENETIC VALUE PREDICTION
More informationStatistical Methods for Quantitative Trait Loci (QTL) Mapping
Statistical Methods for Quantitative Trait Loci (QTL) Mapping Lectures 4 Oct 10, 011 CSE 57 Computational Biology, Fall 011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 1:00-1:0 Johnson
More informationTrudy F C Mackay, Department of Genetics, North Carolina State University, Raleigh NC , USA.
Question & Answer Q&A: Genetic analysis of quantitative traits Trudy FC Mackay What are quantitative traits? Quantitative, or complex, traits are traits for which phenotypic variation is continuously distributed
More informationBIOLOGY. Monday 14 Mar 2016
BIOLOGY Monday 14 Mar 2016 Entry Task List the terms that were mentioned last week in the video. Translation, Transcription, Messenger RNA (mrna), codon, Ribosomal RNA (rrna), Polypeptide, etc. Agenda
More information