Partial list of differentially expressed genes from cdna microarray, comparing MUC18-

Transcription

1 Supplemental Figure legends Table-1 Partial list of differentially expressed genes from cdna microarray, comparing MUC18- silenced and NT-transduced A375SM cells. Supplemental Figure 1 Effect of MUC-18 silencing on proliferation, apoptosis and angiogenesis in vivo Immunohistochemical staining demonstrating decreased proliferation (Ki67), increased apoptosis (TUNEL) and reduction in the number and size of blood vessels (CD31) in MUC18-silenced tumors, 35 days after injections with MUC18-shRNA or NT-shRNAtransduced A375SM cells. Images are at X20 magnification. Supplemental Figure 2 Effect of MUC18 silencing on MMP-2 Promoter Activity MMP-2 promoter-driven luciferase activity is significantly decreased following MUC18 silencing in A375SM (*p<0.01). Data are the representative of three independent experiments. Lysates were analyzed in triplicate for luciferase activity and expressed as mean ± SEM. Supplemental Figure 3 Id-1 promotes MMP-2 transcription through Sp1 and Ets-1 MMP-2 promoter-driven luciferase activity is significantly decreased in SB-2 cells overexpressing Id-1 following (A) deletion of the Est-1 binding site (ΔEts-1) or (B)

2 mutation of the Sp1 binding site (ΔSp1) on the MMP-2 promoter (*p<0.01, **p<0.001). Data are the representative of three independent experiments. Lysates were analyzed in triplicate for luciferase activity and are expressed as mean ± SEM. Supplemental Figure 4 MUC18 promotes melanoma cell invasion through Id-1 (A) Expression of MUC18 in SB-2 cells ( MUC18 negative). (B) Silencing of Id-1 in SB- 2 cells stably overexpressing MUC18 decreased Id-1 expression by 3-fold. (C) Silencing of Id-1 in SB-2 cells overexpressing MUC18 significantly decreased their invasive capacity (*p<0.001). Data are expressed as mean ± SEM of three independent experiments. (D) Quantitative real-time PCR demonstrates decreased MMP-2 mrna expression following Id-1 silencing in SB-2 cells overexpressing MUC18 (*p < 0.001). Expression values are illustrated as fold change of mean values ± SEM of three independent experiments in each cell line, relative to the NT-shRNA cells, after normalization with 18s RNA.

3 Supplemental Material and Methods Chromatin Immunoprecipitation Assay The following primer sequences were used to amplify the ATF-3 binding on the Id-1 promoter: forward 5 -GCGCCAGCCTGACAGTCCGTCCGGG-3 and reverse 5 -CTTCTCAAAGACCTCAGAGCAGGG-3, spanning a region of 181-bp from to The following primer sequences were used to amplify the Sp1/AP-2, AP-1/Ets-1, CREB and p53 binding on the MMP-2 promoter: For Sp1/AP-2 binding site: forward 5 - GGTCGTGCACTGAGGGTGGACGTAG-3 and reverse 5 - GTTTAAAGCCCCAGATGCGCAGCCTC-3, spanning a region of 273 bp from -218 to +55. For AP-1/Ets-1 binding: forward 5 -CATTGTCAATGTTCCCTAAAACATTC-3 and reverse 5 -CTCCCTCTCTCAGGAAAGACAGTTG-3, spanning a region of 185 bp from to For CREB binding: forward 5 - GTTCCTGACCCCAGGGAGTGCAGGG -3 and reverse 5 - CCTGCTACTCCTGGCCTCTACGTCC -3, spanning a region of 236 bp from to p53 binding site: forward 5 -GGTTTGTCACTGGGTCAGGCTGAAGG-3 and reverse5 - GCAGGGAACAGTTTGAGAAGTAAGG -3, spanning a region of 269 bp from to

4 Plasmid Construct The promoter of Id-1 gene (2.2kb) cloned into pgl3 was kindly donated by Dr. Rhoda M Alani. A promoter region of 1.4 kb ( ) was amplified by PCR utilizing the following primer sequences: forward 5 -GGGTACCCGAAATTAATAATGGTC-3 and reverse 5 -GAAGATCTGAATGGGCAAAGCGAAAAAAATGAGG-3. The amplified fragment was digested with KpnI and BglII and ligated into a promoterless luciferase pgl3-basic vector (Promega). Site-directed mutagenesis of the ATF-3 site, replacing TGACGTCA to TGTGCAGCA was generated as described previously (21) and performed using the QuikChange II XL site-directed mutagenesis kit (Stratagene) according to manufacturer s instructions. The promoter region of MMP-2 from to +55 was amplified from A375SM genomic DNA utilizing PCR primers: forward 5 - GGGGTACCTTTAAAACTGACTCTGG-3 and reverse 5 - GAAGATCTAAAGCCCCAGATGCGC-3 and was cloned into a promoterless luciferase pgl3-basic vector (Promega) as described above. Site-directed mutagenesis was performed using the QuikChange II XL site-directed mutagenesis kit (Stratagene) according to manufacturer s instructions to generate a MMP-2 promoter containing either a mutation at Sp1 site or deletion of the Ets-1 binding site. The Sp1 site located between -94 to -79, was generated by replacing GAGGGGCGGCCCGA to GAGCTAGATCCCGA as described previously (28). Deletion of the Ets-1 binding site, TCCAGGAAGCCTT, was generated by utilizing the following primers forward 5 - CTCAGCTCAGAAGTCACTTCTTCCTTCCTTGATTGTCTTTACTAG-3 and reverse 5 -CTAGTAAAGACAATCAAGGAAGGAAGAAGTGACTTCTGAGCTGAG-3.

5 To generate an Id-1 expression vector, Id-1 sequence was amplified from an Id-1-pLXSN expression vector kindly provided by Dr. Pierre-Yves Desprez (24) using the following primer sequences: forward 5 - CCGCTCGAGCGGATGAAAGTCGCCAGTGGCAGCACCG-3 and reverse 5 - CGGGATCCCGCTAGTGGTCGGATCTGGATCTCACCTC-3. The amplified fragment was digested with Xho1 and BamH1 and ligated into the plvx-dsred- Monomer-C1 vector (Clontech) replacing the red protein coding sequence of DsRed.The final lentiviral particle was obtained as described in the main manuscript. To generate the ATF-3 expression vector, a pcdna 3.1 expression vector containing ATF-3 with an N-terminal flag tag sequence was kindly provided by Dr. Douglas Boyd. The coding sequence of ATF-3 with an N-terminal flag tag was digested with Hind IV and HpH1 enzymes and filled in with large (Klenow) fragment. The product was then ligated into the plvx-dsred-monomer-c1 vector (Clontech) replacing the red protein coding sequence of DsRed.The final lentiviral particle was obtained as described in the main manuscript. Overexpression of MUC18 in SB-2 cells was obtained as described previously (9).