Supplemental Methods Cell lines and culture

Transcription

1 Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals, Norcross, GA) and % penicillin/streptomycin. MDA468 cells were propagated in : DMEM/F (:) (Gibco, Invitrogen) supplemented with % FBS and % penicillin/streptomycin. IRF--luciferase reporter cells were additionally supplemented with.5 μg/ml puromycin. Generation of MDA468 IRF- shrna clone for knockdown of IRF- expression using shrna mediated silencing Mission shrna gene sets against the human IRF- were purchased from Sigma-Aldrich. This set consisted of five individual shrna lentiviral vectors in plko.-puro plasmids against different target sites of IRF- (with clone IDs NM_98.-7sc, -584sc, -9sc, -994sc, -769sc, for convenience sake referred to as clone #s -5). A control vector, SHC (a non-targeting shrna that activates the RNAi pathway without targeting any known human gene) was also purchased (Sigma-Aldrich). Lentiviral stocks encoding the shrna of interest were prepared by transient cotransfection of 9T cells with the shrna encoding transfer vector and the two packaging vectors (phr'8. R and pcmv-vsv-g) at a stipulated ratio of 4:: respectively. Three days posttransfection, lentiviruses released into the medium were collected, harvested by centrifugation (5 g for min at 4 C) and filtered through a.45 μm filter to ensure removal of cell debris and floating cells. Confluent monolayers of AGS and MDA468 cells were transduced with the shrna encoding lentivirus stocks in the presence of polybrene (8 μg/ml). Transduced cells were selected with puromycin ( μg/ml) to allow for the generation of AGS and MDA468 monolayers expressing stable and long term downregulation of IRF-. Efficacies of the individual shrnas in knocking down IRF- expression were evaluated by a western blot performed on the whole cell extracts. Lentiviral clone 5 appeared to have the best knockdown of IRF- protein. Sub-clones were then obtained by limiting dilution and propagated under purmomycin selection and then screened by western blot. The MDA468 IRF- shrna clone was the best clone out of all clones to knockdown IRF- both in the absence and presence of baicalein. Luciferase reporter assays After 4 h treatment, the live and dead cell signals were detected in each well using the MultiTox- Fluor Multiplex Cytotoxicity Assay kit (Promega), followed by luciferase activity readout using the One-Glo luciferase assay kit (Promega) according to the manufacture s protocol. The luciferase reporter activity was normalized based on the live cell signal of each well. For transient luciferase reporter assay, cells were seeded in -well plates and incubated overnight. The cells were co-transfected with IRF- luciferase reporter plasmids and -gal plasmid using Lipofectamine Reagent (Invitrogen), and treated, and luciferase activity measured as above. The luciferase activities were normalized to -galactosidase activity as previously described (). Quantitative real-time PCR analysis Total RNA was isolated from treated cells using TRIzol Reagent (Invitrogen) according to the standard protocol. The qrt-pcrs were carried out using a Stratagene MXP System and BrilliantII SYBR Green QRT-PCR Master Mix Kit (Stratagene). The reactions contained Brilliant SYBR Green QPCR Master Mix, nm ROX reference dye, each primer at nm, ng RNA, and l RT/RNase block enzyme mixture in a 5 l reaction. All the reactions were carried out as the following conditions: min at 5 C, min at 95 C, and 4 cycles of s at 95 C, min at 55 C and s at 7 C in 96-well optical reaction plates (Stratagene). The dissociation curve analysis was carried out at the end of amplification to confirm PCR product specificity. Fluorescence data were

2 collected at the end of the extension step. The results were automatically determined using the MxPro software (Stratagene). The following primers were used: IRF- Forward: 5 - CCTGGCTAGAGATGCAGATT - and Reverse: 5 - TTCCTCTTGGCCTTGCTCTT -. -Actin forward : 5 -AGAAAATCTGGCACCACACC- and Reverse: 5 -CCATCTCTTGCTCGAAGTCC-. On each experiment no-template control and no-rt control were also performed at the same time. No signals were detected in no-template controls and no-rt controls. -Actin was used as a endogenous control. The validity of primers has been confirmed with tetracycline-inducible IRF- expression in AGS and MDA468 cell lines previously described ().

3 Supplemental Data Figure. Quantitative Real Time RT-PCR for IRF- of AGS Cells Treated with Baicalein 8 hours IRF-Relative expression p=. p=.7 p=. p=.8 p=.6 4 hours IRF-Relative expression p=.4 p=.8 p=.6 p=. p=. Legend: AGS cells were either treated in triplicate with indicated amount of baicalein or negative control (DMSO is carrier control) or positive control (RA is M of retinoic acid) for 8h or 4h. After treatment for 8 or 4h, expression levels of mrna were also measured by quantitative real-time RT-PCR as described in Supplemental Methods and normalized to -actin. y-axis represents values normalized to carrier control. Experiments were performed four times with similar results; representative experiments are shown. p values are t-test versus carrier control (starred). Error bars are +/- SD.

4 Supplemental Data Figure. IRF--Dependent Luciferase Assay for SKBR Cells Treated with Baicalein 6 SKBR-IRF--Luciferase-4h 5 4 Cell 5 AdIRF- (MOI=5) DMSO-4h um-4h 5uM-4h um-4h 5 SKBR-IRF--Luciferase-48h 4 Cell DMSO-48h um-48h 5uM-48h um-48h Legend: Baicalein enhances IRF- activity in SKBR cells, determined by luciferase reporter assay. SKBR cells were treated in triplicate with baicalein and luciferase activity measured by transient luciferase reporter assay after 4 and 48 h as described in Supplemental Methods. Error bars are +/- SD.

5 Supplemental References. Gao J, Senthil M, Ren B, et al. IRF- transcriptionally upregulates PUMA, which mediates the mitochondrial apoptotic pathway in IRF--induced apoptosis in cancer cells. Cell Death Differ ; 7(4):