SUPPLEMENTARY INFORMATION

Transcription

1 SUPPLEMENTARY INFORMATION doi: /nature10928 Materials and Methods 1. Plant material and growth conditions. All plant lines used were in Col-0 background unless otherwise specified. pif4-101 mutant was provided by C. Fankhauser, HA tagged 35S::PIF4 by S. Prat 1 All references to 35S::PIF4 and PIF:HA4 refer to this line, i.e. 35S::PIF4:HA. FT::GUS was obtained from K.Goto 2. 35S::PIF4:HA co-9 was obtained by crossing. The crosses were genotyped for presence of the 35S::PIF4 construct by PCR on genomic DNA using primers 2362 and 2363, resulting in two products of different size representing the cdna transgene and the genomic DNA fragment, respectively. co-9 was genotyped with primers 3650 and 3652 for insertion, and 3291 and 3292 for the wildtype fragment. For genotyping phyb-9, DNA was amplified using oligos 2137 and 2138 followed by Mnl I digestion to distinguish between wildtype and mutant alleles. The global della mutant is in the Ler background and was described previously 3. PIF4::PIF4:ProteinA and PIF4::PIF4:GUS were constructed by amplifying the genomic fragment of PIF4 including the promoter with oligos 1534 and The PCR product was cloned into pentr/d-topo (Invitrogen) and inserted into the binary plasmids PW889 (C-terminal ProteinA) and PW395 (Cterminal GUS), respectively, using Gateway technology (Invitrogen). Transgenic plants were obtained by transforming pif4-101 by floral dip. For hypocotyl measurements seeds were surface sterilized, sown on ½ MS media, stratified for 2 days at 4 C in the dark and germinated for 24 h at 22 C. The plates were then transferred to short day conditions (8/16 h photoperiod) at 22 C and 27 C respectively and grown vertically for 10 days before being imaged and hypocotyl length measured using the ImageJ software ( Oligonucleotide sequences are provided in Table S1. 2. Transcript analysis. Samples from plants grown in long days (16/8 h photoperiod) were harvested and total RNA was extracted using Trizol Reagent (Invitrogen). 2 µg of RNA were treated with DnaseI (Roche) and used for cdna synthesis (First strand cdna synthesis kit, Fermentas). cdna was diluted 1:8 and used for quantitative PCR using a Roche Lightcycler 480 and the corresponding Sybr Green master mix. To detect FT transcript levels, oligos 3180 and 3181 were 2 1

2 RESEARCH SUPPLEMENTARY INFORMATION used, for CO oligos 2951 and PIF4 transcript levels were analyzed using oligos 3952 and Oligos 3247 and 3408 amplifying TUB6 (At5g12250) were used for normalization. 3. Immunoblot analysis. For analysing the possible effect of temperature on PIF4 protein stability, Plants overexpressing PIF4:HA (35S::PIF4:HA) were used. Seven day old 35S::PIF4:HA seedlings grown in short days at 17 ºC were transferred to 12, 17, 22 and 27 ºC in short days for 2 days. Samples were collected at end of night (EON) and thereafter 30 min, 1 hour and 4 hours under illumination. Protein samples were separated by SDS-PAGE and transferred on to nitrocellulose membrane. PIF4:HA was detected using HRP conjugated HA antibody (Miltenyi Biotech) and visualised by chemiluminscent detection using Immobilon Chemiluminescent HRP substrate (Millipore). 4. GUS histochemical assay. For GUS-staining plants were grown on ½ MS plates in long days (16/8 h photoperiods) for 10 days and kept in the dark for 24 h before harvesting. Plants were stained in buffer containing 100 mm phosphate buffer, ph 7, 10 mm EDTA, 0.1% Triton-X100, 0.5 mm K-ferrocyanide and 1 mm X- gluc at 37 C for 24 h before destaining in ethanol. 5. Chromatin immunoprecipitation (ChIP). ChIP was performed as described 4 with minor modifications. 35S::PIF4:HA seedlings were grown on ½ MS plates for 10 days and kept in the dark for 24 h at respective temperatures before harvesting. 1.5 g of plant tissue and 4 µg of antibody (HA-tag antibody ab9110 from Abcam) were used for ChIP. To analyse the dynamics of PIF4::PIF4:PROTEINA, plants were grown in respective temperatures under short day conditions for four weeks. Aerial parts of the plants were collected and cross-linked before being used for chromatin preparations. ChIP was done using magnetic beads (Dynabeads M-270 Epoxy, Invitrogen) coated with rabbit IgG (Sigma, I5006) as described ( To analyse H2A.Z dynamics at the FT locus in response to temperature, we used 3 week old seedlings of HTA11::HTA11:GFP grown at 17 ºC and 27 ºC. ChIP was done using anti-gfp antibody (Abcam, ab290). To analyze PIF4 binding in Col-0 2

3 SUPPLEMENTARY INFORMATION RESEARCH and arp6-1 backgrounds, respective genotypes with PIF4::PIF4:3XFLAG were grown on soil at 22 ºC under short photoperiods for three weeks before samples fixed by formaldehyde cross-linking. ChIP was performed using anti-flag M2 affinity gel (Sigma A2220). Immuno-complexes were eluted using 3X FLAG peptide (Sigma F4799) according to manufacturer s instructions. Immunoprecipitated DNA was eluted after reverse cross-linking by boiling at 95 ºC for 1 min in presence of 10 % Chelex (BioRad laboratories) followed by treatment with Proteinase K. Oligonucleotides 3255 and 3256 for FT-15 region, 3613 and 3614 for FT-c1, 3607 and 3608 for FT-c and 3261 and 3262 for FT-f were used for detecting PIF4 binding to the FT locus. As a positive control for PIF4 binding, At5g45280 was analysed using oligos 2857 and HSP70 was used as a negative control using oligos 1862 and For analysing PIF4 binding at At4g39950 oligonucleotides 4240 and 4241 was used for region 1; and oligonucleotides 4246 and 4247 were used for region 2. Oligos 1860 and 1861 were used for HSP70 as a negative control. Oligonucleotide sequences are provided in Table S1. 3

4 RESEARCH SUPPLEMENTARY INFORMATION Table S1: Oligonucleotide sequences used in the study Oligo Sequence (5. 3 ) 1534 CACCGCCTGTTTAATTGGTGCTTGGTCAATTACG 1535 GTGGTCCAAACGAGAACCGTCGGTGGTCT 1860 TTCCGGCGAACAATTCTG 1861 CAAACACCGACGCAAGAGTA 1862 AAGGTGAAGGTCCAGCTATCG 1865 CTGTCAGTGAAAGCAACGTAGG 2137 CAATGTAGCTAGTGGAAGAAGCTCGATGTGG 2138 ACATAACAGTGTCTGCGTTCTCAAAACGC 2362 AGAAATGGCTAGTGGAAGATG 2363 GGCTTCGTCTAAAATCGAAG 2951 CCTCAGGGACTCACTACAACGAC 2952 GGTCAGGTTGTTGCTCTACTGTCC 2957 CCGCATTAACTTGATTCGGTG 2958 CATATCAATTCGGCTCATGAGATG 3180 CATTTTATGATACGAGTAACGAACGGTG 3181 CACTCTCATTTTCCTCCCCCTCTC 3247 GGTGAAGGAATGGACGAGAT 3255 CAATCAACACAGAGAAACCAC 3256 AGGTCTTCTCCACCAATCTC 3261 GATCACTGATTCAACGCC 3262 AGCATTAGACAGTAAGACCATC 3291 AGTTGGTGATGGCTCTGACAC 3292 CAACTCTATCTCCCCCGTAGC 3408 GTCATCTGCAGTTGCGTCTT 3607 GAAACAATCAACACAGAGAAACCACCT 3608 CAAGAACGTCTCCAACAACTCTGCTTAC 3613 GTTATGATTTCACCGACCCGAGTT 3614 AGGTGGTTTCTCTGTGTTGATTGTTTC 4

5 SUPPLEMENTARY INFORMATION RESEARCH Figure S1. CONSTANS is dispensable for PIF4 mediated early flowering. Plants grown in long photoperiods and photographed after 6 weeks. Below: Total leaf numbers at flowering for Col-0, 35S::PIF4 and co-9 35S::PIF4 (error bars are +/- SD, n=12). 5

6 RESEARCH SUPPLEMENTARY INFORMATION Figure S2. The early flowering phenotype of 35S::PIF4 is suppressed by low temperature. While 35S::PIF4 plants are extremely early flowering at 22 ºC, growth at 12 ºC strongly suppresses this phenotype. All plants were grown in short photoperiods (8h light, 16 hour dark) (error bars are +/- SD, n=5). 6

7 SUPPLEMENTARY INFORMATION RESEARCH Figure S3. PIF4 protein levels in 35S::PIF4:HA plants are not affected by growth temperature. Seven day old 35S::PIF4:HA seedlings grown at 17 ºC under short photoperiods were transferred to 12, 17, 22 and 27 ºC (short photoperiods) for 2 days and samples were collected at the end of night (EON) before light and thereafter 30 min, 1 hour and 4 hours under illumination. While PIF4:HA protein levels are independent of growth temperatures, the protein is robustly degraded in presence of light. PIF4:HA protein was detected by HRP conjugated anti-ha antibody. The stained lower half of the gel used for immunoblot is shown as loading control. 7

8 RESEARCH SUPPLEMENTARY INFORMATION Figure S4. Complementation of pif4-101 by PIF4::PIF4:ProA. C-terminally tagged PIF4 expressed under its endogenous promoter complements growth and developmental phenotypes of the mutant (error bars are +/- SD, n=8). 8

9 SUPPLEMENTARY INFORMATION RESEARCH Figure S5. The efficiency of PIF4 ChIP is not affected by plant growth temperature as PIF4 protein is biologically active, and can bind to target loci at 12 ºC. We analysed a recently described potential PIF4 target 5, At4g39950 (CYP79B2), as a control. (a) At4g39950 is significantly upregulated in the 35S::PIF4 background (data from three biological replicates, error bars are +/-SD). Modest expression of At4g39950 in pif4-101 likely reflects genetic redundancy between PIF4 and related transcription factors. Plants were grown in short days at 22 ºC for 7 days and samples were collected in the dark at the end of night period (b) ChIP on 35S::PIF4:HA plant tissue shows that PIF4 binds constitutively at both 12 and 27 ºC at a region in the first exon containing G/E-box elements (Region 2). Another region further upstream in the promoter shows a temperature dependent binding of PIF4. Regions 1 and 2 correspond to Regions 1 and 4 respectively in Franklin et al., 5. The binding observed for At4g39950 is specific for PIF4 as shown by the mock control and the absence of enrichment in the PIF4 ChIP for an independent locus, HSP70. These results indicate that the ChIP method per se is not influenced by the temperature at which the sample is grown, and that PIF4 protein is biologically active at lower temperatures. (data presented are from two independent ChIP samples, error bars are +/- SD) 9

10 RESEARCH SUPPLEMENTARY INFORMATION Figure S6. PIF4 expression is approximately two-fold up-regulated in arp6-1, suggesting that H2A.Z-nucleosomes are involved in the transcriptional regulation of PIF4 (data from three biological replicates, error bars are +/- SD). REFERENCES: 1. Lorrain, S., Allen, T., Duek, P.D., Whitelam, G.C. & Fankhauser, C. Phytochromemediated inhibition of shade avoidance involves degradation of growth-promoting bhlh transcription factors. Plant J 53, (2008). 2. Takada, S. & Goto, K. Terminal flower2, an Arabidopsis homolog of heterochromatin protein1, counteracts the activation of flowering locus T by constans in the vascular tissues of leaves to regulate flowering time. Plant Cell 15, (2003). 3. Koini, M.A. et al. High temperature-mediated adaptations in plant architecture require the bhlh transcription factor PIF4. Curr Biol 19, (2009). 4. Kumar, S.V. & Wigge, P.A. H2A.Z-Containing Nucleosomes Mediate the Thermosensory Response in Arabidopsis. Cell 140, (2010). 5. Franklin, K.A. et al. PHYTOCHROME-INTERACTING FACTOR 4 (PIF4) regulates auxin biosynthesis at high temperature. Proc Natl Acad Sci U S A 108, (2011). 10