Strain, plasmid, primer or dsdna fragment Relevant genotype, description, or sequence

Transcription

1 Supplemental Tables Table S1. Strains, Plasmids, Primers and dsdna fragments used in this study Strain, plasmid, primer or dsdna fragment Relevant genotype, description, or sequence Reference or Source Strains Yeast E. coli S. cerevisiae INVSc1 MATa his3d1 leu2 trp1-289 ura3-52 MAT his3d1 leu2 trp1-289 ura3-52 Invitrogen S17-1 (λpir) thi pro hsdr - M - ΔrecA RP4-2::TcMu-Km::Tn7 (7) Top 10 F- mcra Δ(mrr-hsdRMS-mcrBC) f80laczδm15 ΔlacX74 reca1 araδ139 Invitrogen Δ(ara leu)7697 galu galk rpsl (Str R ) enda1 nupg Rosetta 2 DE3 F-ompT hsds B(r B - m B - ) gal dcm (DE3) prare2 (Cam R ) Novagen Pseudomonas aeruginosa PA14 Wild type laboratory strain (5) PA14 ΔcifR PA14 with an unmarked deletion of cifr (4) PA14 6-mix PA14 with an 6 base sequence change in the morb promoter This Study PAO1 Laboratory strain (2) C3638c Clinical Isolate (1) C3640d Clinical Isolate (3) C3470c Clinical Isolate (3) C4111d Clinical Isolate (1) C2773c Clinical Isolate (3) C3639m Clinical Isolate (1) C4276c Clinical Isolate (1) C4277d Clinical Isolate (1) C4278m Clinical Isolate (1) C3195c Clinical Isolate (1) C4993c Clinical Isolate (1) C7632c Clinical Isolate (1) C7633e Clinical Isolate (1) C3779c Clinical Isolate (1) C6618c Clinical Isolate (1) D1173m Clinical Isolate (1) C7577m Clinical Isolate (1) D1426m Clinical Isolate (1) D3025c Clinical Isolate (1) C4657c Clinical Isolate (1) C9279c Clinical Isolate (1) D2639m Clinical Isolate (1) C5858d Clinical Isolate (1) C6597e Clinical Isolate (1) D2957d Clinical Isolate (1) C2548e Clinical Isolate (1) C4977c Clinical Isolate (1) D2982m Clinical Isolate (1) C5198d Clinical Isolate (1) C5203m Clinical Isolate (1) C5204c Clinical Isolate (1) C7024c Clinical Isolate (1)

2 C7205m Clinical Isolate (1) D3010c Clinical Isolate (1) Plasmids pet16b Expression vector for IPTG inducible gene expression; Ap R Novagen pmq30 Shuttle vector for yeast cloning and allelic replacement; Gm R (6) pet-16b cifr-3c-his cifr expression vector with cleavable deca-his tag This Study pmq30 6-mix Vector for mutation of morb promoter mutation; Gm R This Study pgem-t PCR cloning vector; Ap R Promega Primers EMSA for EMSA Rev RplU_rt_1 RplU_rt_2 CifR RT-1 CifR RT-2 PA2934_rt_1 PA2934_rt_2 pet16b Seq R pet16b Seq F BspH1 CifR F BspH1 CifR R morb Specific 5 cctgacctccattatttgtatcgatcac gagcaggttggacatggtcttttcc ggtggcaagcagcacaaagtcaccg gcggaccttgtcgtgacggccgtgg ggcattcgacagggacaccg gcctgatttccatcgcctcg ctcctggccggcatcgccctgaccttctcc ccattcgtaccaggtctggccgaagccgtgc ccctcaagacccgtttagaggcccc cgatcccgcgaaattaatacgac tatatcatgacaacgcgaggcaggccacgg ggtagtcatgatggggccctggaagagcacctccaggggccaggcgcgcagcgcccgtt gaaaagaccatgtccaacctgc 5 Race morb inner gcgcatagtagagagcgttca 5 Race morb Outer tgcagcgagcgatgcgacat cifr Specific 5 ggaggtcaggatggcaac 5 RACE cifr inner gatttccatcgcctcggtca 5 Race cifr outer ttcgcggaacagcccttcctt 30/5' for Mut tgcaggtcgactctagaggatccccgggtaccgagctcgcaagcctggaacacctggacc 3' rev Mut/30 cacaggaaacagctatgaccatgattacgaattcgagctccgctcgaccaggtcggggtt MorB proximal 6mix F MorB Proximal 6mix R Seq CifR F Seq Intergene R dsdna Fragments a Full Length Region 3 Region 2 Region 1 morb Proximal cifr Proximal morb Proximal 27 cifr Proximal 27 morb scramble 27 cifr scramble 27 ttattgctagattcactataaatttacttgacgagcgttgcc ttgaatatctgagtgcttcgctaaataatatggcgacggcaa acggcagcagctatcacctgctga atgacgatgcggttgcgcaag cctgacctccattatttgtatcgatcactataaatttacttgacgagcgttgccgtcgccatattatttagcgacc- gatacagatattcaagccatctccctgccgccttcgaaaggaaaagaccatgtccaacctgctcctctccccgc cctgacctccattatttgtatcgatcactataaatttacttgacgagcgttgccgtcgcca cgagcgttgccgtcgccatattatttagcgaccgatacagatattcaagccatctccctg ttcaagccatctccctgccgccttcgaaaggaaaagacc ttgccgtcgccatattatttagcgaccgatacagatattcaa cctccattatttgtatcgatcactataaatttactt attatttagcgaccgatacagatattc attatttgtatcgatcactataaattt attccataagtattttattgtcaatat tatgctatacttagttaatattactta a. These DNA products were used as 5' biotinylated and unbiotinylated variants

3 Table S2. Summary of clinical isolate Cif screen from longitudinal study Time since first Cif Expression Patient sampling (years) (Band Intensity) Clinical Isolate a Non-Synonymous Mutations P C2773c t40c b M157V 1 4 C3638c t40c M157V 2 1 C3470c t40c M157V 2 4 C3640c t40c M157V 2 4 C3639m t40c M157V 2 4 C4111d t40c M157V 3 1 C4276c t40c M157V 3 4 C4278m t40c M157V 3 4 C4277d t40c M157V P C3195c A96S M157V 3 5 C4993c M157V 8 5 C7632c A96S M157V C7633e M157V P C3779c M157V 5 3 C6618c M157V D1173m M157V P C7577m M157V 8 2 D1426m M157V 11 3 D3025c M157V P C4657c M157V 8 4 C9279c M157V 15 3 D2639m M157V P C5858d M157V 1 3 C6597e M157V 14 2 D2957d M157V P C2548e M157V 5 4 C4977c M157V 21 4 D2982m t40c M157V P C5204c M157V A129S 0 3 C5203c M157V A129S C5198d M157V A129S 3 1 C7024c M157V A129S 3 3 C7025m M157V A129S 15 3 D3010c M157V A129S a. The last letter in the isolate name corresponds to colony morphology c=classic, d=dwarf, e=entire, and m=mucoid b. 40c corresponds to a non-coding single base change in the last base of the morbproximal 27bp binding site

4 Supplemental Figures Figure S1. CifR Concentration Figure S1. Comparative EMSA analysis. Increasing concentrations CifR bound to the full length intergenic region (5 femtomoles) or the Region 2 and 3 DNA fragments (25 femtomoles). Note no secondary band is observed at the highest concentration of CifR protein for the Region 2 and 3 DNA fragments. Figure S2. Figure S2. Western Blot Analysis of Extracellular Cif. Cultures of P. aeruginosa PA14 grown in the presence or absence of 1mM EBH. Cellular and supernatant fractions are normalized to 50 micromoles of total protein per sample.

5 Figure S3. Figure S3. Western blot analysis of A96S and A129S variants. (A) Comparison of P. aeruginosa PA14 to A96S and A129S variants Cif protein expression with lower concentrations of EBH. Note that while the levels of Cif protein levels differ between isolates, the relative increase upon addition of EBH is similar. (B) Western blot comparison of WT and the A to S CifR variants in the presence of 1mM glycidol (G), cyclohexene oxide (CO) and styrene oxide (SO). Note that the relative induction between strains is similar.

6 Literature Cited 1. Behrends, V., B. Ryall, J. E. A. Zlosnik, D.P. Speert, J.G. Bundy, H. D. Williams Metabolic adaptations of Pseudomonas aeruginosa during cystic fibrosis lung infections. Environ Microbiol In Press 2. Holloway, B. W., V. Krishnapillai, and A. F. Morgan Chromosomal genetics of Pseudomonas. Microbiol Rev 43: Huse, H. K., T. Kwon, J.E. Zlosnik, D.P. Speert, E.M. Marcotte and M. Whitely Parallel evolution in Pseudomonas aeruginosa over 39,000 generations in vivo. MBio. Pii: e MacEachran, D. P., B. A. Stanton, and G. A. O'Toole Cif is negatively regulated by the TetR family repressor CifR. Infect Immun 76: Rahme, L. G., E. J. Stevens, S. F. Wolfort, J. Shao, R. G. Tompkins, and F. M. Ausubel Common virulence factors for bacterial pathogenicity in plants and animals. Science 268: Shanks, R. M., N. C. Caiazza, S. M. Hinsa, C. M. Toutain, and G. A. O'Toole Saccharomyces cerevisiae-based molecular tool kit for manipulation of genes from gram-negative bacteria. Appl Environ Microbiol 72: Simon, R., U. Priefer, and A. Puhler A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Nat Biotech 1: