Reducing the impact of Nosema and viruses through improved honey bee nutrition

Transcription

1 Reducing the impact of Nosema and viruses through improved honey bee nutrition by John Roberts and Joel Armstrong November 2018

2 Reducing the impact of Nosema and viruses through improved honey bee nutrition by John Roberts and Joel Armstrong November 2018 AgriFutures Australia Publication No AgriFutures Australia Project No PRJ

3 2018 AgriFutures Australia. All rights reserved. ISBN ISSN Reducing the impact of Nosema and viruses through improved honey bee nutrition Publication No Project No. PRJ The information contained in this publication is intended for general use to assist public knowledge and discussion and to help improve the development of sustainable regions. You must not rely on any information contained in this publication without taking specialist advice relevant to your particular circumstances. While reasonable care has been taken in preparing this publication to ensure that information is true and correct, the Commonwealth of Australia gives no assurance as to the accuracy of any information in this publication. The Commonwealth of Australia, AgriFutures Australia, the authors or contributors expressly disclaim, to the maximum extent permitted by law, all responsibility and liability to any person, arising directly or indirectly from any act or omission, or for any consequences of any such act or omission, made in reliance on the contents of this publication, whether or not caused by any negligence on the part of the Commonwealth of Australia, AgriFutures Australia, the authors or contributors. The Commonwealth of Australia does not necessarily endorse the views in this publication. This publication is copyright. Apart from any use as permitted under the Copyright Act 1968, all other rights are reserved. However, wide dissemination is encouraged. Requests and inquiries concerning reproduction and rights should be addressed to AgriFutures Australia Communications Team on Researcher Contact Details Name: Dr John Roberts Address: CSIRO, Clunies Ross St, Canberra ACT 2601 Phone: In submitting this report, the researcher has agreed to AgriFutures Australia publishing this material in its edited form. AgriFutures Australia Contact Details Building 007, Tooma Way Charles Sturt University Locked Bag 588 Wagga Wagga NSW Electronically published by AgriFutures Australia at in December 2018 AgriFutures Australia is the trading name for Rural Industries Research & Development Corporation (RIRDC), a statutory authority of the Federal Government established by the Primary Industries Research and Development Act ii

4 Foreword This research analysed Nosema spp. and viruses in response to supplementary pollen feeding and different autumn foraging environments. The findings highlight the potential for increasing pollen availability in autumn as a disease management strategy, but question the cost-benefit of achieving this through prophylactic use of pollen supplements. The results highlight the prevalence of the serious bee disease N. apis, a microsporidial disease of adult bees. This disease has a major impact in terms of reducing the life span of adult bees and thus reducing the overall productivity of bee hives. In addition, the prevalence of Nosema disease during the winter months has the potential to seriously impact on the provision of bees for pollination services. This study found that providing supplementary pollen to colonies over autumn was not effective in improving colony health or reducing levels of N. apis, N. ceranae or viruses. However, colonies given access to foraging conditions with high pollen availability showed significant reductions in late winter pathogen levels. This finding supports the importance of natural sources of high quality pollen to reduce the impact of bee diseases. In practical terms, it means beekeepers should consider the nutritional value of the foraging environment when selecting apiary sites. There is a need for further research to clearly identify the amounts and methods of supplementary feeding to overcome any natural deficiency in the field seasonally. This will support the development of effective nutritional interventions and hive management strategies for managing pathogens. This report is an addition to AgriFutures Australia s diverse range of over 2000 research publications and it forms part of our Honey Bee and Pollination Program. The R&D program aims to support research, development and extension that will secure a productive, sustainable and more profitable Australian beekeeping industry and secure the pollination of Australia s horticultural and agricultural crops into the future on a sustainable and profitable basis. Most of AgriFutures Australia s publications are available for viewing, free downloading or purchasing online at John Harvey Managing Director AgriFutures Australia iii

5 Acknowledgments We greatly appreciate the generosity of Robert and Ben Hooper for the use of their colonies for this study. They and their team were essential for carrying out the requeening, colony assessments and pollen treatments. CSIRO s Joel Armstrong provided great assistance with the field work and analysis of bee samples. Terry Brown generously provided the pollen for the experiments. The Advisory Panel and Doug Somerville provided much valuable advice on the experimental design. iv

6 Contents Foreword... iii Acknowledgments... iv Executive Summary... vii Introduction... 1 Objectives... 2 Methodology... 2 Study design... 2 Pollen treatment... 2 Colony assessments and sample collection... 4 Molecular analysis for Nosema, viruses and vitellogenin... 4 Statistical analysis... 6 Results... 7 Effect of pollen availability on colony size and pathogen prevalence... 7 Effect of pollen availability on Nosema spores... 8 Effect of pollen availability on levels of N. apis and N. ceranae... 9 Effect of pollen availability on virus prevalence Effect of pollen availability on vitellogenin expression levels Implications Recommendations References v

7 Tables Table 1. Primers used for quantitative PCR... 5 Table 2. Prevalence of N. apis and N. ceranae in spore-positive samples. NC>NA is the proportion of samples where N. ceranae was the dominant infection Table 3. Prevalence of BQCV and SBV in control and pollen treatment colonies Figures Figure 1. Map of South Australian study sites used to compare low pollen (LP) and high pollen (HP) foraging conditions Figure 2. Pollen treatment (approximately 300g per tray) placed above the brood box and queen excluder Figure 3. Inspection between treatments to confirm pollen was being consumed by worker bees Figure 4. Effect of autumn supplementary pollen treatment and forage conditions (low or high pollen) on colony size in control ( ) and treatment ( ) colonies. Different letters represent a significant (P < 0.05) difference between groups Figure 5. Nosema incidence in colonies under low and high pollen forage conditions from autumn to winter Figure 6. Nosema spore counts of colonies under low and high pollen forage conditions from autumn to winter Figure 7. Effect of autumn supplementary pollen treatment and forage conditions (low or high pollen) on the change in Nosema spore counts in control ( ) and treatment ( ) colonies. Different letters represent a significant (P < 0.05) difference between groups Figure 8. Effect of autumn supplementary pollen treatment and forage conditions (low or high pollen) on relative N. apis and N. ceranae infection levels in control ( ) and treatment ( ) colonies in Different letters represent a significant (P < 0.05) difference between groups Figure 9. Effect of autumn supplementary pollen treatment and forage conditions (low or high pollen) on relative N. apis and N. ceranae infection levels in control ( ) and treatment ( ) colonies in Different letters represent a significant (P < 0.05) difference between groups Figure 10. Effect of autumn supplementary pollen treatment and forage conditions (low or high pollen) on vitellogenin expression in control ( ) and treatment ( ) colonies. Different letters represent a significant (P < 0.05) difference between groups Figure 11. Correlation between vitellogenin expression and infection levels of N. apis ( ) and N.ceranae ( ) in Figure 12. Effect of autumn supplementary pollen treatment (low or high pollen) on vitellogenin expression in control ( ) and treatment ( ) colonies across seasons. Different letters represent a significant (P < 0.05) difference between groups vi

8 Executive Summary What the report is about This report describes the findings of a two-year field study that analysednosema apis, Nosema ceranae and honey bee viruses in response to nutrition in Australian colonies. It reports on the influence of supplementary pollen and different autumn foraging environments to reduce pathogen pressure in late winter, a time when there is high demand for healthy colonies to provide almond pollination. This research aims to provide experimental evidence on the effectiveness of recommended nutritional strategies for managing honey bee pathogens. It will assist beekeeper decision making and help develop more effective nutritional interventions for pathogen management. Who is the report targeted at? The report is targeted at the Australian beekeeping industry for the better management of honey bee pathogens. Where are the relevant industries located in Australia? The Australian honey bee industry is represented across all states and territories. Through management of A. mellifera, this industry supplies honey and other bee products, including queens and packaged bees, for domestic users and international export markets. The industry has an estimated gross value of production of $98 million annually (ABARES, 2016) and also provides paid pollination services of significant value to the horticultural and agricultural sectors. This research will benefit the honey bee industry as a whole through improved knowledge of how supplementary pollen and different autumn foraging environments influence Nosema spp. and virus infections of colonies. Background Effective pest and disease management is essential for increasing the productivity of the honey bee industry and to meet the growing demand for pollination services. Nosema apis and N. ceranae cause serious disease in adult honey bees worldwide and contribute to global colony losses. As N. ceranae was only detected in Australia in 2007, our current management practices are based only on N. apis. We have little information on their effect on mixed infections with N. ceranae or other cryptic pathogen such as viruses. Previous research in Australia has found that (1) there is a high prevalence of Nosema especially in late winter when colonies are needed for almond pollination, (2) feeding pollen during winter to increase colony populations was ineffective and may exacerbate Nosema levels, and (3) under lab conditions pollen fed bees live longer and may reduce the development of Nosema infection. Consequently, beekeepers are recommended to focus on increasing pollen availability in autumn as a strategy for promoting successful overwintering of strong colony populations and as a tool to mitigate the effects of Nosema infections. Survey data has also suggested that certain autumn floral resources may increase N. apis infections in later winter and supplementary feeding is a common beekeeping practice to support colonies during pollen-deficient nectar flows. However, there is little experimental evidence to demonstrate whether supplementary pollen feeding in autumn or access to high pollen flowering conditions can be effective at reducing Nosema spp. or virus levels in late winter in Australian honey bee colonies. vii

9 Aims/objectives This study aimed to extend from this earlier work and provide much needed data on the effectiveness of increased pollen availability in autumn as a strategy for reducing levels of Nosema spp. and viruses in late winter, when there is high demand for colonies for almond pollination. Methods used We worked with a commercial beekeeper in South Australia over 2016 and 2017 to test the effect of providing supplementary pollen to colonies over autumn on colony health and pathogen levels in May and August. In 2016, we fed 900g of pollen per colony over eight weeks and increased this to 2.4 kg of pollen per colony over ten weeks in Supplementary pollen was placed in trays above the brood and queen excluder for bees to access. We also compared the effect of placing colonies in different autumn foraging environments that were defined as being low or high in available pollen. Adult bees were collected and analysed by quantitative PCR to determine relative pathogen levels of N. apis, N. ceranae, Black queen cell virus, and Sacbrood virus, and relative honey bee gene expression for vitellogenin (bee health biomarker) and two control reference genes. Results/key findings Providing supplementary pollen to colonies over autumn had no significant positive or negative effect on colony size, development of N. apis, N. ceranae or viruses, or expression of vitellogenin in May or August compared to untreated control colonies. We did observe several effects on Nosema levels in August for colonies placed under high pollen conditions. These colonies had significantly less increase in spores and relative levels of N. apis and N. ceranae were significantly lower. Incidence of Nosema infection was also lower for colonies on high pollen conditions in August There was no clear effect on virus levels, although the prevalence of Black queen cell virus and Sacbrood virus was much lower in 2017 when overall Nosema levels were also reduced. A limitation of this study was a lack of detailed pollen analysis for the different sites, which would have more reliably defined high and low pollen sites. Nonetheless, the research results provide an indication that targeting high pollen environments in autumn can be an effective management strategy to suppress Nosema levels (and potentially viruses) in late winter and to the best of our knowledge, this suppressive effect has not been demonstrated before at the colony level. Relative quantification of N. apis and N. ceranae also highlighted the continued dominance of N. apis in these colony infections, despite the high prevalence of N. ceranae in Australia. The findings of this research will benefit the Australian honey bee industry by providing quantitative evidence for how autumn pollen availability can influence late winter pathogen levels and help guide further development of nutritional intervention strategies to mitigate Nosema and virus outbreaks. Implications for stakeholders We failed to demonstrate that the supplementary pollen treatment was an effective strategy to suppress levels of N. apis, N. ceranae or viruses. This raises important cost-benefit questions for prophylactically giving pollen supplements to colonies as a strategy for managing these pathogens. That is not to say that supplementary feeding is not a useful management strategy for supporting colony nutrition or manipulating behaviour. However, we need to further understand how supplementary pollen is used by colonies under different conditions and how this influences the development of Nosema and virus infections in colonies before recommending this strategy. Colonies did show significant response to having access to high or low pollen foraging environments. The most consistent response was reduced Nosema levels in August, indicating that increased pollen viii

10 availability in autumn can be an effective management strategy to suppress Nosema levels in late winter. The different results for supplementary pollen versus naturally available pollen may be due to differences in pollen quality and diversity or perhaps how the pollen is collected and ultimately used by the colony. Considering the nutritional value of the foraging environment when selecting apiary sites clearly remains important and having greater characterisation of different foraging environments (e.g. pollen analyses to examine diversity and quality) would assist beekeepers to make more informed decisions. This study investigated the relative levels of N. apis and N. ceranae in colonies and expression of vitellogenin at different time points. This takes our understanding of Nosema disease further than relying only on Nosema spore counts. These South Australian apiaries are an example where earlier tests found very high Nosema spore counts and detected both N. apis and N. ceranae, but using quantitative PCR we showed that N. apis was still the dominant species causing high infections. This is in stark contrast to other countries such as the USA, where N. ceranae has almost completely displaced N. apis. Expression of vitellogenin may still be a useful biomarker for further investigations of colony health, despite not showing a strong response in this study. Other studies have found good correlations between vitellogenin levels and colony strength and perhaps more targeted collection of nurse bees may provide a more reliable profile of vitellogenin expression in relation to colony health. Recommendations The following recommendations are targeted at industry decision-makers, researchers and beekeepers: This project made assumptions that pollen was effectively used by colonies and translated into improved nutrition of developing worker bees. Further research is needed to understand how pollen availability in the environment or through supplementary feeding influences the nutritional quality of brood food and how this corresponds to disease susceptibility. Further application of molecular tools and high-throughput sequencing to more accurately understand the pollen quality and diversity in different environments and what pollens are actually utilised by colonies to support nutrition. Using commercial hives has many benefits in terms of real-world relevance, but means it is more difficult to control environmental and management variables or apply stressful treatments. Further experiments into disease management will benefit from more controlled experiments under lab and research apiary conditions to better understand the fundamental factors involved in disease outbreaks. ix

11 Introduction Effective pest and disease management is essential for increasing the productivity of the honey bee industry and to meet the growing demand for healthy colonies for pollination services. This challenge will only become more difficult should Varroa destructor or other parasitic mites reach Australia. It is important we take advantage of our unique Varroa-free status and better manage our endemic pathogens now. Beekeepers are experienced at managing pests and diseases, but outbreaks continue to occur. Management also tends to focus on visible problems like small hive beetle and American foulbrood, while cryptic pathogens like Nosema and viruses go largely unchecked. Nosema apis and N. ceranae cause serious disease in adult honey bees worldwide and contribute to global colony losses (Holt and Grozinger, 2016). While Nosema apis is a long established pathogen of Apis mellifera, N. ceranae has more recently spread from Asian honey bees (Apis cerana) and was only detected in Australia in 2007 (Hornitzky, 2008a). Consequently our knowledge for disease management is based on N. apis with little information for how this now relates to mixed infections with N. ceranae. Honey bee viruses are also a significant factor in colony losses overseas (McMenamin and Genersch, 2015). The absence of Varroa mites and Deformed wing virus in Australia has limited their impact here (Roberts et al., 2017), but viruses do add to overall pathogen loads and can increase the virulence of Nosema infections (Bailey et al., 1983; Doublet et al., 2015). Previous research has found that (1) there is a high prevalence of Nosema across Australia especially in late winter when colonies are needed for almond pollination (Hornitzky, 2005, 2008b; Roberts et al., 2017), (2) feeding pollen during winter to increase colony populations was ineffective and may exacerbate Nosema levels (Somerville and Collins, 2007), and (3) under lab conditions pollen fed bees live longer and can have reduced levels of Nosema infection (Hornitzky, 2011). Consequently, beekeepers are recommended to focus on increasing pollen availability in autumn as a strategy for promoting successful overwintering of strong colony populations and as a tool to mitigate the effects of Nosema infections (Hornitzky, 2011; Somerville and Collins, 2007). Survey data has also suggested that certain autumn floral resources may increase N. apis infections in later winter (Hornitzky, 2005, 2008b) and supplementary feeding is a common beekeeping practice to support colonies during pollendeficient nectar flows (Somerville, 2005). However, there is little experimental evidence to demonstrate whether supplementary pollen feeding in autumn or access to high pollen flowering conditions can be effective at reducing N. apis levels in late winter. It is also uncertain if autumn floral resources or pollen feeding influence infections of N. ceranae or honey bee viruses in Australian honey bee colonies. This study aimed to extend from this earlier work and provide much needed data on the effectiveness of increased pollen availability in autumn as a strategy for reducing levels of Nosema and viruses in late winter. We worked with a commercial beekeeper in South Australia over 2016 and 2017 to test the effect of providing supplementary pollen to colonies over autumn on colony health and pathogen levels in May and August. We also examined the effect of placing colonies in different autumn foraging environments that were thought to be low or high in available pollen. We chose to work in South Australia as it was identified in the recent national pathogen survey to have very high levels of Nosema infections during late winter almond pollination, with both N. apis and N. ceranae equally common (Roberts et al., 2015), and has potentially limited availability of high quality pollen sources in autumn (Paton et al., 2004). This research provides the first quantitative analysis of these pathogens in response to nutrition in Australia and will help in the development of more effective disease management strategies for beekeepers. 1

12 Objectives The objective of this project was to investigate the effects of autumn nutrition on colony pathogen loads in late winter. Methodology Study design Colonies used for this study were managed by a commercial beekeeper in South Australia. In 2016 we used 144 colonies across 6 migratory apiaries and in 2017 we used 96 colonies across 4 migratory apiaries. All colonies were requeened in January-February before each experiment. In 2016, there was significant queen loss/replacement after requeening due to technical errors, so that only 110 colonies were taken through to August. In 2017, there were few queen related issues and 93 colonies were viable in August. Paired apiaries were placed on three different autumn/winter foraging conditions that were expected to vary in available pollen. The low pollen (LP) forage condition had colonies placed in south-eastern South Australia on flowering Pink Gum (Eucalyptus fasciculosa) from March, which does not provide pollen for bees (Paton et al., 2004), and then remained at those sites to over-winter with access to Banksia ornata, Blue Gum (Eucalyptus leucoxylon) and White Mallee (Eucalyptus diversifolia). High pollen (HP1) forage conditions had colonies taken to Yorke Peninsula to access flowering Tea-tree (Melaleuca lanceolata) and Lincoln weed (Diplotaxis tenuifolia) in March/April, which are good pollen sources (Paton et al., 2004; Somerville, 2005), where they remained over winter with limited flowering options. High pollen (HP2) forage conditions also had colonies taken to Yorke Peninsula to access flowering Tea-tree and Lincoln weed in March/April, but returned to south-eastern South Australia in May to over-winter on Banksia ornata, Blue Gum and White Mallee. In 2017, only the LP and HP2 forage conditions were compared. All apiaries had come from foraging on lucerne (Medicago sativae) in summer and all apiaries were taken to Paringa, South Australia for almond pollination. Pollen treatment In each apiary there were 12 untreated control colonies and 12 pollen treatment colonies. The pollen treatment involved providing colonies with irradiated pollen (Browns Bees Australia Pty Ltd) from March to May. Pollen was put on styrofoam trays above the brood box and queen excluder (Figure 2). In 2016, the first pollen treatment of approximately 300g was given on the 16 th 17 th March, followed by a second treatment of 300g pollen on the 12 th 13 th April, and a final treatment of 300g pollen on 17 th 19 th May. In 2017, we aimed to increase the amount of pollen provided over autumn so pollen treatments were increased to 600g and provided on the 13 th 14 th February, 7 th 10 th March, 4 th 6 th April and 25 th 27 th April. We also removed any stored pollen frames from all colonies at the first treatment, to allow better differentiation of control and pollen treatment colonies. Pollen treatments were readily consumed by colonies (Figure 3), but before giving the pollen treatment any remaining pollen from the previous treatment was removed and recorded. Any colonies that had substantial pollen left were excluded from the analysis. 2

13 August almond pollination High Pollen Tea-tree, Lincoln weed HP Adelaide LP Low Pollen Pink Gum Figure 1. Map of South Australian study sites used to compare low pollen (LP) and high pollen (HP) foraging conditions. Figure 2. Pollen treatment (approximately 300g per tray) placed above the brood box and queen excluder. 3

14 Figure 3. Inspection between treatments to confirm pollen was being consumed by worker bees. Colony assessments and sample collection Colonies were visually assessed for colony size by the number of frames covered with bees at the initial pollen treatment date, in May (17 th 19 th May 2016, 7 th 8 th May 2017), and a final assessment in August during almond pollination (10 th 12 th August 2016, 7 th 8 th August 2017). Colonies were also checked for an active laying queen and any signs of brood disease. At each assessment, a sample of 30 adult worker bees was collected from the honey super to target older bees and a separate sample of 30 adult worker bees collected from a brood frame to target younger nurse bees. Bees were collected in 70ml specimen containers on ice and transferred to -20 C. Frozen bees were transported to CSIRO Canberra with ice packs and stored at -20 C until needed. Molecular analysis for Nosema, viruses and vitellogenin For each colony, total DNA was extracted from the 30 older adult bees to quantify levels of N. apis and N. ceranae. Bees were macerated in sterile extraction bags (Bioreba) in 10ml of 0.05 potassium phosphate buffer. We pipetted 10ul onto a slide with a counting chamber (Improved Neubauer) and estimated Nosema spore levels under 400x magnification (Leica DM2500) as described by Hornitzky (2005). We also collected 500ul of crude bee preparation in 1.5ml centrifuge tubes for use with the High Pure PCR Template Preparation kit (Roche) following the manufacturer s instructions. Total RNA was extracted for each colony from the 30 younger adult bees collected from brood frames to quantify levels of RNA viruses, Black queen cell virus (BQCV) and Sacbrood virus (SBV), and gene expression levels of vitellogenin. Vitellogenin is a precursor of egg yolk protein that is commonly used as a biomarker of the nutritional status of bees (Di Prisco et al., 2011). Bees were 4

15 macerated in sterile extraction bags (Bioreba) in 10ml of Purelink lysis buffer (Life technologies) and 100µl of beta-mercaptoethanol (Sigma-Aldrich). We collected 1ml of crude bee lysate into a 1.5ml centrifuge tube and added 200ul chloroform. After shaking tubes for 30sec we span them at 14,000 g for 5min for phase separation. We collected 200ul of the supernatant in a fresh 1.5ml centrifuge tube for use with the Purelink Pro 96 total RNA purification kit (Life technologies) following the manufacturer s instructions. Quantitative PCR was performed using the SYBR green method to determine levels of N. apis and N. ceranae from the DNA samples and vitellogenin, BQCV and SBV levels from the RNA samples. Honey bee reference genes ARP and RPS5 were amplified for each sample (only RPS5 for DNA templates) to normalise the data. Reactions were ran in duplicate on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad). DNA templates (1µl) were amplified in 10µl reactions using PowerUp SYBR Green Master Mix (Applied Biosystems) and 400nM of each primer. RNA templates (1µl) were amplified in 10µl reactions using Power SYBR RNA-to-C T 1-Step kits for one-step RT-PCR containing 200nM of each primer. Thermal cycling conditions for Nosema spp. was 50 C (2min), 95 C (2min), then 35 cycles of 95 C (15sec) 64.5 C (1min). Thermal cycling conditions for honey bee genes and RNA viruses was 48 C (30min), 95 C (10min), then 35 cycles 95 C (15sec), 60 C (1min). All reactions were followed by a melt curve step to ensure amplification specificity. PCR primers are provided in Table 1. Standard curves were generated for each assay from serial dilutions of quantified purified PCR products and ran with all samples. Table 1. Primers used for quantitative PCR NAME SEQUENCE 5'-3' REFERENCE NC841F_HUANG GAGAGAACGGTTTTTTGTTTGAGA (Huang and Solter, 2013) NC980R_HUANG ATCCTTTCCTTCCTACACTGATTG NA65F_HUANG CGTACTATGTACTGAAAGATGGACTGC (Huang and Solter, 2013) NA181R_HUANG AGGTCTCACTCTTACTGTACATATGTTAGC VITELLOGENIN F TCGACAACTGCGATCAAAGGA (Schwarz et al., 2016) VITELLOGENIN R TGGTCACCGACGATTGGATG ACTIN RELATED PROTEIN 1 F CCAAAGACCCAAGCTCCCTA (Schwarz et al., 2016) ACTIN RELATED PROTEIN 1 R TGGCTTATTGGTTTATGTTTTTCGT RIBOSOMAROTEIN S5A F AATTATTTGGTCGCTGGAATTG (Schwarz et al., 2016) RIBOSOMAROTEIN S5A R TAACGTCCAGCAGAATGTGGTA BQCV_4372_F GATTCGTCTTGGGCGTCTGA this study BQCV_4541_R GCCTGAAATGGTTGCGTCTG SBV_6138_F TCCAGCCTCACTGGATGAGA this study SBV_6350_R GAACAAACTCAACACGCGCT 5

16 Statistical analysis All statistical analyses and graphs were done in Graphpad Prism 7. Frames of bees and Nosema spore counts were log 10 transformed and the change from initial values calculated for May and August (final values / initial values). Raw Nosema spore counts and percentage incidence were also analysed. Quantitative PCR data was exported from the Bio-Rad CFX Manager 3.1 to qbase+ 3.1 (Biogazelle) (Hellemans et al., 2007) for quality control, normalisation and relative quantification of the data. Log 10 transformed data was exported to Prism for analysis. Differences between groups (pollen treatment and forage type) were compared by two-way ANOVA with Tukey s multiple comparison tests. Spearmen correlations were also used to compare the relationship between Nosema spp. levels and vitellogenin expression. P-values below 0.05 were considered significant. 6

17 C h a n g e in fra m e s o f b e e s C h a n g e in fra m e s o f b e e s Results Effect of pollen availability on colony size and pathogen prevalence Colony size decreased as expected for all colonies over autumn and winter, but there was no positive effect from the supplemented pollen treatment in either 2016 or There were varying responses to the foraging conditions between years (Figure 4). Colonies placed on high pollen forage in 2016 had significant reductions in colony size compared to colonies on low pollen forage. Unfortunately there was unexpected site variation in Yorke Peninsula in 2016 that appears to have influenced the strength of HP1 and HP2 colonies, with only one HP1 site having significant Lincoln weed present. The reduced size of HP1 and HP2 colonies also suggests that Teatree flowering at Yorke Peninsula sites was insufficient to yield a high pollen environment. In 2017, site variation was better controlled to give a clearer distinction of low and high pollen environments. We found colonies placed on low pollen forage in May had greater reductions in colony size than colonies on high pollen forage, but no significant difference in August. 1.2 M a y A u g u s t a a b b b b 0.6 a b c b c c c H P 1 H P 2 H P 1 H P 2 M a y A u g u s t a a b b b 0.6 a a a a F o ra g e ty p e H P F o ra g e ty p e H P Figure 4. Effect of autumn supplementary pollen treatment and forage conditions (low or high pollen) on colony size in control ( ) and treatment ( ) colonies. Different letters represent a significant (P < 0.05) difference between groups. 7

18 N osem a spore x50,000 N osem a spore x50,000 % in fected h ives % in fected h ives Effect of pollen availability on Nosema spores Nosema incidence and intensity based on spore counts had very different profiles in 2016 and 2017, but showed no response to supplemented pollen treatment. Comparisons between forage type found there were significantly fewer infected colonies under low pollen forage conditions in May 2016 (chisquare = 14.97, df = 1, P < 0.001), whereas in August 2017 there were significantly more infected colonies under low forage conditions (chi-square = 20.28, df = 1, P < 0.001) (Figure 5). Nosema spore counts in infected colonies were considerably lower in 2017, but similarly spore counts were also significantly higher for colonies on low pollen forage (t-test, df = 44, P < 0.001) (Figure 6) * * 5 0 H igh pollen H igh pollen 2 L o w p o lle n H ig h p o lle n L o w p o lle n 0 In itial M a y A u g u s t 0 In itial M a y A u g u s t Figure 5. Nosema incidence in colonies under low and high pollen forage conditions from autumn to winter c o n tro l H P 1 c o n tro l H P 2 c o n tro l p o lle n H P 1 p o lle n H P 2 p o lle n * c o n tro l H P c o n tro l p o lle n H P p o lle n 0 0 In itia l M a y A u g u s t In itia l M a y A u g u s t Figure 6. Nosema spore counts of colonies under low and high pollen forage conditions from autumn to winter. Comparing the change in Nosema spores counts from initial levels also found no effect from the autumn supplementary pollen treatment in May or August, but there was an observed positive effect with increased pollen availability in the environment (Figure 7). In both years the change in Nosema spore levels was significantly lower in August for colonies on high pollen forage (HP1 control colonies in 2016, all HP colonies in 2017), indicating that increased pollen availability in autumn can result in reduced Nosema infection post-winter. However, results in May were more variable with significantly higher spore counts for colonies on high pollen forage in 2016 and no difference between forage type in

19 C h a n g e in N o s e m a s p o r e s C h a n g e in N o s e m a s p o r e s M a y A u g u s t a a a b a b b c c a a b b a b a a b H P 1 H P 2 H P 1 H P 2 M a y A u g u s t a a a a 0.0 a a b b H P H P F o ra g e ty p e F o ra g e ty p e Figure 7. Effect of autumn supplementary pollen treatment and forage conditions (low or high pollen) on the change in Nosema spore counts in control ( ) and treatment ( ) colonies. Different letters represent a significant (P < 0.05) difference between groups. Effect of pollen availability on levels of N. apis and N. ceranae Relative levels of N. apis and N. ceranae were determined by quantitative PCR, which were generally consistent with the observed spore count data. Throughout the experiment in both years, N. apis was the more prevalent species infecting colonies (Table 2). Nosema ceranae was common in both May and August but mostly as a coinfection with N. apis. Interestingly, N. ceranae was rarely the dominant infection in 2016, but in 2017 when Nosema spore levels were relatively low, N. ceranae was more abundant in 59% of coinfected samples. Table 2. Prevalence of N. apis and N. ceranae in spore-positive samples. NC>NA is the proportion of samples where N. ceranae was the dominant infection. N. apis N. ceranae Both NC>NA May August August

20 R e la tiv e in fe c tio n le v e l R e la tiv e in fe c tio n le v e l As observed for the spore count data, there was no significant effect on relative infection levels in response to the supplementary pollen treatment, but infection levels were influenced by the availability of low or high pollen foraging environments In May 2016 there was a trend for higher infection levels with higher pollen availability, but few significant differences between groups (Figure 8). Pollen treatment colonies on high pollen forage (HP2 only) had significantly higher infection levels for both the control colonies on low pollen forage for N. apis and the pollen treatment colonies for N. ceranae on low pollen conditions. By August 2016 infection levels were lowest in colonies on high pollen forage (HP1 only) (Figure 8). They were significantly lower than the control colonies on high pollen forage (HP2) for N. apis and lower than both the low pollen and high pollen (HP2) colonies for N. ceranae. This suggests that the high pollen availability for HP1 colonies was effective in reducing Nosema infection levels postwinter. M a y N. a p is A u g u s t N. a p is a a b a b a b a b H P 1 H P 2 b 0.5 a a b a a b a b H P 1 H P 2 M a y N. c e r a n a e A u g u s t N. c e r a n a e a b a a b a a b b 0 a a b b a a H P 1 H P 2 H P 1 H P 2 F o ra g e ty p e F o ra g e ty p e Figure 8. Effect of autumn supplementary pollen treatment and forage conditions (low or high pollen) on relative N. apis and N. ceranae infection levels in control ( ) and treatment ( ) colonies in Different letters represent a significant (P < 0.05) difference between groups. 10

21 R e la tiv e in fe c tio n le v e l The overall low prevalence of Nosema in 2017 restricted the quantitative analysis to August, but a similar pattern was observed with colonies in high pollen foraging environments having lower relative infection levels (Figure 9). Pollen treatment colonies on high pollen forage had significantly lower N. apis levels than the control colonies on low pollen forage, and the control colonies on high pollen forage had significantly lower N. ceranae levels than all colonies on low pollen forage. A u g u s t N. a p is A u g u s t N. c e r a n a e a a b a b b 0 a a b a b H P H P F o ra g e ty p e F o ra g e ty p e Figure 9. Effect of autumn supplementary pollen treatment and forage conditions (low or high pollen) on relative N. apis and N. ceranae infection levels in control ( ) and treatment ( ) colonies in Different letters represent a significant (P < 0.05) difference between groups. Effect of pollen availability on virus prevalence BQCV was generally more common than SBV in both years (Table 3). There was no clear effect of pollen treatment or forage type on the prevalence or relative levels of either virus. However, the low virus prevalence in 2017 is consistent with the lower Nosema levels also observed, suggesting that the presumably favourable conditions in 2017 had similar influence on both pathogen types. Table 3. Prevalence of BQCV and SBV in control and pollen treatment colonies Control Treatment BQCV SBV Both BQCV SBV Both May August May August

22 R e la tiv e v ite llo g e n in le v e l R e la tiv e v ite llo g e n in le v e l Effect of pollen availability on vitellogenin expression levels There was no significant effect from autumn supplementary pollen treatments on the expression of vitellogenin, but some difference observed between low and high pollen foraging conditions (Figure 10). In both years there was a trend for higher relative vitellogenin expression with higher pollen availability in May, however this was only significant between control colonies on low pollen forage and pollen treatment colonies on high pollen forage (HP2). In August there was some evidence for lower Vg expression when there was higher pollen availability, with levels in pollen treatment colonies on high pollen forage (HP1) significantly lower than colonies on low pollen forage, however there was generally little difference between groups. The pattern of vitellogenin expression in 2016 appeared to mirror Nosema spp. levels, which could be interpreted that the better nutritional status of colonies on high pollen forage supports greater Nosema levels. However, correlation between vitellogenin and Nosema levels did not support this as there was only a significant correlation between N. ceranae levels and vitellogenin in August 2016 (Figure 11). There was also a significant difference between relative vitellogenin expression in May 2016 compared to May 2017 and August in both years (Figure 12). We suggest that 2016 may be a more typical vitellogenin expression pattern where levels are higher in autumn and drop over winter, although it is unclear what led to the relatively low vitellogenin expression in May M a y A u g a a b a b a b a b b 0.0 a a a b b a b a b H P 1 H P 2 H P 1 H P 2 M a y A u g a a a a 0.0 a a a a H P H P F o ra g e ty p e F o ra g e ty p e Figure 10. Effect of autumn supplementary pollen treatment and forage conditions (low or high pollen) on vitellogenin expression in control ( ) and treatment ( ) colonies. Different letters represent a significant (P < 0.05) difference between groups. 12

23 R e la tiv e v ite llo g e n in le v e l R e la tiv e in fe c tio n le v e l R e la tiv e in fe c tio n le v e l M a y A u g u s t R e la tiv e v ite llo g e n in le v e l R e la tiv e v ite llo g e n in le v e l Figure 11. Correlation between vitellogenin expression and infection levels of N. apis ( ) and N. ceranae ( ) in a b b b 0.8 M a y M a y A u g u s t A u g u s t Figure 12. Effect of autumn supplementary pollen treatment (low or high pollen) on vitellogenin expression in control ( ) and treatment ( ) colonies across seasons. Different letters represent a significant (P < 0.05) difference between groups. 13

24 Implications Ensuring colonies are in a good nutritional condition and have low pathogen pressure is key to successful overwintering. The high demand for early season pollination of almonds has added further need for colonies to come through winter with strong numbers of healthy bees. To achieve this, supplementary feeding of pollen and pollen substitutes has become a common strategy for beekeepers in autumn and winter. However, the results of this study and earlier work by Somerville and Collins (2007) have failed to demonstrate the effectiveness of supplementary pollen to reduce pathogen loads. Laboratory studies show that bees fed pollen live longer but Nosema levels also increase (Fleming et al., 2015; Hornitzky, 2011; Porrini et al., 2011; Rinderer and Dell Elliott, 1977; Zheng et al., 2014), suggesting that pollen helps worker bees tolerate rather than supress Nosema infection. In this study, the pollen treatment was aimed at improving the resilience of colonies to infection by improving the nutritional status of emerging worker bees. However, we found no significant response, positive or negative, to providing additional pollen to colonies during autumn in levels of N. apis, N. ceranae or viruses. We fed 900g of pollen per colony over about eight weeks in 2016 and increased this to 2.4 kg of pollen per colony over about ten weeks in This raises important cost-benefit questions for prophylactically giving pollen supplements to colonies as a strategy for managing Nosema and virus levels. That is not to say that supplementary feeding is not a useful management strategy for supporting colony nutrition or manipulating behaviour (Somerville, 2005). However, before recommending pollen supplements as an effective strategy for managing Nosema or viruses, we need to further understand how supplementary pollen is used by colonies under different conditions and how this influences the development of Nosema and virus infections in colonies. Despite the lack of response to supplementary pollen treatments, there were significant responses from colonies given access to high or low pollen foraging conditions, but not consistently. The most consistent response to pollen availability was observed for August Nosema levels. In both years, colonies placed under high pollen conditions had significantly less increase in spore counts and less increase in both N. apis and N. ceranae levels. There was also significantly lower incidence of Nosema in colonies on high pollen conditions in August A limitation of this study was a lack of detailed pollen analysis for the different sites, which would have more reliably defined high and low pollen sites and help explain the variable response observed in However, these results are a promising indication that targeting high pollen environments in autumn can be an effective management strategy to suppress Nosema levels during almond pollination. To the best of our knowledge, this suppressive effect has not been demonstrated before at the colony level. DeGrandi-Hoffman et al. (DeGrandi- Hoffman et al., 2016) did show that colonies foraging on rapini (Brassica rapa) had lower Nosema spore levels than colonies fed protein supplement and other studies have also demonstrated that pollen quantity, quality and diversity are beneficial for bee physiology and colony overwintering survival (Alaux et al., 2017; Di Pasquale et al., 2013; Filipiak et al., 2017; Frias et al., 2016). If increased pollen availability in the environment can be effective at suppressing Nosema, why was there no effect from providing additional pollen directly in colonies? The supplementary pollen comes from mixed floral sources and contains suitable crude protein levels and all essential amino acids (pers. comm. T. Brown). Perhaps the quality and diversity of the supplementary pollen was still insufficient compared to the naturally available pollen to elicit an effect on Nosema levels. Another factor could be the way that the pollen is collected by bees and how this influences its use in the colony, such that external supplementary feeding might have a different effect. Nevertheless, the results of this study highlight the importance in considering the nutritional value of the foraging environment when selecting apiary sites, something most beekeepers would do already. However, having greater characterisation of different foraging environments (e.g. pollen analyses to examine diversity and quality) would assist beekeepers to make more informed decisions. In this study, we have provided some insight for how Pink Gum and Tea-tree can influence colony health. This can be difficult to achieve for all flowering options in Australia, but having more detailed knowledge of how 14

25 the most common floral resources influence colony health would be valuable information for beekeepers. This study investigated the relative levels of N. apis and N. ceranae in colonies and expression of vitellogenin at different time points. This takes our understanding of Nosema disease further than relying only on Nosema spore counts. These South Australian apiaries are an example where in 2014 all tested apiaries had very high Nosema spore counts with both N. apis and N. ceranae present (Roberts et al., 2015). However, using quantitative PCR detection we were able to show that across this study N. apis was still the dominant species causing high infections. This is in stark contrast to other countries such as the USA, where N. ceranae has almost completely displaced N. apis (Traynor et al., 2016). Expression of vitellogenin may still be a useful biomarker for further investigations of colony health, despite not showing a strong response in this study. Other studies have found good correlations between vitellogenin levels and colony strength (Alaux et al., 2017; Dainat et al., 2012; Smart et al., 2016), but relationships with Nosema and viruses has been more varied (Antúnez et al., 2013; Chaimanee et al., 2012; Prisco et al., 2011; Zheng et al., 2014). The profile of vitellogenin expression also varies with bee age, with older foraging bees have lower vitellogenin expression (Amdam and Omholt, 2002). Perhaps having more targeted collection of nurse bees may provide a more reliable profile of vitellogenin expression in relation to colony health. Recommendations This project made assumptions that pollen was effectively used by colonies and translated into improved nutrition of developing worker bees. Further research is needed to understand how pollen availability in the environment or through supplementary feeding influences the nutritional quality of brood food and how this corresponds to disease susceptibility. Further application of molecular tools and high-throughput sequencing to more accurately understand the pollen quality and diversity in different environments and what pollens are actually utilised by colonies to support nutrition. Using commercial hives has many benefits in terms of real-world relevance, but means it is more difficult to control environmental and management variables or apply stressful treatments. Further experiments into disease management will benefit from more controlled experiments under lab and research apiary conditions to better understand the fundamental factors involved in disease outbreaks. 15