Barley Vulnerability to Wheat Stem Rust: Enhancing our Limited Resistance Sources

Transcription

1

2 Barley Vulnerability to Wheat Stem Rust: Enhancing our Limited Resistance Sources Maricelis Acevedo Plant Pathology Department North Dakota State University

3 Dr. Robert Brueggeman, NDSU, Barley Pathologist

4 Wheat vs. barley resistance to wheat stem rust To date only seven resistant to P. gramins f. sp tritici (Rpg) genes have been identified (Steffenson et al., 2009). Only Rpg1 has been widely utilized in commercial cultivars Only the rpg4/rpg5 locus provides resistance to the highly virulent stem rust races of the TTKS (Ug99) lineage Currently, more than 40 stem rust resistance genes have been identified in wheat and its relatives (McIntosh et al., 1995).

5 Barley vulnerability to stem rust Newer races of the pathogen such as QCCJ in the 90 s in the US and the emerging Ug99 lineage in Easter Africa remind us of the vulnerability of the crop.

6 But there is hope. Previous evaluation of a double haploid population of a cross between the barley lines Q21861 (stem rust resistant) and SM89010 (stem rust seedling susceptible) identified a hot-spot for genes associated with an enhancement of stem rust resistance in the barley chromosome 2H (Moscou et al., 2011).

7

8

9

10 INCORPORATION AND CHARACTERIZATION OF BARLEY LOCI ASSOCIATED WITH WHEAT STEM RUST RESISTANCE ENHANCEMENT

11 Objective 1 Expand the genetic basis of the stem rust resistance in adapted barley cultivars with superior agronomic, malting, and brewing characteristics which already combine the Rpg1 and the rpg4/rpg5 resistances. Fall 2012 Conlon X SM89010 Pinnacle X SM89010 ND25160 X SM89010 Fall/Winter 2013 stem rust evaluation of NDSU AES greenhouse facility and BSL3 greenhouses MCCF (Rpg1) QCCJ (rpg4/rpg5) TTKSK (rpg4/rpg5)

12 Detection and quantification of enhancement of WSR resistance Problem. How do I measure the enhancement of resistance in the present of Rpg1 and rpg4/rpg5? Traditional method - IT, DR and DS Quantitative PCR (qpcr) assay that allows the quantification of fungal growth in plant tissue.

13 Quantification of FDNA in infected tissue Barley Variety Documented Phenotype to MCCF Resistance Genes Present Steptoe Susceptible Beacon Moderately resistant Rpg1 Morex Resistant Rpg1 Q21861 Highly resistant Rpg1, rpg4, Rpg5 Chevron Highly resistant Rpg1 Barley lines used for evaluation of resistance to P. graminis f. sp. tritici race MCCF Primer/Probe Sequence (5-3 ) size Bubi-F1 ACTACAACATCCAGAAGGAGTCCAC Bubi-R1 GTCGAAGTGGTTGGCGGCCATGAAGGTC 242 bp ITS1rustF10d TGAACCTGCAGAAGGATCATTA ITS1rustR3c TGAGAGCCTAGAGATCCATTGTTA 270 bp Barley ubiquitin VIC-CGCCAAGAAGCGCAAGAAGAAGACGTACACC MGBNFQ P. graminis 6FAM-TTGTGGCTCGACTCTCTTATAAACCAAACC- MGBNFQ Primers and Probes used in the experiment, and the expected amplicon size. Previously published in Barnes and Szabo, 2007

14 Ranking of pathogen growth at different time points Rank (1 is most Time Cultivar susceptible) Tukey classification 48 HPI Q A 48 HPI Morex 2AB 48 HPI Chevron 2AB 48 HPI Steptoe 3B 48 HPI Beacon 4C Rank (1 is most Tukey Time Cultivar Susceptible) classification 96 HPI Chevron 1A 96 HPI Morex 2B 96 HPI Beacon 3C 96 HPI Steptoe 4D 96 HPI Q D Rank (1 is most Time Cultivar susceptible) Tukey classification 144 HPI Chevron 1 A 144 HPI Beacon 2 B 144 HPI Q B 144 HPI Steptoe 3 C 144 HPI Morex 3 C Time Cultivar Rank (1 is most susceptible) Tukey classification 8 DPI Steptoe 1A 8 DPI Beacon 1A 8 DPI Chevron 1A 8 DPI Morex 2B 8 DPI Q B Time Cultivar Rank (1 is most susceptible) Tukey classification 10 DPI Steptoe 1 A 10 DPI Beacon 1 A 10 DPI Chevron 1 A 10 DPI Q B 10 DPI Morex 3 C Time Rank (1 is most Cultivar susceptible) Tukey classification 12 DPI Steptoe 1 A 12 DPI Beacon 2 B 12 DPI Chevron 3 C 12 DPI Q D 12 DPI Morex 5 E

15 What else can we measure to dissect the system? Cultivar 24hpi 48hpi 72hpi 96hpi 7dpi Little club Haustoria Haustoria Haustoria Sporulation Sporulation (wheat) GP Transgenic Appresorium Appresorium Haustoria Haustoria, no sporulation Sporulation Golden Promise Haustoria Haustoria Haustoria Haustoria, no sporulation Steptoe Haustoria Haustoria Haustoria Haustoria, no sporulation Morex Appresorium Appresorium Appresorium Haustoria, no sporulation No sporulation Sporulation No sporulation Q21861 Appresorium Appresorium Appresorium Appresorium No haustoria No sporulation Colony size is larger in Little Club compared to all other cultivars. Golden Promise had more number of infection sites per square centimeter. Morex had aborted colonies, abortion at appresorium stage at 48 and 72 hpi. Very less established colonies. GP transgenic had no aborted colonies, every single infection site was established.

16 Histological evaluation Tg_7d haustoria sporulation

17 Objective 2. Development of genetic markers highly associated with enhancement of stem rust resistance For the genomic region enhancing resistance to Ug99 single nucleotide polymorphism (SNP) will be evaluated between Q21861, Conlon, Pinnacle ND25160 and SM Cyber-green assay couple with a High Resolution Melt Curve Analysis to detect SNP in barley bins

18 Marker Development for WSR resistance enhancer Sequences from the Affymetrix chip were identified and blasted against the Barley Genome Exons were identified and exon spanning primers were created using Primer3 22 primer pairs spanning exons for four genes in the eqtl regions Q21861 and SM89010 Amplicons were extracted and sent to Genewiz for sequencing. SNPs were identified in 5 of the 22 amplicons and 7 primer sets were developed for melt curve analysis 4 primer sets were able to distinguish the SM89010 vs. the Q21861 alleles.

19 SNP marker development

20 Future work Evaluate the usefulness of the SNP markers developed as diagnostic markers for the stem rust resistance enhancer Field and greenhouse evaluations of BCF2 and BCF3 populations combining Rpg1, rpg4/rpg5 and the enhancer Characterize the hot-spot for genes associated with an enhancement of stem rust resistance in the barley chromosome 2H