MDA-MB-231 cells were grown in DMEM and T47Ds in RPMI, supplemented with 10% fetal bovine

Transcription

1 Detailed Materials and Methods. Cell culture & generation of stable knockdown cell lines All cell lines were purchased from the ATCC and grown at 37 C in 5% CO 2 and were supplemented with penicillin (100 IU/ml), streptomycin (100 μg/ml) and amphotericin-b (250 ng/ml). MCF7 and MDA-MB-231 cells were grown in DMEM and T47Ds in RPMI, supplemented with 10% fetal bovine serum; T47D cells were additionally supplemented with insulin (10 μg/ml). MCF10A cells were grown in DMEM/F12 supplemented with 20% horse serum, EGF (20 ng/ml), hydrocortisone (0.5 mg/ml), cholera toxin (100 ng/ml) and insulin (10 μg/ml). MDA-MB-231 cells were grown in DMEM with 2.5% charcoal dextran stripped FBS for the low serum growth assay. Stable REST knockdown (REST low ) was achieved as previously described(1). Stable knockdown of LIN28A (LIN28A low ) was achieved via lentiviral delivery of an anti-lin28a shrna (clone TRCN ) in a plko.1 vector obtained from Open Biosytems (Huntsville, AL). A scramble shrna (plasmid 1864, Addgene, Cambridge, MA) was used as a control (LIN28A norm ). Lentiviral particles were generated and cells infected according to Addgene s plko.1 protocol ( Chromatin immunoprecipitation As previously described(12) with the following exceptions. 2μg of anti-rest antibody (H-290, Santa Cruz Biotech, Santa Cruz, CA), anti-g9a antibody (07-551, Upstate, Billerica, MA) or rabbit IgG (Sigma-Adrich, St. Louis, MO) was added to 300μg total protein. All washes were performed using TSE with 500mM NaCl. Quantitative real-time PCR was performed using the following primers: LIN28A: AGCGGGAACCGGCATTGAGGAA, AAAGGGGAGTTGAACGCTCTGGCTTCT

2 BDNF: TTACAGCGCGGCCAAGAAGACTAC, CCATCCGCACGTGACAAACC Negative control (REST promoter region, which does not contain an RE1 site): TGGCCGCACCTCAGCTTATTATG, AGGCTGAGGTTCTACGACGCTGAG Quantitative RT-PCR Total RNA was harvested from cultured cells (in biological triplicate) or xenograft tumors using TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer s protocol, re-suspended in sodium citrate (1mM, ph 6.4) containing RNASecure (Ambion, Austin, TX), quantitated via Nanodrop (Thermo Scientific, Wilmington, DE) and reverse transcribed using SuperScript III (Invitrogen, Carlsbad, CA) according to manufacturer s instructions. Real-time PCR was performed using SYBR Premix Ex Taq (Takara Bio Inc., Otsu Shiga, Japan) and primers listed below or purchased from RealTimePrimers.com (HHK-1, human housekeeping gene set; used B2M, GAPD and PGK). Statistical analysis was performed using Prism; a paired two-tailed t-test was used to compare tumor gene expression levels (Fig 3J). LIN28A (pre-mrna): CCACCCAGTGTGAAGAGGTT, CTTGCCCAGCTTGTCTTAGG LIN28A (mrna, pair 1): GGCCACGGGCTCAGCCGACGACCAT, AGCCGAACCCCATGCGCACGTTGAACC LIN28A (mrna, pair 2): TGCACCAGAGTAAGCTGCAC, CTCCTTTTGATCTGCGCTTC Actin: GCCCCGCGAGCACAGAG, CACGATGGAGGGGAAGACG Luciferase reporter assay Approximately 2kb of the LIN28A promoter region including (+RE1) or excluding (-RE1) the REST binding (RE1) site was amplified from HEK-293T genomic DNA using the following primers, and was

3 cloned into pgl3-basic (Promega, Madison, WI) at the Acc65I AND XhoI sites. Cells were transfected with pgl3-promoter (positive control, Promega), pgl3-basic, pgl3-basic +RE1, or pgl3-basic RE1 and RL-TK renilla (transfection control, Promega) using calcium phosphate. 48 hours posttransfection, luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega) according to manufacturer s instructions and luciferase signal was normalized to renilla. +RE1 forward: AAAAGGTACCGTGACTCAATTCAGCACCGTGGAC -RE1 forward: AAAAGGTACCAGCCCTCAGGACCCTGGACAGAGA Reverse: AAAACTCGAGCCCGAGCTCGAACCTGCAAACTGC Immunoblotting Cells were washed with cold PBS and harvested into lysis buffer (150mM NaCl, 10% glycerol, 0.3% Triton X-100, 50mM Tris ph 8.0). Proteins were resolved via SDS-PAGE and transferred to PVDF. Immunoblotting was performed with the following antibodies and visualized with enhanced chemiluminescence (Thermo Fisher, Rockford, IL); anti-rest (Upstate , Billerica, MA, 1:1000), anti-lin28a (Abcam ab46020, Cambridge, MA, 1:500), anti-β-actin (MP Biomedicals, Solon, OH, 1:10,000), anti-rabbit IgG-HRP (sc-2004, Santa Cruz Biotechnology, Santa Cruz, CA), anti-mouse IgG- HRP (sc-2005, Santa Cruz Biotechnology). Immunofluorescence Paraffin-embedded cells were deparaffinized and rehydrated according to antibody manufacturer s protocol (Abcam, Cambridge, MA). Slides were blocked with 10% goat serum for 1h at RT, washed three times in PBST (PBS, 0.2% Triton X-100), and incubated with primary antibody (anti-lin28a Abcam ab46020, 1:1000) at 4 C overnight. Slides were washed, incubated with secondary antibody

4 (Alexa Fluor goat anti-rabbit 594, 1:1000, Invitrogen, Carlsbad, CA), washed, and mounted in Vectashield Mounting Medium with DAPI (Vector Laboratories, Burlingame, CA). Microscopic imaging was performed with a digital camera (Spot II; Diagnostic Instruments, Sterling Heights, MI) on a Nikon E600 Eclipse epifluorescent microscope with 20x plan apochromatic objective and a standard TRITC filter cube (TRITC; EX nm; DM 565 nm; BA nm). Fluorescent images were acquired at an initial 36-bit tone scale and saved as 16-bit files. Minimal image manipulation was performed using Adobe Photoshop according to AACR guidelines. Clonogenic assay and soft agar colony formation Clonogenic assays were performed as previously described(21). Briefly, cells were plated at low density in six-well plates (MCF10A 200 cells/well; MCF7 500 cells/well; MDA-MB cells/well) and allowed to grow for 1-2 weeks. Cells were fixed with methanol and stained with crystal violet (0.5% in 70% MeOH). For soft agar assays, 20,000 cells/well were suspended in 0.4% (MCF7) or 0.3% (MCF10A) agar containing growth medium, and were overlaid over 0.7% or 0.5% agar (MCF7 or MCF10A, respectively) in triplicate in 6-well plates. After 14 days, colonies were stained with 0.005% crystal violet, photographed and counted using NIH ImageJ. Statistical analyses were performed using Prism (Graph-Pad Inc., Mann Whitney test). Xenograft Experiments All procedures were performed with the approval of the University of Wisconsin-Madison School of Medicine and Public Health Institutional Animal Care and Use Committee and according to national guidelines and policies. Adult intact female athymic nude-foxn1 nu mice (Harlan Laboratories, Indianapolis, IN) were used. MCF7 cells were pretreated for 6 days with 1 nm 17-β-estradiol as

5 previously described(22) and suspended in a cold 1:3 Matrigel/DMEM solution cells were injected per site; each mouse received two subcutaneous flank injections and subcutaneous injections into the fat pads of the 4 th mammary glands. Tumors were monitored weekly by palpation and caliper measurements. Tumor volume was calculated using the equation for the volume of an ellipsoid (length and width were measured; height was the average of length and width). Tumors were flash-frozen in liquid nitrogen for RNA extraction or fixed in neutral buffered formalin (10%), embedded in paraffin, sectioned and stained with H&E for histopathological analysis. A board-certified pathologist (A.F.) examined tumor sections, described the pathology, identified tumors exhibiting local invasion, and counted cells undergoing mitosis in each of seven fields of view per tumor (REST norm n=3; REST low n=10) under 400x magnification. Kaplan-Meier and Log-rank (Mantel-Cox) survival analyses were performed on tumor take data and tumor burden was evaluated via Mann Whitney test using Mstat (Norman Drinkwater, University of Wisconsin-Madison) and Prism (Graph-Pad Inc.) software; twosided p-values were used throughout. Microarray datasets and analysis Microarray analysis was performed as previously described(1). Analyses on the microarray data were performed using MultiExperiment Viewer and Prism 5. Tumor gene expression data were obtained from the NCBI Gene Expression Omnibus, and are identified by their GEO dataset record number. Analysis of datasets GSE2990 and GSE2034 were performed to define tumors as RESTless or RESTfl using the gene signature derived in Wagoner et al.(1). The dataset was log2 transformed and the samples were median centered. LIN28A expression was then calculated as fold-median and the difference in expression between RESTless and RESTfl in each data set was tested for significance using the unpaired t-test.

6