Electronic Supplementary Information (ESI) for

Transcription

1 Electronic Supplementary Information (ESI) for Multicolor Fluorescent Biosensor for Multiplexed Detection of DNA Rong Hu, 1, 2 Tao Liu, 1 Xiao-Bing Zhang 1 *, Shuang-Yan Huan 1, Cuichen Wu 2, Ting Fu 1, Weihong Tan 1, 2 * 1 Molecular Science and Biomedicine Laboratory, State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, College of Biology, Hunan University, Changsha , P.R. China. 2 Center for Research at the Bio/Nano Interface, Department of Chemistry and Department of Physiology and Functional Genomics, Shands Cancer Center, UF Genetics Institute, and McKnight Brain Institute, University of Florida, Gainesville, Florida , United States These authors contributed equally to this work. 1

2 Table S1. Sequences of oligonucleotides used in this work Name P1 T1 P2 T2 P3 T3 T4 T5 Sequences(from 5 to 3 ) FAM-CTGAATTCTGGATGTAGTTAGTAGTC GACTACTAACTACATCCAGAATTCAGTGAG TAMRA--CAGATATCGTTAAGTAGGTGCATGTGTC GAC ACA TGC ACC TAC TTA ACG ATA TCT GAG CG Cy5-CTAGTTCTAAGTTCTGATCGATCGTAGC GCTACGATCGATCAGAACTTAGAACTAGAATG GAC ACA TGC ACC TAC TTA CCG ATA TCT GAG CG GAC ACA TAC ACC TAC TTC ACG ATA TCT GAG CG 6e-7 6e-7 R 2 = e-7 1/(F 0 -F) 5e-7 4e-7 4e-7 3e /[PDI] Fig. S1 Lineweaver Burk plot for 100 nm P3. F 0 and F are the fluorescence intensities of fluorophore in the absence and presence of PDI, respectively. Excitation: 643 nm, emission: 670 nm. 2

3 4.0 FAM F 0 /F TAMRA [PDI] /µm 4 3 F 0 /F [PDI] /µm Fig. S2 Stern-Volmer plots for 100 nm P1 and P2. F 0 and F are the fluorescence intensities of fluorophore in the absence and presence of PDI, respectively. The data for P1 were recorded with excitation and emission wavelengths of 494 and 520nm, respectively. The data for P2 were recorded with excitation and emission wavelengths of 559 and 583nm, respectively. 3

4 FAM DNA PDI /FAM DNA PDI Absorbance Wavelength/nm PDI TAMRA DNA PDI/TAMRA DNA Absorbance Wavelength/nm Fig. S3 Uv-vis spectral changes with the oligonucleotide. Aggregated PDI concentration: 1 µm; DNA concentration: 100 nm. 4

5 5e+5 Fluoresence Intensity/a.u. 4e+5 3e+5 2e+5 1e+5 a b control 100 nm T Wavelength/nm Fig. S4 Fluorescence emission spectra of P2 (100 nm) at different conditions: (a) P2 + Aggregated PDI; (b) P2+ Aggregated PDI nm T2. Excitation: 559 nm, emission: 583 nm. 8e+5 dsdna dsdna dsdna dsdna Fluoresence Intensity / a.u. 6e+5 4e+5 2e+5 ssdna ssdna ssdna ssdna Fig. S5 The effect of ph on the affinities of aggregated PDI toward ssdna and dsdna Excitation: 559 nm, emission: 583 nm. 5

6 F/F [PDI]/nM Fig. S6 The effect of aggregated PDI concentration. F and F 0 are the fluorescence intensities of the sensing system in the presence and absence of 50 nm of target DNA, respectively. Excitation: 559 nm, emission: 583 nm. The concentrations were 100nM for P2 and 50 nm for T F/F [Exo III] U Fig. S7 The effect of Exo III concentration. F and F 0 are the fluorescence intensities of the sensing system in the presence and absence of 50 nm of target T2, respectively. Excitation: 559 nm, emission: 583 nm. The concentrations were 100nM for P2 and 50 nm for T2. 6

7 Fig. S8 Schematic illustration of the aggregated perylene-based broad-spectrum quencher with pre-addition strategy for amplified multiplexed analysis of DNA 7

8 1.6e+6 Fluoresence Intensity/ a.u. 1.4e+6 1.2e+6 1.0e+6 8.0e+5 6.0e+5 4.0e+5 2.0e T2 T4 T5 Control Fig. S9. Selectivity of the platform analyzing target DNA T2 (75 nm) over other mismatched DNA (75 nm): T4 (single-base-mismatched target) and T5 (two-base-mismatched target). 8

9 Table S2. Analytical Performance of Homogeneous Florescence Detection Methods for DNA Using Nanomaterials. Nanomaterial Linear Range Detection Limit Assay Time Reference Pd nanowire (post-addition) CNNS (pre-addition) Single-walled carbon nanotubes Aggregated PDI (post-addition) (pre-addition) nm Exo III cycle: nm 6.0 nm 0.3 nm > 1 h 20 min > 2 h 20 min S nm 2.1 nm 12 min S2 Exo III cycle: nm 81 pm 30 min nm 4.0 nm > 3 h S nm 2.0 nm 10 min This work Exo III cycle: nm 20 pm 30 min Exo III cycle: nm 20 pm 30 min Supporting References (S1) Zhang, L. B.; Guo, S. J.; Dong, S. J.; Wang, E. K. Anal. Chem. 2012, 84, (S2) Wang, Q.; Wang, W.; Lei, J.; Xu, N.; Gao, F.; Ju, H. Anal. Chem. 2013, 85, (S3)Yang, R. H.; Jin, J. Y.; Chen, Y.; Shao, N.; Kang, H. Z.; Xiao, Z. Y.; Tang, Z. W.; Wu, Y. R.; Zhu, Z.; Tan, W. H. J. Am. Chem. Soc. 2008, 130,