Antibodies and reagents Construction and characterization of YFP-TF chimera

Transcription

1 Antibodies and reagents Antibodies: mouse monoclonal antibodies (mab) against PDI (clone 34, BD Transduction and RL90, Affinity Bioreagents); rabbit polyclonals against bovine PDI (SPA-890, Stressgen and P7496, Sigma); mab JL-8 anti-green fluorescent protein (Clontech); rabbit anti-human TF IgG (American Diagnostica); mab 10H10 and 5G9 anti-human r-tf (kind gifts from Dr. J. Morrissey, UIUC); mab anti-beta actin (Affinity Biologicals); mouse IgG1k and IgG2a isotype controls (Sigma); donkey anti-rabbit IgG-FITC (Jackson Immunoresearch). Special reagents: Human coagulation factors VIIa, X and Xa were from Enzyme Research Laboratories. Bovine coagulation factors II and IIa were obtained from Dr. C.T. Esmon (OMRF). Chromogenic substrates were: S-2765 specific for FXa (DiaPharma) and Spectrozyme TH specific for thrombin (American Diagnostica). Human r-tnfα was from R&D Systems. Fluo-3 and Fluo-4 were from Invitrogen. The fluorescent lipid analogs NBD-PS (1-oleoyl-2-{6-[(7- nitro-2-1,3-benzooxadiazol-4-yl)amino]hexanoyl}-sn-glycero-3-phosphoserine) and NBD-PC (1-oleoyl-2-{6-[(7-nitro-2-1,3-benzooxadiazol-4-yl)amino]hexanoyl}-sn-glycero-3- phosphocholine) were from Avanti Polar Lipids. Cell culture media and supplements were from Invitrogen and HyClone. Purified bovine PDI was from Sigma and recombinant human PDI (hpdi) containing low endotoxin levels (<0.1ng/µg) was from Cell Sciences. Unless otherwise specified, all other reagents were from Sigma. Construction and characterization of YFP-TF chimera The full length TF cdna cloned in pdnr-lib was obtained from ATCC (MGC-13630) and served as template for the PCR amplification of TF coding sequences. TF signal peptide (SP) was amplified using the GGAAGCTTACCATGGAGACCCCTGCCTGGCCCCGGGTCCC (forward, F) and CTTGCTCACCATGAATTCAGCGCCGGCCACCTGGGC (reverse, R) primer pair. TF mature peptide (MP) was PCR amplified using the ACCGAGCTCGGATCCACTTCAGGCACTACAAATACT (F) and GGTCTAGACTTATGAA ACATTCAGTGGGGAGTTCTC (R) primer pair. The monomeric form of yellow fluorescent protein (myfp), cloned in pcdna3.1(+) (kind gift of Dr. Roger Tsien, UCSD), was PCR amplified using the GTGGCCGGCGCTGAATTCATGGTGAGCAAGGGCGAG (F) and AGTATTTGTAGTGCCTGAAGTGGATCCGAGCTCGGT (R) primer pair. SP and myfp amplicons were gel-purified and used to generate the SP-YFP chimera by splicing by overlapping extension PCR (SoE-PCR) using the appropriate primer pair from above (SP-F and YFP-R). The SP-YFP chimera and MP amplicons were subjected to TA cloning in pcr2.1 vector (Invitrogen) and positive clones were selected by sequencing. HindIII/BamHI digested SP-YFP and BamHI/XbaI digested MP were ligated into HindIII/XbaI digested pcdna3.1(+) vector. The resulting chimera SP-YFP-MP, renamed YFP-TF, in pcdna3.1(+) (Invitrogen) was verified by sequencing and positive clones were amplified in DH5α (Invitrogen). We expressed the YFP-TF chimera in EA.hy926 transfected with Effectene (Qiagen). Fluorescence microscopy at 48 hrs post-transfection revealed % transfection efficiency. The expression, distribution and activity of YFP-TF in EC were assessed by Western blot with anti-tf and/or JL-8 (Clontech) anti-gfp antibodies, confocal immunofluorescence microscopy, and TF activity by the two-stage Xa generation assay. Non-transfected and empty vector transfected EC (mock), stimulated or not with TNFα to induce endogenous TF expression, were used as controls.

2 To generate stable YFP-TF expressing EC lines, we selected the transfected cells in medium supplemented with 0.5 mg/ml Geneticin (Invitrogen) for 14 days. Individual clones were isolated, screened for expression and activity of YFP-TF as above, expanded and then frozen. Functional characterization of endothelial cell models used in this study We used the immortalized line EA.hy926 to analyze PDI contribution to TF procoagulant function on EC. We have previously used these EC to analyze TFPI-dependent regulation of TF procoagulant function. 33 Under basal conditions, neither anti-tfpi antibodies nor calcium ionophore influenced significantly Xa generation (Fig. S1). However, combined treatment with ionomycin and anti-tfpi antibodies increased significantly Xa generation, suggesting that these cells express a very low amount of TF under basal conditions. TF expression is induced by TNFα through NF-kB mediated events, which can be recapitulated in this EC model. After TNF stimulation for 6 hours, the TF-dependent Xa generation assay was sensitive to both anti-tfpi antibodies and ionomycin. The full procoagulant potential of TF, measured in the presence of combined anti-tfpi and ionomycin, was 4.92 fold higher than before TNF stimulation (5.881±0.121 nm vs ±0.107 nm Xa generated in 30 min). Because we observed variability in the TF expression in response to TNF, we also generated cell lines stably expressing YFP-TF. Fluorescence imaging of transiently expressed YFP-TF in EC revealed >80% co-localization of YFP fluorescence with 10H10 mab anti-tf staining in non-permeabilized EC (Fig. S2A), indicating proper folding of the YFP tag and TF extracellular domain, and a surface expression of the chimera similar to endogenous TF. Xa-generation assays revealed that YFP-TF retained the TF procoagulant activity that is decrypted by ionomycin (Fig. S2B). Stable cell lines homogenously expressing low-levels of YFP-TF, re-named TF-EC, were selected (Fig. S2C) and used to study TF regulation in EC.

3 Figure S1. Surface TF procoagulant activity in EAhy926 cells Endothelial monolayers stimulated or not with TNFα for 6 hours to induce TF expression, were treated or not with either rabbit anti-tfpi antibodies (30 µg/ml, 30 min), ionomycin (5 µm, 10 min) or the combination of the two in HBS/Ca buffer before addition of coagulation factors FVIIa and FX. FXa generation after 30 minutes was detected using the S-2765 chromogenic substrate and quantified using a human FXa standard curve. The results are represented as the mean ± SD of triplicates. The experiment was repeated at least 3 times with similar results (*** p < 0.001, one-way ANOVA).

4 Figure S2. Characterization of YFP-TF chimera expressed in endothelial cells (A) The YFP-TF chimera expressed in EAhy.926 cells exhibits YFP fluorescence (left micrograph) and can be immunodetected by mab anti-tf (10H10, center) in non-permeabilized EC. The pixel-over-pixel co-localization of YFP and anti-tf fluorescence (right), measured using Imaris (Bitplane), was 80%, suggesting proper folding of both YFP tag and TF extracellular domain, and surface localization of most of YFP-TF similar to endogenous TF. (B) YFP-TF transiently transfected EA.hy926 exhibited surface TF procoagulant activity as measured by the 2-stage Xa generation assay. The TF procoagulant function directly correlated with the amount of YFP-TF DNA used for transfection and was, in every case, enhanced by ionomycin treatment (I+ vs. I-), suggesting that the YFP-TF chimera retains TF functionality and decryption characteristics. Data are represented as mean ± SD of triplicates (** p <0.01, *** p <0.001, one-way ANOVA). (C) Surface TF procoagulant activity on EAhy.926 cells stably expressing low amounts of the YFP-TF chimera (TF-EC) was compared with endogenous TF expression in response to TNFα stimulation. TF procoagulant activity in TF-EC was significantly higher than in non-decrypted TNFα stimulated EC (p = ), but similar with the decrypted activity of endogenous TF in response to ionomycin treatment (p = ). Furthermore, ionomycin decrypted TF on both TNF-stimulated EC (p = ) as well as TF-EC (p = ). Data are represented as mean ± SD of triplicate assay (** p <0.01, *** p <0.001, unpaired t test).

5 Figure S3. Ionomycin-induced TF decryption is sensitive to annexin V TF-EC cells were pre-incubated with anti-tfpi (30 µg/ml, 30 min) and ionomcyin (5 µm, 10 min) before addition of FVIIa (10 nm) and various concentrations of annexin V. After equilibration for 15 minutes, excess substrate FX (100 nm) was added and the reaction continued at 37 C. Aliquotes were taken during a 30 min incubation interval, quenched with EDTA (25 mm) and FXa measured in a chromogenic assay. The annexin V effect on the TF-dependent Xa generation is normalized to the decrypted TF procoagulant activity in the absence of annexin V. Data are represented as mean ± SD of triplicate assays.

6 Figure S4. Exogenous PDI enhances PS internalization after thapsigargin challenge EC were treated with 1 µm thapsigargin (TG+) or vehicle (Ctrl) for 1 hr in culture media supplemented with 2 mm CaCl 2, detached with EDTA, washed, then treated for 30 min at RT with 800 nm PDI preincubated or not with equimolar concentration of inhibitory mab BD34 (PDI/Ab) in the presence of 10 µm GSH. EC were subsequently labeled with Annexin V FITC for 15 min and immediately analyzed by flow-cytometry. A representative overlay histogram is shown.

7 Figure S5. Surface PDI inhibition does not significantly alter the internalization of NBD- PC Flow-cytometric analysis of NBD-PC internalization in EC pre-treated with the inhibitory BD34 anti-pdi mab (closed squares) or isotype control (open diamonds). The internalized PC is represented as the percentile dithionite resistant NBD-PC fluorescence from total NBD-PC fluorescence observed in the absence of dithionite. Data are represented as mean ± SEM of 10,000 gated events.