Does climate shape virulence and assertiveness of Nosema ceranae? Andreas Linde 2, and Elke Genersch 1 *,

Transcription

1 AEM Accepts, published online ahead of print on 12 March 2010 Appl. Environ. Microbiol. doi: /aem Copyright 2010, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 2 Five-year cohort study of Nosema spp. in Germany: Does climate shape virulence and assertiveness of Nosema ceranae? Sebastian Gisder 1, Kati Hedtke 1, Nadine Möckel 1, Marie-Charlotte Frielitz 1, Andreas Linde 2, and Elke Genersch 1 *, 1 Institute for Bee Research, Friedrich-Engels-Str. 32, D Hohen Neuendorf, Germany 2 FH Eberswalde, Applied Ecology and Zoology, Alfred-Möller-Str. 1, D Eberswalde Germany * Correspondence and reprints: elke.genersch@rz.hu-berlin.de Tel.: ++49 (0) Fax: ++49 (0) Running title: Nosema ssp. infection in honey bees Keywords: microsporidia, Nosema, honey bee, colony mortality, climate Abstract: 210 words Main text: 4466 words Tables: 2 Figures: 4 Suppl. Figs.: 2 1

2 ABSTRACT Nosema ceranae and Nosema apis are two fungal pathogens belonging to the phylum Microsporidia and infecting the European honey bee, Apis mellifera. Recent studies suggested that N. ceranae is more virulent than N. apis at the individual insect level and at the colony level. Severe colony losses could be attributed to N. ceranae infections and an unusual form of nosemosis caused by this pathogen. In the present study, data from a five year cohort study on the prevalence of Nosema spp. in Germany involving about 220 honey bee colonies and a total of 1997 samples collected from these colonies each spring and autumn and analyzed via species-specific PCR-RFLP are described. Statistical analysis of the data did not reveal any relation between colony mortality and detectable levels of infection with N. ceranae or N. apis. In addition, N. apis is still more prevalent than N. ceranae in the analyzed cohort of the German bee population. A possible explanation for these findings could be the observed marked decrease of spore germination already after short exposure to low temperatures (+4 C) only for N. ceranae. Reduced or inhibited N. ceranae spore germination at low temperatures should hamper the infectivity and spread of this pathogen in climatic regions characterized by a rather cold winter season. 2

3 INTRODUCTION Microsporidia are highly evolved fungi with an obligate intracellular parasitic lifestyle (14, 35). They are common parasites of insects and other invertebrates but also known from vertebrates including humans (8, 10, 48). To date, more than 160 genera and almost 1,300 species of microsporidia have been described in the literature (14) revealing a great diversity of morphology and life cycle strategies within this phylum. The common characteristic that qualifies an organism as a microsporidium is that outside the host cell they exist only as metabolically inactive spores and that infection of a host cell involves spore germination, i. e. extrusion of a specialized structure, the polar tube, which pierces the host cell and inoculates infective sporoplasm directly into the cytoplasm of the host cell (9). From honey bees, two species of microsporidia are described, Nosema apis (N. apis) and Nosema ceranae (N. ceranae) (23, 50). The original assumption was that N. apis is a pathogen specific for the European honey bee, Apis mellifera, causing nosemosis and N. ceranae is specific for the Asian honey bee, Apis cerana. However, early cross-infection experiments already demonstrated that N. apis can be infective for A. cerana and N. ceranae can successfully infect A. mellifera (21). That N. ceranae can infect A. mellifera also under natural conditions became evident when in 2005 N. ceranae was isolated from diseased honey bees (A. mellifera) in Taiwan (31) and found in collapsing A. mellifera colonies in Spain (30). Many studies on the incidence of N. ceranae in A. mellifera were initiated by these findings revealing a worldwide distribution of 3

4 N. ceranae in A. mellifera populations (11, 12, 24, 30, 32, 34, 41, 43, 49). Experimental studies suggested that N. ceranae is highly virulent for A. mellifera (27) presumably due to immune suppression which could only be observed after N. ceranae but not after N. apis infection (3). In the field, N. ceranae causes an unusual form of nosemosis which led and still leads to severe colony losses in Spain (28, 37). One explanation for the higher virulence of N. ceranae in the field could be the better adaptation of N. ceranae compared to N. apis to elevated temperatures (18, 36) indicating that N. ceranae might be a pathogen whose spread and assertiveness could be influenced by changing climate. Over the past decade, bee keepers in Europe and North America reported a dramatic increase in colony losses, both during the season and over winter (1, 2, 44, 47). The main culprits for this increase in colony mortality among the pathogens affecting honey bee vitality are viruses (6, 7, 15, 38) and Nosema ceranae (28, 37). While colony losses in the US [termed colony collapse disorder, CCD; (46)] did not correlate with N. apis or N. ceranae infection (12, 15) colony mortality in Spain could clearly be attributed to N. ceranae infection (28, 37) and it was suggested that N. ceranae-induced colony collapse is not restricted to Spain but at least a European-wide phenomenon. In Germany, bee keepers experienced dramatic over-wintering losses in the winter 2002/2003 and report an increase in over-wintering mortality since then. To evaluate whether or not N. ceranae can be correlated with these losses, we conducted a cohort study over five years involving two hundred twenty colonies in the north-eastern part of Germany and determined colony mortality and incidence and prevalence of the two Nosema 4

5 90 91 species. We also analyzed individual bees for Nosema infection and Nosema spores for germination capacity. The implications of our results will be discussed METHODS Bee samples and field survey A cohort of two hundred twenty colonies kept in twenty two apiaries (ten randomly selected colonies per apiary) and managed by hobbyist beekeepers in the north-eastern part of Germany (Fig. S1) were monitored for Nosema spp. infection between spring 2005 and spring The colonies selected for the survey were closely monitored by a professional bee inspector twice a year for the duration of the study without introducing any changes in the beekeeping practice of the beekeeper. In each March, about 100 dead bees were collected from each colony from the bottom board (representing the bees which died over winter) as well as live bees from the winter cluster (representing the bees which survived winter). Qualitative Nosema detection and differentiation did not vary between these two samples for a given colony, therefore, the bees collected from the bottom boards were used in the course of the study. End of September/beginning of October, around 100 live adult bees were collected from each colony representing the bees which were raised for overwintering. Collected bees were frozen at -20 C and stored until analysis. Overwintering success, survival during the summer season, and presence of nosemosis symptoms were recorded individually for each colony. None of the monitored colonies showed clinical 5

6 symptoms of nosemosis throughout the study. Lost colonies were replaced by colonies from the same apiary, preferentially by nuclei made from these colonies in the previous year. As two hundred and twenty colonies were observed throughout the study, the sampling of the monitored colonies and of nuclei replacing lost colonies at nine different time points between 2005 and 2009 resulted in a total of 1997 analyzed samples (Tabs. I, II). Nosema spp. detection Qualitative microscopical diagnosis of Nosema spp. spores was performed according to the method described in the Manual of Standards for Diagnostics and Vaccines published by the Office International des Epizooties (OIE), the World Organization for Animal Health. Briefly, twenty abdomens from each sample were homogenised together in 2 ml ddh 2 O and checked by light microscopy (400X) for the presence of microsporidian spores (42). The rather moderate sampling size will not allow detecting the odd infected bee in the colony but will detect an infection level above ~15% at the 5% significance level (22), which can be considered biologically relevant (28). Microscopically positive homogenates were transferred to a 1.5 ml reaction tube and thoroughly homogenized with a 3 mm tungsten carbide bead (Qiagen) in a mixer mill (Retsch) for 30 sec at 30 hz. Subsequently, the homogenate was centrifuged by 16,000 g for 3 min and the pellet was subjected to DNA extraction using standard methods following the manufacturer s protocols 6

7 (Plant DNA Extraction kit, Qiagen). Extracted DNA was resuspended in 50 µl elution buffer (Qiagen) and frozen at -20 C until differentiation. From each Nosema-positive bee sample individual bees were dissected under a dissecting microscope (10X) under sterile conditions. The tissues (gut, Malpighian tubules, fat body, hypopharyngeal glands, brain) were carefully isolated from individual bees using fresh forceps for each organ to prevent any contaminations. The isolated organs were washed twice in 1x phosphate buffered saline (PBS) and nuclease free water to wash off any potentially contaminating haemolymph. Subsequently, the tissues were subjected to DNA extraction as described above. Extracted DNA was resuspended in 50 µl elution buffer (Qiagen) and frozen at -20 C until differentiation. Nosema spp. differentiation via PCR-RFLP A region of the 16S rrna gene which is conserved for N. apis and N. ceranae (34) was selected for primer design using MacVector 6.5 (Oxford Molecular). Primers nos-16s-fw (5 - CGTAGACGCTATTCCCTAAGATT -3, positions 422 to 444 in U97150; Gatehouse and Malone, 1998) and nos-16s-rv (5 - CTCCCAACTATACAGTACACCTCATA -3, positions 884 to 909 in U97150 Gatehouse and Malone, 1998) were used to amplify ca. 486 bp of partial 16S rrna gene. PCR analysis was performed in a final volume of 25 µl containing 5 µl of template DNA (extracted from pelleted spores or individual organs), 2.5 µl of 10x Qiagen PCR buffer, 2.5 mm MgCl 2, 200 µm of each dntp (Qiagen), U 7

8 Taq polymerase (Qiagen) and 0.5 µm of each forward and reverse primer. PCR parameters for amplification were: initial DNA denaturation of 5 min at 95ºC, followed by 45 cycles of 1 min at 95ºC, 1 min at 53 C and 1 min at 72ºC, and terminated with a final extension step at 72ºC for 4 min. Amplification products (5 µl DNA) were electrophoresed on 1.1% agarose gels (1 x TBE), stained with ethidium bromide, and visualised under UV light. A commercial 100 bp ladder (Peqlab) was used as a size marker. For each PCR, positive (reference N. apis and N. ceranae DNA extracts as template) and negative (ddh 2 O as template) controls were run along with DNA extracts of isolates as template. To differentiate between the species N. apis and N. ceranae, discriminating restriction endonuclease sites present in the PCR amplicon were used (34). The restriction endonuclease Pac I provides one unique digestion site for N. ceranae whilst the enzyme Nde I only digests N. apis. Msp I digests N. apis and N. ceranae and is used as a control for successful restriction digestion of PCR products The predicted restriction fragments produced from digestion of the PCR amplicons are illustrated in Fig. S2. Amplicons were digested with Msp I / Pac I and with Msp I / Nde I (New England Biolabs) in two reactions at 37 ºC for 3h to analyze and confirm the presence of each Nosema species in each sample. Digests were performed in 12.5 µl volume with 7 µl of the amplified DNA and 1.5 Units of each enzyme. The 1x NEBuffer 4 (provided by NEB with Nde I) was used as buffer for the reactions with Msp I and Nde I. The 1x NEBuffer 1 + BSA (provided by NEB with Pac I) was used for the reactions with Msp I and Pac I. 8

9 Fragments were separated in a 3% NuSieve agarose gel (Cambrex Bio Science) in 1 x TBE buffer with a 20 bp ladder as size marker at 110 V for 1 h 30 min. Gels were stained with ethidium bromide and visualised under UV light Smear preparations for detection of developmental stages of Nosema spp. For the microscopical detection of developmental stages of Nosema spp. in smear preparations of bee tissue, adult bees infected with Nosema ceranae or Nosema apis were used. Brain, hypopharyngeal glands, malphigian tubules, fatbody, and midgut were carefully isolated from individual bees as described above. Pieces of respective tissues, 2 mm² in size, were placed on a microscopic slide for crush preparations using coverslips and the back of a pencil. After removing the coverslips, the crushed tissue was air dried, fixed with 100% methanol, again air dried prior to staining with giemsa solution (1:10 Fluka Giemsa Stain, modified solution) for 10 min. Stained tissues were rinsed with tap water, air dried and embedded with Entellan (Merck). Microscopy analysis was performed at 1000-fold magnification using a stereomicroscope (Leica). In vitro-germination of Nosema spp. spores Bee samples which tested positive for either N. apis or N. ceranae were used to isolate the respective spores. Spore accumulation and purification was modified according to Chen et al. (2009). Alimentary tracts of 20 individual bees were removed by snatching the sting with forceps and gently pulling the hindgut and the midgut out of the abdomen. The sting was cut with a scalpel and the 9

10 alimentary tract was transferred into a 1.5 ml reaction-tube and crushed in a final volume of 1.5 ml sterile double distilled water in a mixer mill (Retsch) with a 3 mm tungsten carbide bead (Qiagen) for 30 sec at 30 hz. The homogenate was filtered trough a nylon cell strainer (Falcon) with 100 µm mesh diameter. The filtrate was gently overlayed on a 90% Percoll- (Sigma-Aldrich) cushion in a 15 ml reaction-tube and centrifuged twice at 15,000 g for 45 min at 20 C in a Eppendorf 5810 R Centrifuge using a F rotor. The small but dense band shortly above the bottom of the tube, which contained purified spores, was aspirated with a syringe and a Sterican 0.8 mm x 120 mm needle (Braun) and transferred to a 15 ml reaction tube. Spores were washed 3 times with 8 vol. double distilled water and centrifuged at 6,500 g for 10 min at 20 C. After a final centrifugation step, the supernatant was removed, the pellet was resuspended in 500 µl AE buffer (Qiagen), and the spore concentration was determined using a hemocytometer. The identity of the spores was verified with PCR-RFLP as described above. Aliquots of purified N. apis or N. ceranae spores (20 µl, 2E+8 spores per ml) were spotted onto glass slides, air dried and kept at different temperatures for different periods of time. Subsequently, germination was triggered by adding 30 µl of 0.1 M Sucrose in PBS-buffer to the air dried spores (40), a procedure which mimics the natural conditions for germination of environmental spores. Representative results obtained with freshly isolated, dried and germinated spores (+22 C) or after storage of the dried spores at 4 C for 4 days are shown. These experiments were repeated ten times with different spore preparations (n=10). 10

11 Data evaluation and statistical analysis We compared survived and collapsed colonies employing nonparametric chi 2 tests because the basal assumptions of parametric tests (i.e. normality and constant variance) were not satisfied. The distribution of colony losses differed between the years and between the seasons (Tabs. I, II), therefore, the data sets were analyzed separately. Chi 2 tests were performed by comparing the infection status of the survived colonies with those of the collapsed colonies. A p-value < 0.05 was considered significant. RESULTS Incidence of Nosema apis and Nosema ceranae During the entire period of our study we found the described seasonality (20) of Nosema positive colonies (Fig. 1). The proportion of samples positive for Nosema spp. in the monitored cohort was always higher in spring than in autumn. In spring, the proportion of Nosema-positive samples ranged between 22.4 % (2007) and 35.4 % (2008). In autumn, the highest prevalence of Nosema spp. was detected in 2005 (12.7 %) and the lowest in 2008 (5.2 %). From recent studies suggesting the replacement of N. apis by N. ceranae in Europe (34, 41) we expected to hardly find any N. apis positive samples. Surprisingly, this was not the case. With the exception of spring 2007, N. apis was always more prevalent than N. ceranae. The proportion of N. apis-positive colonies in spring varied between 15.7% (2009) and 3.7% (2007) and in autumn 11

12 between 8.0% (2005) and 2.9% (2008) (Fig. 1). The proportion of colonies which tested positive for N. ceranae in spring differed between 14.9% (2007) and 4.1% (2005) and in autumn between 4.2% (2005) and 1.3% (2006) (Fig. 1). In spring 2007, 14.9% N. ceranae positive colonies and only 3.1% N. apis-positive colonies were detected in our cohort. A low prevalence of mixed infections with the same seasonal pattern (more positive colonies in spring than in autumn) was also detected throughout the entire study period (Fig. 1). Colony losses during the study period For evaluating the impact of Nosema spp. infection on the mortality of honey bee colonies, we differentiated between colony losses in the summer season (week 15-35) and overwintering losses (week 36 week 14 of the following year) and related these to the detection of Nosema spp., N. apis, and N. ceranae in spring and autumn samples (Tabs. I, II). The winter losses we observed in our cohort during the study period varied between 22.4% (2005/2006) and 4.8% (2008/2009) meaning that our study period covered both, winters with low to normal and winters with rather high colony mortality rates (Tab. II). We observed a similar variation although on a much lower level (1.8% for 2007, 6.7% for 2008) for colony losses during the season (Tab. I). Our data did neither reveal a significant relation between Nosema infection detected in spring and colony losses in the following season (p-values see Tab. I) nor a significant relation between detectable Nosema infections in autumn and colony collapses in the following winter (p-values see Tab. II). In addition, no significant differences in the 12

13 mortality rates of uninfected colonies and colonies infected by N. apis, N. ceranae, or both (mixed infection) could be established (p >> 0.05) Tissue tropism of N. apis and N. ceranae While N. apis infections are reported to be restricted to the gut (16, 19, 21), N. ceranae could also be detected in hypopharyngeal glands, salivary glands, Malpighian tubules, and fat body indicating a more generalized infection (13) which could possibly be linked to the reported increased lethality of N. ceranae (27, 41). Since our results did not reveal the described and, therefore, expected correlation between N. ceranae infection and colony losses (28, 37), we hypothesized whether a less virulent form of N. ceranae might be present in Germany not causing such generalized infections. We therefore analyzed the tissue tropism of N. apis and N. ceranae in infected bees collected in our study in detail but did not find any substantial differences to what is described already (13). Using PCR analysis and RFLP-differentiation, N. apis was only detected in the gut of infected bees supporting the tissue tropism reported for N. apis (16, 17, 19). In contrast, using the same method we detected N. ceranae in hypopharyngeal glands, brain, gut, Malpighian tubules, and fat body (Fig. 2). For the majority of the bees infection of the gut could be demonstrated. In addition to detection of N. ceranae in the tissues as reported by Chen and co-workers (13) we could detect N. ceranae also in the brain. All analyzed N. ceranae-positive bees showed a rather generalized infection with at least two different tissues testing positive for N. ceranae. However, using the less sensitive method of Giemsa- 13

14 stained smear preparations we could detect both, N. apis and N. ceranae so far only in gut tissue (Fig. 3) Germination of N. apis and N. ceranae Previous studies have shown that N. ceranae but not N. apis spores are sensitive towards -20 C (18). Since germination is the first step in the infection process, we analyzed the germination capacity of N. apis and N. ceranae spores exposed to low temperatures as compared to room temperature. We found that germination of both Nosema species was affected after four days at 4 C. Estimation of the number of germinated spores and extruded polar tubes revealed that about 80% of the N. apis spores were still capable of germination, while N. ceranae spore germination was reduced to less than 10% (Fig. 4). In addition, the polar tubes extruded from the few N. ceranae spores still capable of germination were unusually short most likely not representing true germination (Fig. 4). DISCUSSION A recent study (34) is frequently cited to substantiate the notion that N. ceranae is predominant in Europe although the published data rather show that the pattern of incidence of N. apis and N. ceranae differs between different regions in Europe. N. ceranae seems to be more prevalent than N. apis in Denmark, Greece, Italy, Serbia, and Spain, while N. apis could be detected more often than N. ceranae in Sweden and in the U.K. In the analyzed German samples (14 random samples from spring 2006), the prevalence of both Nosema species 14

15 was balanced. Although in this study a meaningful overview was given for Europe, the limited data for each country lower the representative character of the study. The cohort study at hand performed with about 220 colonies over five years now revealed that N. apis, as in the UK and Sweden (34), is still more prevalent in Germany than N. ceranae, although N. ceranae might be on the rise. A two- and three-fold increase in the proportion of N. ceranae positive colonies could be seen in spring 2008 and spring 2009, respectively, when compared to the beginning of the study (spring 2005 and spring 2006) suggesting a current process of increasing N. ceranae prevalence. We will continue our study with the same cohort in order to see whether or not we are just observing the replacement of N. apis by N. ceranae in Germany, a process which seems likely according to data from other European countries (34) and from the USA (12) and which will be most interesting to watch. One of the hallmarks of the unusual form of nosemosis caused by N. ceranae is reported to be a loss of seasonality. For N. apis it has been described that in spring more colonies will have detectable infection levels, i.e. more individuals will be infected and infected individuals will reveal a higher spore load. Typically, pathological symptoms of nosemosis (dysentery accompanied by defecation within the hive, crawling bees) will be evident in early spring and colonies will collapse before the season starts (4, 5, 20). N. ceranae infected European honey bees do not show this pathology. Instead, colonies are reported to eventually collapse from the disease not showing any obvious symptoms of nosemosis (24). In addition, for N. ceranae infections of European honey bees in 15

16 Spain a change in seasonality has been reported with an increase of Nosema positive samples throughout the year finally leading to a total absence of seasonality in infection prevalence (37). Our data do not support such a situation for the prevalence of Nosema-positive colonies in Germany. The proportion of colonies with detectable levels of Nosema spp. infection was always higher in spring than in autumn. For colonies infected by N. ceranae seasonality was not really pronounced in the beginning of the study when the proportion of infected colonies was quite low (about 4%) but this changed in 2007 when 14.9% of the spring samples tested positive for N. ceranae. Since then N. ceranae followed the seasonality which is described for N. apis and could be verified in our study except for one season, spring 2007, when as few as 3.1% of the colonies were N. apis positive. Hence, the notion that the prevalence of colonies with detectable levels of N. ceranae infection over the year does not show the normal seasonality could not be substantiated in our study. Studies performed with experimental infection of caged bees have recently suggested that in addition to a different pathology N. ceranae has a higher individual virulence than N. apis (27, 41) although this effect could be overcome by feeding the caged bees ad libitum (39). Reports on the colony level virulence of N. ceranae are contradictory. Several studies from Spain suggest that N. ceranae is highly virulent at the colony level and, hence, infected colonies inevitably die from the infection if left untreated. These studies also imply that N. ceranae is the cause for the unusal colony losses reported from several regions in Europe and in the USA (28, 29, 37). Other studies rather question a link between 16

17 N. ceranae infections and increased colony mortality or identify other causes for unusual colony losses (11, 12, 15, 33, 45, 46). The results of our study also did not reveal a relation between N. ceranae infection of colonies and colony mortality even in seasons with unusually high colony loss rates. Likewise, following the fate of individual N. ceranae infected colonies over several years (data not shown) did not show a mandatory link between this infection and failure of the colony. Instead, infestation by Varroa destructor and infection with deformed wing virus (DWV) and acute bee paralysis virus (ABPV) could be identified as pathogenic agents related with high significance to increased colony mortality in Germany (26). Nevertheless, it is a fact (i) that in Spain and Italy N. ceranae nearly replaced N. apis over the last decade (34) and (ii) that N. ceranae infections cause severe honey bee colony losses at least in Spain (28, 30, 37). Possible reasons for this assertiveness and virulence of N. ceranae are the exceptional biotic potential of N. ceranae at higher temperatures and the spores tolerance to temperatures as high as 60 C combined with resistance to desiccation (18, 36). On the other hand, N. ceranae spores have been reported to be sensitive towards freezing temperatures (18, 20). Since in our study unexpectedly neither predominance nor a noticeable colony level virulence of N. ceranae could be verified we were in search for an explanation. Differences in virulence between genetically different isolates (25) were possible and will be addressed in further studies. However, stimulated by the above mentioned studies about the influence of temperature on N. ceranae spore viability and infectivity we rather suspected climatic factors 17

18 playing a role in the outcome of N. ceranae infections (20). The north-eastern part of Germany is characterized by moderately warm but not hot summers and rather cold and long winters (Dec. to Feb.) with a mean upper temperature threshold of about +4 C. We, therefore, analyzed and compared the germination capacity of N. apis and N. ceranae spores at different temperatures. After as few as 4 days at +4 C we already found a marked decrease in germination of N. ceranae spores but not of N. apis spores. Since germination is the first step in the infection process of ingested environmental spores, a decrease in germination of N. ceranae spores after quite a short time at such moderately cold temperatures will reduce infectivity and virulence of N. ceranae at low temperatures. Cold-sensitivity of N. ceranae spores not seen with N. apis spores could pose a clear disadvantage for N. ceranae when competing with N. apis in climatic regions with comparable or even colder temperatures in the winter season. Environmental spores (e.g. defecated inside the hive and waiting to be ingested by another bee) of N. ceranae will just have a limited chance of staying infective during any cold period in winter while N. apis spores might stay unaffected even at -20 C (20). Withincolony transmission of N. ceranae will, therefore, be hampered at lower temperatures not allowing N. ceranae to build up in the colony over winter like N. apis does. The disadvantage of cold sensitivity of N. ceranae spores might even neutralize any advantageous effect of thermotolerance and resistance to desiccation especially in regions where the summer temperature rarely rises above 33 C. This explanation for the limited assertiveness and virulence of N. ceranae in Germany so far is consistent with earlier results showing a predominance of N. 18

19 apis also e.g. in Sweden (rather cold and long winters) while N. ceranae prevailed e.g. in Italy and Spain (hot summers, moderate winters) (34). Further laboratory and field studies are needed to substantiate the impact of the climate on the colony level virulence of the two Nosema species and on the success of N. ceranae in replacing N. apis in the European honey bee population. In summary, N. ceranae is still not predominant in Germany and did not yet replace N. apis in the European honey bee population in Germany. No link between N. ceranae infection and an increased risk of colony mortality could be established. We presented evidence that the germination capacity of N. ceranae spores is affected already by moderately low temperatures (+4 C) which may hamper infectivity and transmission of N. ceranae during the winter season. Hence, we suggest that virulence and assertiveness of N. ceranae in the European honey bee population is influenced by climate and might change upon climatic changes. Acknowledgements This work was supported by grants from the Ministries for Agriculture from the Federal States of Brandenburg (MIL) and Sachsen-Anhalt (MLU), Germany, and through grants from Bayer Animal Health AG. S.G. and N.M. were supported by a grant from the German Ministry of Nutrition, Agriculture and Consumer Protection (BMELV). 19

20 References 1. Aizen, M. A., L. A. Garibaldi, S. A. Cunningham, and A. M. Klein Long-term global trends in crop yield and production reveal no current pollination shortage but increasing pollinator dependency. Curr. Biol. 18: Aizen, M. A., and L. D. Harder The global stock of domesticated honey bees is growing slower than agricultural demand for pollination. Curr. Biol. 19: Antunez, K., R. Martin-Hernandez, L. Prieto, A. Meana, P. Zunino, and M. Higes Immune suppresion in the honey bee (Apis mellifera) following infection by Nosema ceranae (Microsporidia). Environ. Microbiol. 11: Bailey, L The epidemiology and control of Nosema disease of the honey bee. Ann. Appl. Biol. 43: Bailey, L Nosema apis and dysentery of the honey bee. J. Apicult. Res. 6: Ball, B. V The association of Varroa jacobsoni with virus diseases of honey bees. Exp. Appl. Acarol. 19: Ball, B. V Honey bee viruses: a cause for concern? Bee World 77: Becnel, J. J., and T. G. Andreadis Microsporidia in insects., p In M. Witter and L. M. Weiss (ed.), The Microsporidia and Microsporidiosis. American Society of Microbiology Press. 20

21 Bigliardi, E., and L. Sacchi Cell biology and invasion of the microsporidia. Microbes Infect. 3: Canning, E. U., and J. Lom p. 1-16, The microsporidia of vertebrates. Academic Press, New York. 11. Chauzat, M. P., M. Higes, R. Martin-Hernandez, A. Meana, N. Cougoule, and J. P. Faucon Presence of Nosema ceranae in French honey bee colonies. J. Apicult. Res. 46: Chen, Y., J. D. Evans, I. B. Smith, and J. S. Pettis Nosema ceranae is a long-present and wide-spread microsporidian infection of the European honey bee (Apis mellifera) in the United States. J. Invertebr. Pathol. 97: Chen, Y. P., J. D. Evans, C. Murphy, R. Gutell, M. Zuker, D. Gundensen-Rindal, and J. S. Pettis Morphological, molecular, and phylogenetic characterization of Nosema ceranae, a microsporidian parasite isolated from the European honey bee, Apis mellifera. J. Eukaryot. Microbiol. 56: Corradi, N., and P. J. Keeling Microsporidia: a journey through radical taxonomical revisions. Fungal Biol. Rev. doi: /j.fbr Cox-Foster, D. L., S. Conlan, E. C. Holmes, G. Palacios, J. D. Evans, N. A. Moran, P.-L. Quan, S. Briese, M. Hornig, D. M. Geiser, V. Martinson, D. vanengelsdorp, A. L. Kalkseitn, L. Drysdale, J. Hui, J. Zhai, L. Cui, S. Hutchison, J. F. Simons, M. Egholm, J. S. Pettis, and 21

22 W. I. Lipkin A metagenomic survey of microbes in honey bee colony collapse disorder. Science 318: De Graaf, D., and F. J. Jacobs Tissue specificity of Nosema apis. J. Invertebr. Pathol. 58: de Graaf, D., H. Raes, G. Sabbe, P. H. Rycke, and F. J. Jacobs Early development of Nosema apis (Microspora: Nosematidae) in the midgut epithelium of the honeybee (Apis mellifera). J. Invertebr. Pathol. 63: Fenoy, S., C. Rueda, M. Higes, R. Martín-Hernandez, and C. del Aguila High-level resistance of Nosema ceranae, a parasite of the honeybee, to temperature and desiccation. Appl. Environ. Microbiol. 75: Fries, I Infectivity and multiplication of Nosema apis Z. in the ventriculus of the honey bee. Apidologie 19: Fries, I Nosema ceranae in European honey bees (Apis mellifera). J. Invertebr. Pathol. in press, doi: /j.jip Fries, I Protozoa, p In R. A. Morse and K. Flottum (ed.), Honey Bee Pests, Predators, and Diseases. A.I. Root Company, Medina, Ohio, USA. 22. Fries, I., G. Ekbohm, and E. Villumstad Nosema apis, sampling techniques and honey yield. J. Apicult. Res. 23: Fries, I., F. Feng, A. dasilva, S. B. Slemenda, and N. J. Pieniazek Nosema ceranae n sp (Microspora, Nosematidae), morphological 22

23 and molecular characterization of a microsporidian parasite of the Asian honey bee Apis cerana (Hymenoptera, Apidae). Eur. J. Protistol. 32: Fries, I., R. Martin, A. Meana, P. Garcia-Palencia, and M. Higes Natural infections of Nosema ceranae in European honey bees. J. Apicult. Res. 45: Gatehouse née Edmonds, H. S., and L. A. Malone Genetic variability among Nosema apis isolates. J. Apicult. Res. 38: Genersch, E., W. von der Ohe, H. Kaatz, A. Schroeder, C. Otten, R. Büchler, S. Berg, W. Ritter, W. Mühlen, S. Gisder, M. Meixner, G. Liebig, and P. Rosenkranz The German Bee Monitoring: a long term study to understand periodically high winter losses of honey bee colonies. Apidologie accepted. 27. Higes, M., P. Garcia-Palencia, R. Martin-Hernandez, and A. Meana Experimental infection of Apis mellifera honeybees with Nosema ceranae (Microsporidia). J. Invertebr. Pathol. 94: Higes, M., R. Martín-Hernández, C. Botías, E. Garrido Bailón, A. V. González-Porto, L. Barrios, M. J. del Nozal, J. L. Bernal, J. J. Jiménez, P. García Palencia, and A. Meana How natural infection by Nosema ceranae causes honeybee colony collapse. Environ. Microbiol. 10:

24 Higes, M., R. Martin-Hernandez, C. Botias, and A. Meana The presence of Nosema ceranae (Microsporidia) in African honey bees (Apis mellifera intermissa). J. Apicult. Res. 48: Higes, M., R. Martin, and A. Meana Nosema ceranae, a new microsporidian parasite in honeybees in Europe. J. Invertebr. Pathol. 92: Huang, W. F., J. H. Jiang, Y. W. Chen, and C. H. Wang A Nosema ceranae isolate from the honeybee Apis mellifera. Apidologie 38: Invernizzi, C., C. Abud, I. H. RTomasco, J. Harriet, G. Ramallo, J. Campá, H. Katz, G. Gardiol, and Y. Mendoza Presence of Nosema ceranae in honeybees (Apis mellifera) in Uruguay. J. Invertebr. Pathol. 101: Invernizzi, C., C. Abud, I. H. Tomasco, J. Harriet, G. Ramallo, J. Campá, H. Katz, G. Gardiol, and Y. Mendoza Presence of Nosema ceranae in honeybees (Apis mellifera) in Uruguay. J. Invertebr. Pathol. 101: Klee, J., A. M. Besana, E. Genersch, S. Gisder, A. Nanetti, D. Q. Tam, T. X. Chinh, F. Puerta, J. M. Ruz, P. Kryger, D. Message, F. Hatjina, S. Korpela, I. Fries, and R. J. Paxton Widespread dispersal of the microsporidian Nosema ceranae, an emergent pathogen of the western honey bee, Apis mellifera. J. Invertebr. Pathol. 96:

25 Lee, S. C., N. Corradi, E. J. Byrnes III, S. Torres-Martinez, F. S. Dietrich, P. J. Keeling, and J. Heitman Microsporidia evolved from ancestral sexual fungi. Curr. Biol. 18: Martin-Hernandez, R., A. Meana, P. Garcia-Palencia, P. Marin, C. Botias, E. Garrido-Bailon, L. Barrios, and M. Higes Effect of temperature on the biotic potential of honeybee microsporidia. Appl. Environ. Microbiol. 75: Martin-Hernandez, R., A. Meana, L. Prieto, A. M. Salvador, E. Garrido-Bailon, and M. Higes Outcome of colonization of Apis mellifera by Nosema ceranae. Appl. Environ. Microbiol. 73: Martin, S. J The role of Varroa and viral pathogens in the collapse of honeybee colonies: a modelling approach. J. Appl. Ecol. 38: Mayack, C., and D. Naug Energetic stress in the honeybee Apis mellifera from Nosema ceranae infection. J. Invertebr. Pathol. 100: Olsen, P. E., W. A. Rice, and T. P. Liu In vitro germination of Nosema apis spores under conditions favorable for the generation and maintenance of sporoplasms. J. Invertebr. Pathol. 47: Paxton, R. J., J. Klee, S. Korpela, and I. Fries Nosema ceranae has infected Apis mellifera in Europe since at least 1998 and may be more virulent than Nosema apis. Apidologie 38: Ritter, W Diagnostik und Bekämpfung der Bienenkrankheiten. Fischer, Stuttgart. 25

26 Tapaszti, Z., P. Forgách, C. Kovágó, L. Békési, T. Bakonyi, and M. Rusvai First detection and dominance of Nosema ceranae in Hungarian honeybee colonies. Acta Vet. Hung. 57: VanEngelsdorp, D A survey of honey bee colony losses in the U.S., fall 2007 to spring PLoS One 3:e vanengelsdorp, D., J. D. Evans, L. Donovall, C. Mullin, M. Frazier, J. Frazier, D. R. Tarpy, J. Hayes, and J. S. Pettis "Entombed Pollen": A new condition in honey bee colonies associated with increased risk of colony mortality. J. Invertebr. Pathol. 101: vanengelsdorp, D., J. D. Evans, C. Saegerman, C. Mullin, E. Haubruge, B. K. Nguyen, M. Frazier, J. Frazier, D. Cox-Foster, Y. Chen, R. Underwood, D. R. Tarpy, and J. S. Pettis Colony collapse disorder: a descriptive study. PLoS One 4(8):e vanengelsdorp, D., and M. D. Meixner A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J. Invertebr. Pathol. in press. 48. Weber, R., R. T. Bryan, D. A. Schwartz, and R. L. Owen Human microsporidial infections. Clin. Microbiol. Rev. 7: Williams, G. R., A. B. A. Shafer, R. E. L. Rogers, D. Shutler, and D. T. Stewart First detection of Nosema ceranae, a microsporidian parasite of European honey bees (Apis mellifera), in Canada and central USA. J. Invertebr. Pathol. 97:

27 Zander, E Tierische Parasiten als Krankheitserreger bei der Biene. Münchener Bienenzeitung 31: Downloaded from on November 12, 2018 by guest 27

28 TABLES Table I: Effects of Nosema spp. infection in spring on honey bee colony losses in the following season. Summer season Total No. of colonies analyzed in spring No. of survived colonies between week 15 and week 35 total N. spp. positive* 51 (36/9/6) 65 (41/10/14) 51 (17/34/10) 67 (33/13/21) 68 (33/23/12) N. spp. negative No. of collapsed colonies between week 15 and week 35 total N. spp. positive* 1 (1/0/0) 2 (2/0/0) 0 (0/0/0) 7 (2/5/0) 0 (0/0/0) N. spp negative p-value (chi 2 ) colony losses in % Note: *Numbers of colonies positive for N. apis, N. ceranae, and both are given in brackets (N. apis / N. ceranae / mixed infect.). 28

29 Table II: Effects of Nosema spp. infection in autumn on honey bee colony losses in the following winter. Winter season Total No. of colonies analyzed in autumn No. of survived colonies between week 36 and week 14 total 2005/ / / / N. spp. positive* 21 (16/4/1) 19 (14/3/2) 11 (7/3/1) 11 (6/5/0) N. spp. negative No. of collapsed colonies between week 36 and week 14 total N. spp. positive* 9 (3/6/0) 1 (1/0/0) 4 (3/1/0) 0 (0/0/0) N. spp negative p-value (chi 2 ) colony losses in % Note: *Numbers of colonies positive for N. apis, N. ceranae, and both are given in brackets (N. apis / N. ceranae / mixed infect.). 29

30 604 FIGURE LEGENDS Figure 1: Epidemiological survey for Nosema prevalence in 22 apiaries between spring 2005 and spring 2009 in the north-eastern part of Germany. Prevalence of samples positive for Nosema spp. (filled diamonds), Nosema apis (open squares), Nosema ceranae (open triangles), and for both species in mixed infections (grey filled circles) is given at each time point. Nosema spp. diagnosis was performed microscopically, Nosema differentiation was performed via RFLP of a PCRamplified partial sequence of the 16S rrna gene. Figure 2: Detection of Nosema spp. and differentiation via species-specific 16S rrna-gene RFLP in different tissues of infected bees sampled from colonies which tested positive for Nosema ceranae only. Analyzed tissues were hypopharyngeal glands (h. glands), brain, gut, malpighian tubules (m. tubules), and fat body. Figure 3: Detection of Nosema spp. via smear preparations in infected bees. Different organs of infected bees were analyzed for the presence of spores and vegetative stages of Nosema spp. using Giemsa-stained smear preparations. A representative picture from the gut of an N. apis-infected bee is shown (n, nucleus, red staining; arrows point to infected cell and spores, blue-white staining). 30

31 Figure 4: In vitro-germination of N. apis and N. ceranae spores. Spores were isolated, air dried on a glass slide and kept at different temperatures for different time periods. Representative results obtained after storage of the dried spores at +4 C for 4 days are shown in comparison with freshly isolated, dried and germinated spores. Extruded polar tubes can be seen as curved lines in the pictures. White arrow heads point to extremely short, extruded polar tubes only seen for N. ceranae after 4 days at +4 C. Downloaded from on November 12, 2018 by guest 31

32 proportion of infected colonies (100 % = all analyzed colonies) spring 2005 autumn 2005 spring 2006 autumn 2006 spring 2007 autumn 2007 spring 2008 autumn 2008 spring 2009 Nosema spec. N. apis N. ceranae mixed infect.

33

34

35