supplementary information

Transcription

1 DOI: /ncb1919 Mori et al. Supplementary Figure 1a-b a Characterization of the mdrg cells Anti-NF150 DIC (89%: N=154) 100µm Anti-S100 DIC 100µm b (9.1%: N=144) Characterization of the cortical neurons anti-tuj1 Anti-Tuj1 Figure S1 Characterization of dorsal root ganglia (DRG) neurons. (a) We evaluated isolated DRG neurons by immunostaining using a neuron specific marker (an anti-neurofilament antibody) and a Schwann cell specific marker (an anti-s100 antibody), since Schwann cells are co-purified during preparation of DRG neurons. Most (90%) of total cells are neurofilament positive, indicating that the majority of cells in the preparation are DRG neurons instead of Schwann cells. (b) To prove that the extended neurite process is in fact a neurite process, we performed immunostaining using axon specific markers Tuj1 and MAP2. Most of extended neurite processes are Tuj1 and MAP2 positive, indicating that the extended neurite processes are most likely axons instead of dendrites. (c) To prove neurite identity, we used another neurite specific marker, neurofilament. In comparison with Tuj1 (upper panels), processes from DRG neurons were also neurofilament positive (lower panels) from early stages of extension. 1

2 c 3 hr 6 hr 20 hr Tuj1 DAPI Merge 20 µm d Anti-Neurofilament 3 hr 6 hr 20 hr DAPI Merge 20 µm Figure S1 continued 2

3 a 6hr DRG culture 48hr γ tubulin γ tubulin γ tubulin γ tubulin γ tubulin 20µm Figure S2 Comparison of phospho-t288 and γ-tubulin expression and activation of in cortical neurons. (a) Examples of immunostaining by phospho-t288 and γ-tubulin are shown to outline spatial relationships between these markers. Quantitative analysis indicated that the centrosome relocated and moved to the peripheral area of the neurite hillock after extension of the neurite process (see also Supplementary Fig. 7c). Examination of expression, phospho-t410 /λ (upper), phospho-t288 (middle) phospho-t288 and γ-tubulin (lower) in cortical neurons (b) and and phospho-t288 in PC-12 cells (c). was expressed in cortical neurons and PC-12 cells. Phospho-T288 was less robust in cortical neurons, and undetectable in PC-12 cells. (d) Western blot analysis of DRG neurons, cortical neurons and PC-12 cells. Quantitation by Western blotting was consistent with immunocytochemistry data. (e) Comparison of the speed of neurite extension. DRG neurons extended rapidly, whereas cortical neurons extended less rapidly. PC-12 cells displayed very slow extension speeds, correlated with expression of and phosphorylation status of. Approximation curves were calculated by logarithm functions. (f) Comparison of constants of approximation curves and the signal strength of phospho-t288. The approximation constant and the fluorescence intensity of phospho-t288 revealed a mild correlation. 3

4 b 1day cortical neuron 5day (T288P) Tuj1 (T288P) γ-tubulin Tuj1 P-PKCλ/ζ Tuj1 20µm Figure S2 continued 4

5 c PC 12 cells 5day d DRG cortical neuron PC12 (T288P) (T288P) β-actin e f Extension length (µm) DRG PC12 cortical neuron y = ln(x) y = ln(x) y = ln(x) Ratio of anti-t288p signal (%) DRG PC12 cortical neuron Culture time course (hrs) Constant of approximation curve Figure S2 continued 5

6 a 5.0e5 I y2a2 b3-nh3y4-nh3 y5 y7a8 y y10 b11 y11 y12 b13 y13 y14 y15 4.5e5 4.0e Intensity, cps 3.5e5 3.0e5 2.5e5 2.0e e5 1.0e e m/z, amu P TTLCGTLDYLPPEMIEGR 287 Figure S3 Determination of phosphorylation site of by apkc and generation of a phosphorylated specific monoclonal antibody. (a) Characterization of phosphorylation of by LC/MS/MS. Phosphorylation of T287 was detected after phosphorylation by PKCλ or. T287 phosphorylation of AuroraA was not detected prior to in vitro phosphorylation with PKCλ or. Characterization of an anti- (phospho-t287-specific) monoclonal antibody (b) Anti- mab specifically recognized phospho- proteins that were phosphorylated with in vitro. Incorporation of phosphate was examined by 32 P. The anti-phospho-t287 monoclonal antibody specifically recognized in vitro phosphorylated by. (c) Western blot analysis revealed that the anti- antibody specifically recognized phospho-t287. Anti- antibody was pre-absorbed with phospho-peptide T287T-P of various concentrations and then was used for Western blotting. The phospho-peptide T287T-P efficiently and specifically suppressed the signal detected by anti- antibody. (d) Immunocytochemistry using DRG neurons. Anti- antibody was pre-absorbed with phospho-peptide T287T-P and then was used for immunocytochemistry. The phospho-peptide T287T-P efficiently and specifically abolished the signal detected by an anti- antibody. 6

7 b c GST- GST- + (P-T287) phosphopeptide (µg/ml) (P-T287) 32 P d DRG neuron α- (P-T287) α- (P-T287) + Phosphopeptide (T287P) Figure S3 continued 7

8 a α- (P-T287) α (µg) (µg) CBB Autoradiography Figure S4 Examination of the effect of anti-p- antibodies on phosphorylation by apkc and phosphorylation of T287, and characterization of subcellular localization of TPX2 in DRG neurons, cortical neurons and HeLa cells. (a) We examined phosphorylation of by in the presence of various concentrations of an anti-pt287 antibody or an anti-pt288 antibody as indicated above the panel in 50 µl of total reaction mixture. One fifth of the total reaction mixture was subjected to SDS-PAGE separation, followed by autoradiography (upper) or CBB staining (lower). Note that an anti-pt287 antibody mildly suppressed auto-phosphrylation of, whereas an anti-pt288 antibody did not exhibit any obvious effect. (b) Examination of subcellular distribution of GF (upper panel) or mutated GF (T287E) (lower panel). GF (T287E) displayed more restricted distribution than GFP-. (c) Immunoblotting analysis of sucrose gradient fractions of cell extracts using an anti-gfp antibody. Cos cells transfected by GF (upper panel) or GF (T287E) (lower panel) were lysed, and subjected to sucrose density gradient fractionations. One example of three independent experiments is shown. Note GF (T287E) distributed in higher molecular weight co-sedimentation fractions. Fraction number is showed at the top. Sedimentation coefficient is showed at the bottom. (d) Sucrose gradient analysis of recombinant proteins expressed in insect cells. (upper panel), phosphorylated by (middle panel), and (T287E) (lower panel). Note Phosphorylated and (T287E) displayed higher molecular weight co-sedimentation fractions. Fraction number is showed at the top. Sedimentation coefficient is showed at the bottom. (e) We examined subcellular localization of TPX2 in interphase HeLa cells, DRG neurons and cortical neurons. TPX2 was expressed in cells examined except PC12. TPX2 was exclusively localized within the nucleus but not at the centrosome in interphase HeLa cells, whereas strong signal of TPX2 was observed at neurite hillock in DRG neurons and cortical neurons. (f) Expression was also confirmed by Western blotting. 8

9 Mori et al. Supplementary Figure 4b-d b DRG cells GF GF (T287E) c 30% 10% GF 19.2S 16.5S 11.2S 4.3S 30% 10% S 16.5S 11.2S 4.3S GF (T287E) d 30% 10% GST- 19.2S 16.5S 11.2S 4.3S 30% 10% GST- phosphorylated by 19.2S 16.5S 11.2S 4.3S 30% 10% GST-Aurora-T287E 19.2S 16.5S 11.2S 4.3S Figure S4 continued 9

10 e TPX2 DAPI HeLa DRG cortical neuron f HeLa DRG cortical neuron PC12 (-NGF) PC12 (+NGF) TPX2 100kDa ratio β-actin Figure S4 continued 10

11 a control PKC inhibitor b control sirna P-PKC-λ/ζ P-PKC-λ/ζ (P-T287) NDEL1 P-NDEL1 (P-S251) NDEL1 P-NDEL1 (P-S251) β-actin β-actin c TPX2 control sirna TPX2 sirna d wildtype NDEL1 KO P-PKC-λ/ζ (P-T287) NDEL1 (P-T287) P-NDEL1 (P-S251) NDEL1 β-actin β-actin Figure S5 Examination of the effect of apkc inhibition or depletion on neurite extension of cortical neurons. (a) Western blotting analysis of phosphorylation of, and NDEL1 after inhibition of /λ. Proteins detected by antibodies are shown on the left. Pseudosubstrate suppressed phosphorylation of all proteins, whereas protein amounts were unchanged. (b) Western blotting analysis of phosphorylation of and NDEL1 after depletion of by sirna. Proteins detected by antibodies are shown on the left. sirna against depleted endogenous. Depletion of suppressed phosphorylation of NDEL1, whereas protein amounts of /λ and NDEL1 and phosphorylation of /λ were unaltered. (c) Western blotting analysis of phosphorylation of and NDEL1 after depletion of TPX2 by sirna. Proteins detected by antibodies are shown on the left. sirna against TPX2 depleted endogenous TPX2. Depletion of TPX2 suppressed phosphorylation of T288 and NDEL1, whereas protein amounts of and NDEL1 and phosphorylation of T287 were unchanged. (d) Western blotting analysis of phosphorylation of, after disruption of Ndel1. Proteins detected by antibodies are shown on the left. Cre-mediated recombination disrupted Ndel1 resulting in loss of endogenous NDEL1, Disruption of Ndel1 did not affect phosphorylation of,. We addressed whether apkc and are essential for neurite extension in cortical neurons. For preparation of cortical neurons, fetuses were collected in Hank s balanced salt solution (Invitrogen) and rapidly decapitated. After removal of meninges and white matter, the brain cortex was collected in Hank s balanced salt solution without Ca2+ and Mg2+ (HBSS- 2). The cortex was then mechanically fragmented, transferred to a 0.025% trypsin in HBSS-2 solution, and incubated for 15 min at 37 C. Following trypsinization, cells were washed twice in HBSS-2 containing 10% fetal calf serum and resuspended in Neurobasal medium (Invitrogen), supplemented with 0.5 mm L-glutamine, 25 μm L-glutamic acid, 2% B-27 supplement (Invitrogen), and 12 mg/ml gentamicin. After preparation of cortical neurons, we performed pre-culture in the non-coated dish for 24 hours to provide enough time for pseudosubstrate inhibition and sirna mediated gene depletion. In this condition, cortical neurons displayed a spheroid morphology without extension of neurite processes. After pre-culture, cortical neurons were plated on extracellular matrix coated (laminin or poly-l-lysine) plates, and the length of neuirte processes were measured. Neurites were confirmed by Tuj1 staining. Histograms indicating the distribution of length of neuirte process and number of cortical neurons are shown at the top. X-axis and Y-axis indicate the length of neurite processes and the number of cortical neurons, respectively. The number of cortical neurons examined and the average length of neurites are shown at the upper right in the histogram. One representative image is shown below. (e) In control experiments, cortical neurons extended neurite processes with an average length of 49.5 µm. (f) Inhibition of /λ activity by pseudosubstrate reduced neurite extension to 36.4 µm. (g) Depletion of reduced neurite extension to 38.6 µm. These data suggest that apkc and are essential for neurite extension in cortical neurons. 11

12 e Number of cells (n) no plasmids f PKC inhibitor g sirna n=243 n=173 n=121 Number of cells (n) Number of cells (n) Length of neurite processes (µm) Length of neurite processes (µm) Length of neurite processes (µm) Figure S5 continued 12

13 a PCR efficiency Slope correlation coefficient Par6α 86.69% Par6β 74.85% Par6γ 108% b PCR product (amol/1µg total RNA) Par6α Par6β Par6γ DRG 1.119± ± <0.01 cortical neuron 0.192± ± MEF 0.066± ± Figure S6 Characterization of the role of Par6 on neurite extension. A recent study in Drosophila neuroblasts revealed a functional connection between and apkc in proliferating cells, demonstrating that can phosphorylate the apkc binding partner Par6, thereby regulating apkc activity in mitosis 40. Par6 also might regulate neurite extension in post mitotic neurons. To address the role of Par6 during neurite extension, we first characterized expression profiles of each isoform by quantitative RT-PCR (a, b), since Par6α does not have the phosphorylation site. We used the following primers: TCCTGCTTGGCTATACGGATGCTC (Par6α forward), GGAGCCCTTTCTTGCGCCTTTGTAG (Par6α reverse), CTGGACCAGGTGACTGACATGATG (Par6β forward), AACAGGGTCTGGGAATCGAAGAACC (Par6β reverse), GCACACCCACCACATCTCTAACA (Par6γ forward), GACCGTCATCCCTCAGGGTCACCA (Par6γ reverse). All experimental procedures were performed using SYBERGREEN (ABI) and 7500 Fast Real-Time PCR System (ABI). We used each cdna as a reference to examine absolute amount of cdna. Amplification summary indicated that these primer sets exhibited fairly good PCR efficiency and correlation coefficients (a). We extracted mrna from DRG neurons, cortical neurons and mouse embryonic fibroblast (MEF) cells by TRizol Reagent (Invitrogen). Random primed cdna was synthesized from one µg mrna by Super Script II (Invitrogen) as per the manufacturer s recommendation. 5% of the total of each cdna was subjected to quantitative RT-PCR. We performed three independent experiments and obtained reproducible results. Quantitative RT-PCR revealed that Par6 was highly expressed in post-mitotic neurons, in particular DRG neurons. Profiling of isoforms revealed that Par6α and Par6β were major components of Par6, and Par6γ was not detectably expressed. Par6α was expressed as 52%, 58% and 41% of total Par6 in DRG neurons, cortical neurons and MEF cells, respectively. We next quantitated protein amounts by Western blotting using isoform specific antibodies (anti-par6α (Suzuki et al. J Cell Biol : ); c, anti-par6β (Yamada et al. Curr Biol :734-43); d). We used each recombinant protein as a reference to examine the absolute amount of endogenous proteins. Quantitation of each protein is indicated at the bottom of the panel. (e) We performed in vitro phosphorylation assays using recombinant proteins. One µg of Par6β was incubated with one µg of in the presence or absence of 0.5 µg as indicated above the panel in 50 µl. One tenth of the total reaction mixture was subjected to SDS-PAGE separation, followed by autoradiography (upper) or CBB staining (lower). Note that Par6β was phosphorylated by. Although Par6β detectably reduced phosphorylation of by, its effect was not significant. (f) We performed in vitro phosphorylation of GST-NDEL1 using wild type, mutated (Aurora287E) or a pre-phosphorylated as indicated above. Two µg of GST-NDEL1 was incubated with one µg of with 100 ng of TPX2 in 50 µl of total reaction mixture. One tenth of total reaction mixture was subjected to SDS-PAGE separation, followed by autoradiography (upper) or CBB staining (lower). Note that TPX2 significantly enhanced activity especially when we used pre-phosphorylated. Par6β treatment did not have an obvious effect on NDEL1 phosphorylation by. (g) We examined the effect of the expression of dominant negative Par6β to inhibit Par6 function. Par6β, lacking amino acids 1 125, corresponding to the apkcbinding domain was used as a dominant negative for Par6 (Yamanaka et al. Genes Cells : ). Expression was confirmed by fluorescence images and Western blotting (middle panels and bottom panel). Overexpression of dominant negative Par6β did not affect neurite extension compared to control, suggesting that Par6 is not essential for neurite extension. 13

14 c GST-Par6α input (ng) MEF DRG cortical neuron anti-par6α GST-Par6α Par6α (ng/10µg protein) d GST-Par6β input (ng) MEF DRG cortical neuron anti-par6β GST-Par6β Par6β (ng/10µg protein) Figure S6 continued 14

15 e Par6β + +Par6β ++Par6β CBB Autoradiography Par6β Par6β f Autoradiography CBB GST-TPX Par6β GST-NDEL Aurora-T287E P-Aurora GST-NDEL1 Par6β GST-TPX2 GST-NDEL1 Par6β 100kDa Figure S6 continued 15

16 g Ch-Par6β(WT) 25 Ch-Par6β(DN) n=85 20 n=93 Number of cells (n) Number of cells (n) Length of neurite processes (µm) Length of neurite processes (µm) Cherry Cherry * Ch-Par6β(WT) * * Ch-Par6β(DN) * * Ch-Par6β(WT) Ch-Par6β(DN) Par6β Figure S6 continued 16

17 a b Cherry-PACT Cherry-PACT EB3-GFP EB3-GFP 20µm 20µm c 100 Ratio of co-localization of the centrosome and MTOC (%) n=101 n=103 n=120 6hr 1day 2day DRG culture Figure S7 Examination of microtubule dynamics in DRG neurons. We examined microtubule dynamics using GFP-EB3 as a marker of the microtubule plusend. The centrosome was,located by γ-tubulin staining. EB3-GFP (upper), centrosomal position determined by mcherry-pact (middle) and tracing pattern of EB3-GFP (bottom) are shown. (a) At early stages of neurite extension, the centrosome is localized at the neurite hillock, and microtubules were emanating from this region. (b) At later stages of neurite extension, the centrosome was re-localized from the neurite hillock, when the centrosome lost co-localization with the center of microtubule emanation. At this time, the centrosome lost its capability to be an MTOC, whereas the neurite hillock still maintained its robust function as MTOC without the centrosome. (c) Calculation of co-localization of the centrosome and MTOC during neurite extension. 17