Amplicon size (bp) E ± SD

Transcription

1 Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro C, Serra E Supplemental Data Table 1 Information on primer and probe sequences, amplicon sizes, primer efficiencies and LDRs, intra-assay and inter-assay CV and 99% CI of RCN values for samples with two copies of NF1. Locus Chr. location Primer sequence (5' to 3') UPL probe MAP2K4 17p12 SSH2 17q11.2 TBC1D29 17q11.2 CRLF3 17q11.2 RNF135 17q11.2 NF1-5' 17q11.2 NF1-C 17q11.2 NF1-3' 17q11.2 UTP6 17q11.2 SUZ12 17q11.2 RHOT1 17q11.2 PSMD11 17q11.2 ADARB1 21q22.3 L1PA interspersed MAP2K4-L MAP2K4-R SSH2-L SSH2-R TBC1D29-L TBC1D29-R CRLF3-L CRLF3-R RNF135-L RNF135-R NF1-5'-L NF1-5'-R NF1-C-L NF1-C-R NF1-3'-L NF1-3'-R UTP6-L UTP6-R SUZ12-L SUZ12-R RHOT-L RHOT-R PSMD11-L PSMD11-R ADARB1-L ADARB1-R L1PA-L L1PA-R cccatgaagtctccattctca ccgaagtaatccactgctgac tgctttgttttgcttccttg gaatgtggccagggtgat agccttaaaggagaagagacagc ggggacattttccctttctt agctgctgaagccagagaaa ctagcagacctgggcatctaa ggttgaagagaaaaccctgtca aggaaagaaaggcaagaagagtt cagagtcccctggtgagagt cctgaagaggcagttgagttg actctgtgtctgctttctgctaac aagagacagtgtgatactacacctgaa ggccagggcaaaacttaaa tgtatggttccctagctccaa cgccttgttgcttaaactga acctacaatcccagcccttt caagctccgtgaaatgcag ttcttcagttatttcttcgtttgc gcactggtctgtgtttcttcaa ccacttctgagccaagagga tgttactgttttgcttgaaattcct gtacacttctaaacttctcaggtcaca ccacacaaggacaggagagtc cagccttggaattgaattgg aaaaagtcaggaaacaacaggtg tcccaccaacagtgtaaaagtg Amplicon size (bp) E ± SD LDR (ng DNA) Intra-assay CV (%) Inter-assay CV (%) RCN CI 99% (two NF1 copies) #4 cttcctgc ± #4 cttcctgc ± # 20 ctggctgg ± # 20 ctggctgg ± # 20 ctggctgg ± # 38 ggaagcag ± #4 cttcctgc ± #4 cttcctgc ± #4 cttcctgc ± # 38 ggaagcag ± #4 cttcctgc ± #4 cttcctgc ± #4 cttcctgc ± n/a # 55 ggagagga ± n/a The Universal Probe Library (UPL) Assay Design Center webpage from Roche ( was used to choose a suitable UPL probe that bound to each of the 14 interrogated genomic loci. It was also used to design a specific primer pair that flanked the probe binding sequence. We performed PCR reactions with a series of 2-fold dilutions of pooled DNA samples ( ng per reaction) in order to get calibration curves to determine the linear dynamic range (LDR) and the efficiency (E) of the primers used. The set of dilutions was also used to calculate the intra-assay variation (repeatability). For every locus studied, it is expressed as the average of the coefficient of variation (CV) values calculated for each of the Cq triplicates in each 2-fold dilution point. These CV values ranged from 0.19% to 0.35% considering all loci interrogated. The calibrator samples were used to calculate the inter-assay variation (reproducibility). For every locus studied, it is expressed as the average of the coefficient of variation (CV) values calculated for each of the Cq triplicates of the calibrator sample in each run. These CV values ranged from 0.13% to 0.89% considering all loci interrogated. The assay specific SD of the log-transformed Relative Copy Number (RCN) values from the set of 24 control samples was calculated for each interrogated locus as described in D haene et al (see complete reference in the article) and used to determine the interval in which 99% of the normal results were expected (NORMINV function in Excel). The calculated 99% confidence intervals (CI) for each locus are specified in this table.

2 Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro C, Serra E Supplemental Data Table 2 Characterization of control samples, samples with a constitutional deletion and samples with a somatic deletion in the NF1 region. Mean RCN values are shown for the 11 loci located in NF1 region and the MAP2K4 control locus in 24 control samples bearing two copies of NF1, 14 blood samples found to carry a constitutional deletion and 21 samples from dnfs (N=16) and from selective SC cultures (SC NF1 / ) (N=5) found to carry a somatic deletion of NF1. Bold numbers in black represent the RCN values indicating deletion by the qpcr assay (true positives, TP) and grey rectangles show the extent of the previously characterized deletions. Red and blue numbers represent, respectively, the false positives (FP) and the false negatives (FN) of our assay. NF-30 and NF-31 samples are SC NF1 / from dnf samples NF-16 and NF-24, respectively. For the calculation of both the sensitivity and the specificity of our assay (considering all interrogated loci) when detecting NF1 constitutional deletions, the control sample set and the set of samples with a constitutional deletion were considered. In the case of NF1 somatic deletions, the control sample set and the set of samples with a somatic deletion containing less than 56% of non-deleted NF1 component (samples from NF-30 to NF-27, both included) were considered. Sensitivity = 100 * [ # TP / (# TP + # FN)] Sensitivity (constitutional deletions) = 100* [84 / (84+0)] = 100% Sensitivity (somatic deletions) = 100* [114 / (114+12)] = 90.5% Specificity = 100 * [# TN / (# TN + # FP)] Specificity (constitutional deletions) = 100* [369 / (369+3)] = 99.2% Specificity (somatic deletions) = 100* [349 / (349+4)] = 98.9% Moreover, as SUZ12 locus is essential for distinguishing a Type 1 from a Type 2 constitutional deletion, both the sensitivity and the specificity of our assay were calculated at this locus: Sensitivity (SUZ12 locus in constitutional deletions) = 100* [6 / (6+0)] = 100% Specificity (SUZ12 locus in constitutional deletions) = 100* [31 / (31+1)] = 96.9% NF1 constitutional deletions (N=14) Sample Del. type MAP2K4 SSH2 TBC1D2 9 R S CRLF3 RNF135 R NF1-5' NF1-C NF1-3' UTP6 S SUZ12 R RHOT1 PSMD11 NF-05 type E U E U 0.59 E NF-08 type P Z P Z 0.54 P NF-09 type NF-13 type A B C NF-65 type P NF-01 type NF-02 type NF-03 type NF-04 type NF-06 type NF-07 type NF-10 atypical NF-11 atypical NF-12 atypical

3 Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro C, Serra E Supplemental Data Table 2 (cont.) NF1 somatic deletions (N=21) Sample % normal cells * MAP2K4 SSH2 TBC1D29 R S CRLF3 RNF135 R NF1-5' NF1-C NF1-3' UTP6 S SUZ12 R RHOT1 PSMD11 NF-30 ~ E U E U 0.58 E NF-31 ~ P Z P Z 1.09 P NF-32 ~ NF-33 ~ A B C NF-36 ~ P n/a NF NF NF NF NF NF NF NF NF NF NF NF NF NF NF NF-22 n/a * % normal cells: Mean % of cells with two copies of NF1 Control samples (N=24) Sample Type MAP2K4 SSH2 TBC1D29 R S CRLF3 RNF135 R NF1-5' NF1-C NF1-3' UTP6 S SUZ12 R RHOT1 PSMD11 NF-14 control E U E U 1.06 E NF-35 control P Z P Z 1.09 P NF-38 control NF-39 control A B C NF-41 control P NF-42 control NF-43 control NF-44 control NF-45 control NF-46 control NF-47 control NF-48 control NF-50 control NF-51 control NF-52 control NF-53 control NF-54 control NF-55 control NF-56 control NF-57 control NF-58 control NF-60 control NF-61 control NF-62 control

4 Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro C, Serra E Supplemental Data Table 3 Characterization of somatic NF1 deletions in dnfs by Multiplex Microsatellite PCR Analysis (MMPA). Calculation of the percentage of cells with two copies of NF1 present in each tumor (see Garcia-Linares et al., 2012 for details. Complete reference in the article). For some samples deletion was also analyzed by Paralog Ratio Analysis (PRA) and SNP array. 2q 17p 17q NF1 gene 17q Sample Mean % of cells with two copies of NF1 D2S2314 D17S1879 D17S1303 D17S783 D17S841 D17S1294 D17S 'NF1 D17S1800 D17S798 D17S933 D17S250 D17S807 D17S789 PRA assay SNP array NF NF NF NF X NF X X NF X NF NF NF NF X X NF X X NF NF X NF X NF X X NF-22 n/a n/a not available Non deleted Deleted Non informative

5 Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro C, Serra E Supplemental Data Table 4. MIQE guidelines checklist. ITEM TO CHECK IMPORTANCE CHECKLIST OBSERVATIONS EXPERIMENTAL DESIGN Definition of experimental and control groups E YES Number within each group E YES Assay carried out by core lab or investigator's lab? D YES Investigator's lab Acknowledgement of authors' contributions D YES SAMPLE Description E YES Volume/mass of sample processed D NO Microdissection or macrodissection E YES dnfs samples were macrodissected Processing procedure E YES DNA extracted from fresh or frozen dnfs and fresh blood If frozen - how and how quickly? E N/A If fixed - with what, how quickly? E N/A Sample storage conditions and duration (especially for FFPE samples) E N/A NUCLEIC ACID EXTRACTION Procedure and/or instrumentation E YES Name of kit and details of any modifications E YES Source of additional reagents used D N/A Details of DNase or RNAse treatment E YES Information on kit manufacturer's instructions Contamination assessment (DNA or RNA) E YES PCR and agarose gel electrophoresis Nucleic acid quantification E YES Instrument and method E YES Purity (A260/A280) D YES Yield D YES RNA integrity method/instrument E N/A RIN/RQI or Cq of 3' and 5' transcripts E N/A Electrophoresis traces D N/A Inhibition testing (Cq dilutions, spike or other) E N/A REVERSE TRANSCRIPTION Complete reaction conditions E N/A Amount of RNA and reaction volume E N/A Priming oligonucleotide (if using GSP) and concentration E N/A Reverse transcriptase and concentration E N/A Temperature and time E N/A Manufacturer of reagents and catalogue numbers D N/A Cqs with and without RT D N/A Storage conditions of cdna D N/A qpcr TARGET INFORMATION If multiplex, efficiency and LOD of each assay. E N/A Sequence accession number E N/A Location of amplicon D YES Amplicon length E YES In silico specificity screen (BLAST, etc) E YES Pseudogenes, retropseudogenes or other homologs? D YES Sequence alignment D YES Secondary structure analysis of amplicon D NO Location of each primer by exon or intron (if applicable) E N/A What splice variants are targeted? E N/A qpcr OLIGONUCLEOTIDES Primer sequences E YES RTPrimerDB Identification Number D N/A Probe sequences D YES Location and identity of any modifications E YES Manufacturer of oligonucleotides D YES Purification method D YES N/A: not applicable

6 Development of a probe-based qpcr assay for the detection of constitutional and somatic deletions in the NF1 gene. Application to genetic testing and tumor analysis. Terribas E, Garcia-Linares C, Lázaro C, Serra E Supplemental Data Table 4. MIQE guidelines checklist (cont.) ITEM TO CHECK IMPORTANCE CHECKLIST OBSERVATIONS qpcr PROTOCOL Complete reaction conditions E YES Reaction volume and amount of cdna/dna E YES Primer, (probe), Mg++ and dntp concentrations E YES Polymerase identity and concentration E YES Available upon request (Roche Diagnostics) Buffer/kit identity and manufacturer E YES Exact chemical constitution of the buffer D YES Available upon request (Roche Diagnostics) Additives (SYBR Green I, DMSO, etc.) E N/A Manufacturer of plates/tubes and catalog number D YES Complete thermocycling parameters E YES Reaction setup (manual/robotic) D YES Reaction setup was manual Manufacturer of qpcr instrument E YES qpcr VALIDATION Evidence of optimisation (from gradients) D NO Specificity (gel, sequence, melt, or digest) E YES For SYBR Green I, Cq of the NTC E N/A Standard curves with slope and y-intercept E YES Available upon request (data not shown in the manuscript) PCR efficiency calculated from slope E YES Confidence interval for PCR efficiency or standard error D YES Available upon request (data not shown in the manuscript) r2 of standard curve E YES Available upon request (data not shown in the manuscript) Linear dynamic range E YES Cq variation at lower limit E YES Available upon request (data not shown in the manuscript) Confidence intervals throughout range D NO Evidence for limit of detection E YES If multiplex, efficiency and LOD of each assay. E N/A DATA ANALYSIS qpcr analysis program (source, version) E YES Cq method determination E YES Outlier identification and disposition E YES Results of NTCs E YES Difference of >5 Cq between NTC and the unknown Cq values Justification of number and choice of reference genes E YES Description of normalisation method E YES Number and concordance of biological replicates D YES 24 control (NF1 non-deleted) samples were used Number and stage (RT or qpcr) of technical replicates E YES Repeatability (intra-assay variation) E YES Reproducibility (inter-assay variation, %CV) D YES Power analysis D YES Statistical methods for result significance E YES Software (source, version) E YES Cq or raw data submission using RDML D NO N/A: not applicable