Supplementary Figures and Figure legends

Transcription

1 Supplementary Figures and Figure legends

2 3 Supplementary Figure 1. Conditional targeting construct for the murine Satb1 locus with a modified FLEX switch. Schematic of the wild type Satb1 locus; the conditional targeting construct for the murine Satb1 locus containing the unrecombined FLEX switch, exon 2, a neomycin/kanamycin cassette flanked by two FRT sites, as well as the 5 untranslated region (UTR) of exon 2 fused to an egfp and the 3 UTR of Satb1 on the opposite strand; the intermediate stages after the Cre-mediated inversion at the loxp and lox2272 sites, respectively; and the final product after Cre-mediated excision between the lox2272 or the loxp sites. TTS, TALEN targeting site, mutated on the targeting construct.

3 4 Supplementary Figure 2. Analysis of Cre-mediated recombination of the modified FLEX switch within the conditional targeting construct in prokaryotes. a, Schematic of the FLEX switch contained in the conditional targeting construct for the murine Satb1 locus before and after Cre-recombinase induced recombination in prokaryotes. Oligonucleotides for analysis of successful recombination are shown as red and green arrows. b, In vivo recombination of the FLEX switch in control- (w/o Cre) or Cre-recombinase expressing (+ Cre) E.coli 12 hrs after transformation as determined by PCR on purified plasmid DNA. Successful recombination results in a PCR product of 1.4 kb while the wild type PCR product has a size of 1.8 kb. c, Recombination efficacy in E.coli.

4 5 Supplementary Figure 3. Functionality of the egfp-expressing modified FLEX switch within the conditional targeting construct for the murine Satb1 locus in NIH3T3 fibroblasts. a, Schematic of the FLEX switch contained in the conditional targeting construct for the murine Satb1 locus transferred to an eukaryotic expression vector before and after Cre-recombinase induced recombination. b, In vivo recombination of the FLEX switch in NIH3T3 cells 24 hrs after transfection. egfp expression was determined by flow cytometry in control- (w/o Cre) or Cre-recombinase cotransfected cells (+ Cre)..

5 6

6 7 Supplementary Figure 4. Generation of mice with a mutated TALEN targeting site by intranuclear injection of pronucleus stage embryos with Satb1 TALEN mrna and the conditional Satb1 targeting construct. SURVEYOR endonuclease assays were conducted using PCR-amplified genomic DNA from tail biopsies of the 67 F0 mice. Mice marked with an asterisk (*) denote founder mice with TALEN-induced deletions as determined by the SURVEYOR assay and confirmed by sequencing of the TALEN targeting site. Mice with a number sign (#) denote founder mice positive in the SURVEYOR assay and homologous recombination as repair mechanism for the TALENinduced deletions. Mouse 710 and 716 were positive in the SURVEYOR assay but only showed wild type sequences of the TALEN targeting site in sequencing (n 5), mouse 740 had random integration of the targeting construct and thereby also was positive in the SURVEYOR assay but showed no deletions in sequencing. Size of the PCR product as well as the size of SURVEYORdigested DNA fragments is depicted on the right. WT, wild type control.

7 8 Supplementary Figure 5. Functionality of the egfp-expressing modified FLEX switch. Thymocytes and splenocytes were isolated from the founder mouse and treated for 90 minutes with TAT-Cre. After washing, the cells were cultured for 20 hours and induction of egfp expression assessed by flow cytometry. a-c, egfp expression in untreated and TAT-Cre treated CD4 + T cells (a), CD8 + T cells (b), and B220 + B cells (c) isolated from the spleen. d-g, egfp expression in untreated and TAT-Cre treated CD4 + single positive thymocytes (d), CD8 + single positive thymocytes (e), CD4 + CD8 + double-positive thymocytes (f), and CD4 - CD8 - double-negative thymocytes (g).

8 9 Supplementary Tables Supplementary Table 1. Potential off-target sites of Satb1 TALEN. Sequences* Locus TALEN 1 Spacer TALEN 2 TALEN 1 Score TALEN 2 Score Chr17: TAGACCTCCACCCACTGATA ACGTCTTCTTTTCCA GTTCTGGCAGGTGATCTGTA RVD RVD Chr9: TAaAaCTCacatacCcaAaA GTACAAATTATGCA tatcagtgtgtgtatgtata RVD RVD Chr6: cacacatcacctgccacacc CACCATACCACAGCTTCTCCTCTCTCAGCT TtTtttgtttgtttGgTgTg RVD RVD Chr5: cccacctccacacacaaata AATGGAGGGGTTTTGTTTTTTGT tgttattgtgtgtgtgtttg RVD RVD Chr4: cacacctccacccactgttg ACGGGCATTCGAGCAGTTCCCTCCAACACA TgTgtagctGgttAtcTgTg RVD RVD Chr14: cagccccccccccactttta AATTTTAAGTTAAATTATT tatttgtgtgtgtatgtgtg RVD1 15 RVD Chr5: cagaaaccccaacgccaaac CAAGCCTGTCTCCTCTTCAGTTG TtTCtGTcaGgtGtttTgTg RVD RVD * Putative binding sequences are listed as TALEN 1 and 2. Identical nucleotides are in uppercase. RVD, repeat-variable diresidue. A lower score indicates a higher binding affinity between the RVD and the target sequence 4. Only TALENs with less than 3.0 times the best possible score will likely be functional.

9 10 Supplementary Table 2. Amino acid sequence of the RVDs of the Satb1 targeting TALENs. TAL RVD 1 NI NN NI HD HD NG HD HD NI HD HD HD NI HD NG NN NI NG NI TAL RVD 2 NI HD NI NN NI NG HD NI HD HD NG NN HD HD NI NN NI NI HD RVD, repeat-variable di-residue.

10 11 Supplementary Table 3. Oligonucleotides for T7 endonuclease I assays in NIH3T3 fibroblasts and SURVEYOR nuclease assays for tail biopsies of founder mice. SURVEYOR/T7 forward 5 -TGCTGAGGTTTCCGTCCATAAC-3 SURVEYOR/T7 reverse 5 -TGTGCTCCCAAGCCTTCCTC-3

11 12 Supplementary Table 4. Oligonucleotides for in vitro analysis of TALEN activity. in vitro Satb1-TALEN forward 5 -AGCCCCCAGATCGCATGCCT-3 in vitro Satb1-TALEN reverse 5 -AAACAGGAGCCTTCGCTGGACTGC-3

12 13 Supplementary Table 5. Mouse Satb1 genotyping PCR oligonucleotides. Satb1 genotyping PCR I forward 5 -AGGACATGGACCTGACATGAGAAC-3 Satb1 genotyping PCR I reverse 5 -CTAACAATACGGAGTGCTGTGTCTGT-3 targeted Satb1 genotyping PCR I reverse 5 -GGCTAACTGAAACACGGAAGGAG-3 Satb1 genotyping PCR II forward 5 -TGCTGAGGTTTCCGTCCATAAC-3 Satb1 genotyping PCR II reverse 5 -TGTGCTCCCAAGCCTTCCTC-3 Satb1 genotyping PCR 5 HR forward 5 -AGCCTGCTTTCTGGGTGCCAT-3 Satb1 genotyping PCR 5 HR reverse 5 -TGGGTCGATGGTGATGCTTGGC-3 Satb1 genotyping PCR 3 HR forward 5 -CGAAGTTATGTCCCTCGAAGAGGTTC-3 Satb1 genotyping PCR 3 HR reverse 5 -GGTGTGCGACCATTGTTCAGGAG-3

13 14 Supplementary Table 6. Oligonucleotides for mutagenesis of the TALEN binding sites of the Satb1 targeting construct. TALEN 1 5 -ATGGGGCAGGCATAACTATAGATCTCCATCCACTTATAACGTC TTCTTTTC-3 TALEN 2 5 -CTTTTCCAGTTCTGGCAGGTGCTTTTTAAGACAGTGACTGAGT ATGG-3

14 15 Supplementary Table 7. PCR oligonucleotides for assessment of Crerecombinase activity in prokaryotes. psatb1-flex_5 HR_forward 5 -GGGGCTCTGCTGAGGTTTCCG-3 psatb1-flex_3 HR_forward 5 -CCAAACAGTCCTTGACGCTTCACCC-3 psatb1-flex_3 HR_reverse 5 -GAGGCCAAAGAATTTGCTGAAGGGC-3