The poly(a) tail blocks RDR6 from converting self mrnas into substrates for gene silencing

Transcription

1 In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 3 ARTICLE NUMBER: The poly(a) tail blocks RDR6 from converting self mrnas into substrates for gene silencing Kyungmin Baeg 1,2, Hiro oki Iwakawa 1,2 * and Yukihide Tomari 1,2 * 1 Institute of Molecular and Cellular Biosciences, The University of Tokyo, Bunkyo-ku, Tokyo , Japan. 2 Department of Computational Biology and Medical Sciences, Graduate School of Frontier Sciences, The University of Tokyo, Bunkyo-ku, Tokyo , Japan. * iwakawa@iam.u-tokyo.ac.jp; tomari@iam.u-tokyo.ac.jp NATURE PLANTS DOI: /nplants

2 a Bead Y FLAG SUMO RDR6 b 250 WT CT RDR6 Bead Y FLAG SUMO SUMO protease RDR (kda) CBB!"##$%&%'()*+,-./"*%,0,1,2%34&5.')'(,6(2728,#"*.9.%:,9*4&,!"#$#%&'(),!;,3%$$<= )!"#$%&'&()*&+,"-(./0/"+'"%/(+01&,),*"2*3435"'%+0"!"#$#%&'()"67"(/88-9 5!":++0)--&/"1%&88&),*"18$/";:<<="-*)&,&,>"+'"%/(+01&,),*"?&8@A*BC/"2*3435";DE=" ),@"()*)8B*&("0$*),*"2*3435";:E=9 NATURE PLANTS DOI: /nplants

3 a Marker ss ds A0 A60 A0 A60 + A0 A60 A0 A60 RNase I N100 RNA b Marker ss ds A0 A60 A0 A60 + A0 A60 A0 A60 RNase I N100 RNA 4% native gel [α- 32 P]-UTP 4% native gel [α- 32 P]-CTP!"##$%&%'()*+,-./"*%,0,1,23%,4./')$4,*%&).'.'/,)5(%*,(3%,67)4%,8,(*%)(&%'(,)*%, )"(3%'(.9,:;"<$%=4(*)':%:,67>4? ), The experiment was performed essentially as in Fig. 1b with [α-!" P]-UTP, except that the reaction products were resolved on 4% native acrylamide gel, which can separate double-stranded and single-stranded RNAs. The signals for the N#$$-A$ RNA were double-stranded RNAs synthesized by the RdRP activity. In contrast, the signals for the N#$$-A%$ RNA were single-stranded RNAs derived from the TNTase activity. ss and ds denote single-stranded RNAs and double-stranded RNAs, respectively. <, Same as in Fig. 1c with [α-!" P]-CTP, except that the reactions products were resolved on 4% native acrylamide gel. NATURE PLANTS DOI: /nplants

4 Marker + A0 A60 A0 A60 RNase I N100 RNA N100-A60 N100-A0 [α- 32 P]-UTP!"##$%&%'()*+,-./"*%,0,1,2%34&5.')'(,6(2728,#"*.9.%:,9*4&,#$)'(,$+;)(%, ;#%3.9.3)$$+,34'<%*(;,#4$+=6>?$%;;,2@6;,.'(4,(A%.*,:4"5$%?;(*)':%:,94*&;B!"#$%&'()*+,-*$,--,($&.$#/!0!1$2-345$"677$!"#-$83/9$&+$83/9&2/$/9*$%&'(:#;$/,3'$,-$ the templates in the presence of NTPs and [α- <= P]-UTP. The experiment was performed essentially as in Fig. 1b, except that recombinant AtRDR6 was prepared from an in vitro /+,4-',/3&4$-(-/*)$2-345$!"#$%"&'&(%&)&#*+ (BY-2) cell lysate. The recombinant AtRDR6 purified from the plant lysate specifically converted poly(a)-less RNAs into their double-stranded forms, confirming that AtRDR6 can discriminate poly(a)-less RNAs from polyadenylated RNAs. NATURE PLANTS DOI: /nplants

5 Marker N11 A12 + U12 G12 C12 RNase I N28 RNA 39 nt [α- 32 P]-UTP Supplementary Figure 4 G-quadruplex at the 3 end of RNA blocks dsrna conversion by AtRDR6. RNA polymerase assay of AtRDR6 using N28 reporter RNAs bearing a 12-nt poly(a), poly(u), poly(g) or poly(c) sequence or a 11-nt unrelated sequence at the 3 end. 5 -end labeled N28-N11 RNA was used as the size marker. The experiment was performed essentially as in Fig. 1e. The 12-nt poly(g) sequence, which is expected to form G-quadruplex, as well as 12-nt poly(a) sequence, inhibited dsrna conversion by AtRDR6. NATURE PLANTS DOI: /nplants

6 Supplementary Methods Cell culture Drosophila S2 cells were cultured at 27 C in Schneider s Drosophila medium (Gibco) supplemented with 10% fetal bovine serum (Gibco) and Antibiotic-Antimycotic (Gibco). Plasmid construction pbyl-atrdr6-mm2d The coding region of AtRDR6 (At3G49500) was cloned into the AscI site of pbyl2 vector 1 by In-Fusion HD cloning kit (Takara). pbyl-3 HA-AtRDR6 The full-length AtRDR6 DNA fragment was amplified from pbyl-atrdr6-mm2d using oligo 1 (5 -GATTACGCTGCTCATGGCGGAGGGTCAGAGG-3 ) and oligo 2 (5 -TCAAGCTGGCGCGCCTTAGAGACGCTG-3 ). 3 HA sequence was amplified from pahw vector (Drosophila gateway vector collection) using oligo 3 (5 -CCAAGCTGGCGCGCCATGTACCCATACG-3 ) and oligo 4 (5 -CTCTGACCCTCCGCCATGAGCAGCG-3 ). These two PCR fragments were cloned into pbyl2 vector at the AscI site by In-Fusion HD cloning kit (Takara) pafw-sumo-atrdr6 AtRDR6 fragment was amplified from pbyl-atrdr6-mm2d using oligo 5 (5 -AACAGATTGGAGGTATGGGGTCAGAGGGAAATATGAAG-3 ) and oligo 6 (5 -CTGGGTCGGCGCGCCTTAGAGACGCTGAGC-3 ). The SUMO sequence was NATURE PLANTS DOI: /nplants

7 amplified from pbyl-3 FLAG-SUMO-AtAGO1 2 using oligo 7 (5 -AAGCAGGCTCCGCGGCCATGGGGTCCCTGCAGGACTCAGA-3 ) and oligo 8 (5 -CTTCATATTTCCCTCTGACCCCATACCTCCAATCTGTT-3 ). These two PCR fragments were mixed and then further amplified using oligo 6 and oligo 7. The SUMO-AtRDR6 fragment was cloned into pafw vector (Drosophila gateway vector collection) between the SacII and AscI site by In-Fusion HD cloning kit (Takara). pafw-sumo-ctatrdr6 In order to construct catalytic mutant (CT) AtRDR6 of which the 876 th aspartate was substituted by alanine 3, the 5 or 3 fragment of AtRDR6 was amplified from pafw-sumo-atrdr6 using the primer pairs, oligo 7 and oligo 9 (5 -CCCAAGCCACAAAGTACAGGGCCCCGTCAAGGTCACTGCC-3 ), and oligo 6, and oligo 10 (5 -GGCAGTGACCTTGACGGGGCCCTGTACTTTGTGGCTTGGG-3 ). The two fragments were mixed and then amplified using oligo 6 and oligo 7. The SUMO-catalytic mutant AtRDR6 fragment was cloned into pafw vector (Drosophila gateway vector collection) between the SacII and the AscI site by In-Fusion HD cloning kit (Takara). pasw-sumo-atrdr6(opt) The AtRDR6 gene was codon-optimized (Opt) for Drosophila melanogaster (GenScript) and amplified using oligo 11 (5 -ACCGCGAACAGATTGGAGGTATGGGCAGTGAGGGCAATAT-3 ) and oligo 12 (5 -AAAGATCCTGCTAGCTTACAGGCGCTGGGC-3 ). The SUMO sequence NATURE PLANTS DOI: /nplants

8 was amplified from pafw-sumo-atrdr6 using oligo 13 (5 -GGCCAGCGGGAGCCCATGGGGTCCCTGCAG-3 ) and oligo 14 (5 -ATATTGCCCTCACTGCCCATACCTCCAATCTGTTCGCGGT-3 ). These two PCR fragments were mixed and then further amplified using oligo 12 and oligo 13. The SUMO-AtRDR6(Opt) fragment was cloned into pasw vector 4 linearized by amplification using oligo 15 (5 -GGGCTCCCGCTGGCCC-3 ) and oligo 16 (5 -GCTAGCAGGATCTTTGTGAAGG-3 ) by In-Fusion HD cloning kit (Takara). Preparation of template RNAs The N 100 reporter RNAs were prepared by in vitro transcription using T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) with the PCR fragments described below. The transcripts were gel purified and then capped with ScriptCap m7g Capping System (CELLSCRIPT). The sequences of H 32 and N 28 RNAs (GeneDesign) are listed in the Supplementary Table 1. PCR fragments for N 100 reporter RNAs The PCR fragments for N 100 -A 0, N 100 -A 60, N 100 -N 60, N 100 -U 60, N 100 -N 30 A 30 and N 100 -A 30 N 30 RNAs were amplified from pgl3-basic (Promega) using primer pairs, oligo 17 (5 -GTACTTAATACGACTCACTATAGGTAAAGCCACCATGGAAGAC-3 ) and oligo 18 (5 -GAGCCTTATGCAGTTGCTCTCC-3 ), oligo 17 and oligo 19 (5 -TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTGAGCCTTATGCAGTTGCTCTCC-3 ), oligo 17 and oligo 20 NATURE PLANTS DOI: /nplants

9 (5 -CCACCTCGATATGTGCATCTGT-3 ), oligo 17 and oligo 21 (5 -AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAGAGCCTTATGCAGTTGCTCTCC-3 ), oligo 17 and oligo 22 (5 -TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTGTTCCAGGAACCAGGGCG-3 ), oligo 17 and oligo 23 (5 -CCACCTCGATATGTGCATCTGTAAAAGCAATTTTTTTTTTTTTTTTTTTTTT TTTTTTTTGAGCCTTATGCAGTTGCTCTCC-3 ), respectively. Preparation of BY-2 lysate The BY-2 lysate was prepared as described previously 5. In vitro translation and immunopurification of AtRDR6 Two hundred and fifty microliter BY-2 lysate and 125 µl of substrate mixture (3 mm ATP, 0.4 mm GTP, 100 mm creatine phosphate, 200 µm each of 20 amino acids, 320 µm spermine and 0.4 U/µl creatine phosphokinase (Calbiochem)) were mixed and incubated at 25 C for 3 hours with 50 µl of 1 µm 3 HA-AtRDR6 mrna, which was transcribed from Not I-linearized pbyl-3 HA-AtRDR6 using T7-Scribe Standard RNA IVT Kit (CELLSCRIPT) and capped and polyadenylated using ScriptCap m7g Capping System (CELLSCRIPT) and A-Plus Poly(A) Polymerase Tailing Kit (CELLSCRIPT). The translation product was immunopurified with Dynabeads protein G (Invitrogen) coated with anti-ha antibodies (#ab130275, 16B12, Abcam) at 4 C for 1 hour. The beads were washed twice with 1 lysis buffer containing 800 mm NaCl and 1% Triton NATURE PLANTS DOI: /nplants

10 X-100 and once with 1 lysis buffer and resuspended in 20 µl of 1 lysis buffer containing 1 mm DTT and 20% glycerol. NATURE PLANTS DOI: /nplants

11 References 1. Mine, A. et al. J Virol 84, (2010). 2. Iwakawa, H.O. & Tomari, Y. Mol Cell 52, (2013). 3. Curaba, J. & Chen, X. J Biol Chem 283, (2008). 4. Iwasaki, S. et al. Mol Cell 39, (2010). 5. Komoda, K., Naito, S. & Ishikawa, M. Proc Natl Acad Sci U S A 101, (2004). NATURE PLANTS DOI: /nplants

12 Supplementary Table 1 Name H 32 -N Random 8 H 32 -A 8 H 32 -U 8 H 32 -G 8 H 32 -C 8 N 28 -N 11 N 28 -A 12 N 28 -U 12 N 28 -G 12 N 28 -C 12 Sequence (5 -to-3 ) UCAAAAACUAACAAAUUAAUUUCAAACAAUCUNNNNNNNN UCAAAAACUAACAAAUUAAUUUCAAACAAUCUAAAAAAAA UCAAAAACUAACAAAUUAAUUUCAAACAAUCUUUUUUUUU UCAAAAACUAACAAAUUAAUUUCAAACAAUCUGGGGGGGG UCAAAAACUAACAAAUUAAUUUCAAACAAUCUCCCCCCCC UCAAAAACUAACGGAUUGGUUUCGAACAGUCACCCGCCC UCAAAAACUAACGGAUUGGUUUCGAACAAAAAAAAAAAAA UCAAAAACUAACGGAUUGGUUUCGAACAUUUUUUUUUUUU UCAAAAACUAACGGAUUGGUUUCGAACAGGGGGGGGGGGG UCAAAAACUAACGGAUUGGUUUCGAACACCCCCCCCCCCC NATURE PLANTS DOI: /nplants