SUPPLEMENTARY INFORMATION

Transcription

1 SUPPLEMENTARY INFORMATION doi: /nature12474 Supplementary Figure 1 Analysis of mtdna mutation loads in different types of mtdna mutator mice. a, PCR, cloning, and sequencing analysis of mtdna mutations in type I-VI mice from the crosses described in Fig. 1a-c (n = 7 animals for mouse type I, n = 6 animals for each of mouse type II-VI). Black bars represent the total mtdna mutation load. White bars represent the unique mtdna mutation load with recurring mutations counted only once. b, Load of recurring mtdna mutations obtained by deducting the unique mtdna mutation load from the total mtdna mutation load. The grey bars give an estimate of the relative abundance of clonally expanded mtdna mutations observed in type I-VI mice. c, Analysis of total and unique mtdna mutation load obtained by sequencing of phage clones containing complete mtdna molecules from mouse liver. Error bars = 1 s.d. See also Supplementary Table 1 and

2 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 2 Breeding and characterization of mouse lineages derived from a female with a mutational burst in the germline. a, Schematic depiction of the mating scheme. Wild-type mtdna was introduced into PolgA wt/mut females. Maternal lineages with a wild-type nuclear background derived from the PolgA wt/mut female were analyzed to study segregation of mtdna mutations generated by a single mutational burst in the female germline. b, mtdna sequencing chromatograms from a backcross generation 2 animal (N2) showing the presence of heteroplasmic mutations, which were undetectable in the mother to this animal belonging to the N1 generation. 2

3 SUPPLEMENTARY INFORMATION RESEARCH Supplementary Figure 3 Phenotypes in mice with a wild-type nuclear genome and maternally transmitted mtdna mutations. a, Body weights at age weeks in wt N -1 (black bars; n = 4) and wt N -3 (dark grey bars; n = 4) mice. b, Phenotype score at age weeks in wt N -1 (black bars; n = 4) and wt N -3 (dark grey bars; n = 4) mice. c, Total rearing over 90 minutes at age ~65 weeks in wt N -1 (black bars, n = 4) and wt N -2 mice (red bars) of generation 1 (F1, n = 5), F3 (n = 4) and F>8 (n = 7). d, Rearing activity at age weeks in wt N -1 (black bars; n = 4) and wt N -3 (dark grey bars; n = 4) mice. e, Comparison of rearing behavior in 2 year-old wt N -1 mice (black bar; n = 6) and 2.3 year-old C57Bl/6N wild-type mice (white bars; n = 6). Two-tailed, unpaired t-tests, Error bars = s.e.m. *P<0.05, **P<0.01, Non-significant = n.s. 3

4 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Figure 4 Phenotypes in different types of mtdna mutator mice. a, Determination of relative body weight at age 35 weeks in wild-type mice (C57Bl/6N; white bar, n = 6), type III mice (black bars, n = 5) and type VI mice (grey bars, n = 5). b, Determination of hemoglobin levels in wild-type mice (C57Bl/6N; white bar, n = 8), type III mice (black bars, n = 8) and type VI mice (grey bars, n = 6). c, Determination of erythrocyte counts in wild-type mice (C57Bl/6N; white bar, n = 8), type III mice (black bars, n = 8) and type VI mice (grey bars, n = 6). d, The ratio of spleen weight to body weight in wild-type mice (C57Bl/6N; white bar, n = 10), type III mice (black bars, n = 9) and type VI mice (grey bars, n = 7). e, Histology of colonic crypts from wild-type (wt) mice, type III mice (n = 9) and type VI mice (n = 7) at 35 weeks of age. Scale bar = 50µm. Two-tailed, unpaired t-tests were used. Error bars = s.e.m. *P<0.05, **P<0.01, ***P< Non-significant = n.s. 4

5 SUPPLEMENTARY INFORMATION RESEARCH Supplementary Table 1 Analysis of mtdna mutation load. Mouse type Animal Mutations Unique mutations Sequence depth (bp) Total mutation load (mut / bp) Unique mutation load (mut / bp) PCR-clone-sequence data I x x10-4 I x x10-4 I x x10-4 I x x10-4 I x x10-4 I x x10-5 Total Mean 2.14x x10-4 II x x10-4 II x x10-4 II x x10-4 II x x10-4 II x x10-4 II x x10-4 Total Mean 5.34x x10-4 III x x10-4 III x x10-4 III x x10-4 III x x10-4 III x x10-4 III x x10-4 Total Mean 8.55x x10-4 IV IV x x10-5 IV x x10-5 IV x x10-5 IV x x10-5 IV x x10-5 IV x x10-5 Total Mean 2.16x x10-5 V x x10-4 V x x10-4 V x x10-4 V x x10-4 V x x10-4 V x x10-4 Total Mean 2.03x x

6 RESEARCH SUPPLEMENTARY INFORMATION Mouse Animal Mutations Unique Sequence Total mutation Unique mutation type mutations depth (bp) load (mut / bp) load (mut / bp) VI x x10-4 VI x x10-4 VI x x10-4 VI x x10-4 VI x x10-4 VI x x10-4 Total Mean 6.56x x10-4 WT N -2 (F4) x x10-4 WT N -2 (F4) x x10-5 WT N -2 (F4) x x10-4 Total Mean 5.64x x10-4 Sequencing of lambda clones I x x10-4 I x x10-5 I x x10-5 Total Mean 1.45x x10-4 II x x10-4 II x x10-4 II x x10-4 Total Mean 3.10x x10-4 III x x10-4 III x x10-4 III x x10-4 Total Mean 8.24x x10-4 V x x10-4 V x x10-4 V x x10-4 Total Mean 2.21x x

7 SUPPLEMENTARY INFORMATION RESEARCH Supplementary Table 2 Quantification of clonally expanded point mutations. RFLP- PCR assay to determine mutation loads for three specific clonally expanded point mutations from representative tissues of mtdna mutator mice and sibling genotypes. Symbols indicate the following: * the percentage of clones from the PCR-Cloning-Sequencing assay that carry this mutation, - Not detectable above the RFLP-PCR assay s detection limit, / tissue not available. I (1) I (2) I (3) II (1) II (2) III (1) III (2) 5247A>G 0%* 0%* 1.2%* 0%* 0%* 8.7%* 0%* Brain % - Liver % - Lung / / - Heart % - Kidney % - Muscle % - Spleen % T>C 0%* 0%* 0%* 3.3%* 0%* 0%* 0%* Brain % Liver % Lung % Heart % Kidney % Muscle % Spleen % G>A 0%* 1.2%* 0%* 0%* 0%* 12.0%* 0%* Brain % - Liver % - Lung % - Heart % - Kidney % - Muscle % - Spleen % - 7

8 RESEARCH SUPPLEMENTARY INFORMATION Supplementary Table 3 Sequences of PCR Primers used for whole mtdna sequencing. Symbols indicate the following: * - Not used in lambda clone sequencing, λ - only used in lambda clone sequencing. PCR Forward primer sequence Reverse primer sequence Number 1 tgtaaaacgacggccagtatgaacactctgaactaatcc caggaaacagctatgaccactttgacttgtaagtctagg 2 tgtaaaacgacggccagtagagaaggttattagggtgg caggaaacagctatgaccggataaggtgtttaggtagc 3 tgtaaaacgacggccagtccattccacttctgattacc caggaaacagctatgaccaaaagcatgggcagttacg 4 tgtaaaacgacggccagtctgctcctattatcactacc caggaaacagctatgaccgatatagaggactaaggagc 5 tgtaaaacgacggccagttgtcctagaaatggttccac caggaaacagctatgaccgtacaataggagtgtggtggcc 6 tgtaaaacgacggccagtttgatgaggatcttactccc caggaaacagctatgaccgtaggttgagattttggacg 7 tgtaaaacgacggccagtaatcggttctattccactgc caggaaacagctatgaccagaatttgattgatgtggtgg 8 tgtaaaacgacggccagtaggaaaatcagcacaatttgg caggaaacagctatgaccatgatgttggagttatgttgg 9* tgtaaaacgacggccagtcactcattcattgacctacc caggaaacagctatgacctcatttcaggtttacaagacc 10 tgtaaaacgacggccagtgaaactttatcagacatctgg caggaaacagctatgaccgctgaattagcaagagatgg 11 tgtaaaacgacggccagttgtatcccataaacacaaagg caggaaacagctatgacctgcggtactagttctatagc 12 tgtaaaacgacggccagtagaaagcgttcaagctcaac caggaaacagctatgaccagaacactattagggagagg 13 tgtaaaacgacggccagttcactattcggagctttacg caggaaacagctatgaccgatagtagagttgagtagcg 14 tgtaaaacgacggccagtaatggcggtagaagtcttag caggaaacagctatgaccgctgatgtaaagtaagctcg 15 tgtaaaacgacggccagtgatacatactatgtagtagcc caggaaacagctatgaccttgatgtatctagttgtgg 16 tgtaaaacgacggccagtcacatacatttacacctactacc caggaaacagctatgaccttaatgaagataacagtgtacagg 17 tgtaaaacgacggccagtaaaaaaattaatgatttcgactc caggaaacagctatgacccatgaagcgtctaaggtgtg 18 tgtaaaacgacggccagtcatcatcactcctattctgc caggaaacagctatgaccgtacttgagtgtagtagtgct 19 tgtaaaacgacggccagtacagctatgtacagcatacg caggaaacagctatgacctctgatgtgtagtgtatggc 20* tgtaaaacgacggccagtgctttccacttcatcttacc caggaaacagctatgacccacagttatgttggtcatgg 21 tgtaaaacgacggccagtagagaactactagccatagc caggaaacagctatgacctactcatactaacagtgttgc 22 tgtaaaacgacggccagtttgacctttcagtgaagagg caggaaacagctatgaccttgtttctgctagggttgag 23 tgtaaaacgacggccagtcaagccctcttatttctagg caggaaacagctatgaccttttttcggcggtagaagtag 24 tgtaaaacgacggccagtggaatagtgggtactgcac caggaaacagctatgaccttgctcatgtgtcatctagg 25 tgtaaaacgacggccagttccaacttggtctacaagac caggaaacagctatgaccgtttttagtttgtgtcggaagcc 26 tgtaaaacgacggccagtctactcaccaatatcctcac caggaaacagctatgaccttttaaactaattaccatttactctg 27 tgtaaaacgacggccagtaccatcttagttttcgcagc caggaaacagctatgaccgctagattagctagacttgc 28 tgtaaaacgacggccagttcttcattcttctactatccc caggaaacagctatgaccgacaaatcctgcaaagatgc 29 tgtaaaacgacggccagttactaccatcattcaagtagc caggaaacagctatgaccgtatagtaggggtgaaatgg 30* tgtaaaacgacggccagtcttatcttaacctgaattggg caggaaacagctatgacctctatggaggtttgcatgtg λ-armf tgtaaaacgacggccagtgctttccacttcatcttacc caggaaacagctatgaccattaaccctcactaaagg λ-armr tgtaaaacgacggccagtattaaccctcactaaagg caggaaacagctatgacctctatggaggtttgcatgtg 8