Phenotype Cells can be thawed and passaged keeping continuously undifferentiated proliferation, no replicative crisis was observed.
|
|
- Henry Roger Lambert
- 5 years ago
- Views:
Transcription
1 B-luciferase K562 Cell Line Basic Information Strain Name K562-Gt(AAVS1) tm1(3xstop-cag-luciferase) /Bcgen Stock Number BCG-PS-015-luc Common Name B-luciferase K562 Cell Line Source / Investigator Bcgen (Beijing Biocytogen Co., Ltd) Organism Human Tissue Bone marrow Disease Leukemia (CML) Growth Properties Suspension Resistance Puromycin, 0.5 μg/ml Fluorescence detection Bright-GloTM luciferase Assay System (Promega, Cat E2610) Genotypes AAVS1 LStd (wt/mut) Genotyping Information Genotyping Protocols Primer Sequence Product Tm size (bp) ( C) K562 luc -primer 1 AGGCCTGCATCATCACCGTTTTTCTGG 64 K562 luc WT: 593 -primer 2 CAGGATCCTCTCTGGCTCCATCGTA 62 K562 luc -primer 2 CAGGATCCTCTCTGGCTCCATCGTA 62 K562 luc Mut: 791 -primer 3 GCAACAGATGGAAGGCCTCCTGGCG 64 Polymerase: KOD-plus Cells can be thawed and passaged keeping continuously undifferentiated proliferation, no replicative crisis was observed. Fig.1. Luminescence can be observed in these K562 luc cells. K562-mix with high luciferase expression is for sale. Description & Application Description This K562 luc cell line expresses firefly luciferase as a marker of K562 cells. Luminescence can be observed in K562 luc cells. Application This K562 luc cell line can be used to support research in tracer for K562 cells. Availability Cryopreserved vial 1x10 6 cells/vial
2 Gene Targeting Strategy Gene Targeting Strategy Media & Culturing Complete Growth The base medium for this cell line is ATCC formulated IMDM Modified. To make the complete growth medium, add the following components to the base medium: fetal bovine serum to a final concentration of 10%. Cell line revival Rapidly thaw cells in a 37 C water bath. Transfer contents into a tube containing prewarmed media. Centrifuge cells and seed into a 25 cm 2 flask containing pre-warmed Subculture Cryopreservation media. Cells are cultured as a monolayer at 37 C in a humidified atmosphere with 5% CO 2. Cells should be passaged 2 to 3 times per week. Split at 80-85% confluency, approximately 1: 3 to 1: 8 is recommended. 90% FBS+10% DMSO.
3 B-luciferase 4T1 Cell Line Basic Information Strain Name 4T1-Gt(ROSA) 26Sor tm1(3xstop-cag-luciferase) /Bcgen Stock Number BCG-PS-018-luc Common Name B-luciferase 4T1 Cell Line Source / Bcgen (Beijing Biocytogen Co., Ltd) Investigator Organism Murine Tissue Mammary gland Disease Breast Carcinoma Growth Properties Adherent Resistance Puromycin, 0.5μg/ml Fluorescence detection Bright-GloTM luciferase Assay System (Promega, Cat E2610) Genotypes Rosa26 luc (wt/mut) Genotyping Information Genotyping Protocols Product Tm Primer Sequence size (bp) ( C) 4T1 luc -primer 1 CAAGCACGTTTCCGACTTGAGTTGC 62 4T1 luc WT: 576 -primer 2 AAATACTCCGAGGCGGATCACAAGC 62 4T1 luc -primer 2 AAATACTCCGAGGCGGATCACAAGC 62 4T1 luc Mut: 644 -primer 3 GCAACCTCCCCTTCTACGAGC 60 Polymerase: KOD-plus Cells can be thawed and passaged keeping continuously undifferentiated proliferation, no replicative crisis was observed. Fig.1. Luminescence can be observed in these 4T1 luc cells. 4T1-mix with high luciferase expression is for sale. Description & Application Description This 4T1 luc cell line expresses firefly luciferase as a marker of 4T1 cells. Luminescence can be observed in 4T1 Luc cells. Application This 4T1 luc cell line can be used to support research in tracer for 4T1 cells. Availability Cryopreserved vial 1x10 6 cells/vial
4 Gene Targeting Strategy Gene Targeting Strategy Media & Culturing Complete Growth The base medium for this cell line is ATCC formulated RPMI1640 Modified. To make the complete growth medium, add the following components to the base medium: fetal bovine serum to a final concentration of 10%. Cell line revival Rapidly thaw cells in a 37 C water bath. Transfer contents into a tube containing prewarmed media. Centrifuge cells and seed into a 25 cm 2 flask containing pre-warmed Subculture Cryopreservation media. Cells are cultured as a monolayer at 37 C in a humidified atmosphere with 5% CO 2. Cells should be passaged 2 to 3 times per week. Split at 80-85% confluency, approximately 1: 3 to 1: 8 is recommended. 90% FBS+10% DMSO.
5 B-luciferase B16-F10 Cell Line Basic Information Strain Name B16-F10-Gt(ROSA) 26Sor tm1(3xstop-cag-luciferase) /Bcgen Stock Number BCG-PS-019-luc Common Name B-luciferase B16-F10 Cell Line Source / Bcgen (Beijing Biocytogen Co., Ltd) Investigator Organism Murine Tissue Skin Disease Melanoma Growth Properties Adherent Resistance Puromycin, 0.2 μg/ml Fluorescence detection Bright-GloTM luciferase Assay System (Promega, Cat E2610) Genotypes Rosa26 luc (wt/mut) Genotyping Information Genotyping Protocols Product Tm Primer Sequence size (bp) ( C) B16-F10 luc -primer 1 CAAGCACGTTTCCGACTTGAGTTGC 62 B16-F10 luc WT: 576 -primer 2 AAATACTCCGAGGCGGATCACAAGC 62 B16-F10 luc -primer 2 AAATACTCCGAGGCGGATCACAAGC 62 B16-F10 luc Mut: 644 -primer 3 GCAACCTCCCCTTCTACGAGC 60 Polymerase: KOD-plus Cells can be thawed and passaged keeping continuously undifferentiated proliferation, no replicative crisis was observed. Fig.1. Luminescence can be observed in these B16-F10 luc cells. B16-F10-mix with high luciferase expression is for sale. Description & Application Description This B16-F10 luc cell line expresses firefly luciferase as a marker of B16-F10 cells. Luminescence can be observed in B16-F10 luc cells. Application This B16-F10 luc cell line can be used to support research in tracer for B16-F10 cells. Availability Cryopreserved vial 1x10 6 cells/vial
6 Gene Targeting Strategy Gene Targeting Strategy Media & Culturing Complete Growth The base medium for this cell line is ATCC formulated DMEM Modified. To make the complete growth medium, add the following components to the base medium: fetal bovine serum to a final concentration of 10%. Cell line revival Rapidly thaw cells in a 37 C water bath. Transfer contents into a tube containing prewarmed media. Centrifuge cells and seed into a 25 cm 2 flask containing pre-warmed Subculture Cryopreservation media. Cells are cultured as a monolayer at 37 C in a humidified atmosphere with 5% CO 2. Cells should be passaged 2 to 3 times per week. Split at 80-85% confluency, approximately 1: 3 to 1: 8 is recommended. 90% FBS+10% DMSO
7 B-luciferase-GFP NCI-H1975 Cell Line Basic Information Strain Name NCI-H1975 tg(luciferase-gfp) /Bcgen Stock Number BCG-PS-022-luc Common Name B-luciferase-GFP NCI-H1975 Cell Line Source / Investigator Bcgen (Beijing Biocytogen Co., Ltd) Organism Homo sapiens, human Tissue Lung Disease Adenocarcinoma; nonsmall cell lung cancer Growth Properties Adherent Resistance Blasticidin S HCl (10 μg/ml, Invitrogen, Cat R210-01) Fluorescence detection Bright-GloTM luciferase Assay System (Promega, Cat E2610) Cells can be thawed and passaged keeping continuously undifferentiated proliferation, no replicative crisis was observed. Fig.1. Fluorescence can be observed in these NCI-H1975 luc-gfp cells. Fig.2. Luminescence can be observed in these NCI-H1975 luc-gfp cells. NCI-H1975-mix with high luciferase expression is for sale. Description & Application Description This NCI-H1975 luc-gfp cell line expresses green fluorescent protein (GFP) and firefly luciferase as a marker of NCI-H1975 cells. Fluorescence and luminescence can be observed in NCI-H1975 luc-gfp cells. Application Availability Cryopreserved vial This NCI-H1975 luc-gfp cell line can be used to support research in tracer for NCI-H1975 cells. 1x10 6 cells/vial
8 Transgenic Strategy Strategy Media & Culturing Complete Growth The base medium for this cell line is ATCC formulated RPMI1640. To make the complete growth medium, add the following components to the base medium: fetal bovine serum to a final concentration of 10%. Cell line revival Rapidly thaw cells in a 37 C water bath. Transfer contents into a tube containing prewarmed media. Centrifuge cells and seed into a 25 cm 2 flask containing pre-warmed Subculture Cryopreservation media. Cells are cultured as a monolayer at 37 C in a humidified atmosphere with 5% CO 2. Cells should be passaged 2 to 3 times per week. Split at 80-85% confluency, approximately 1: 3 to 1: 6 is recommended. 90% FBS+10% DMSO
9 B-luciferase MIA PaCa-2 Cell Line Basic Information Strain Name MIA PaCa-2-Gt(AAVS1) tm1(3xstop -CAG-luciferase) /Bcgen Stock Number BCG-PS-033-luc Common Name B-luciferase MIA PaCa-2 Cell Line Source / Investigator Bcgen (Beijing Biocytogen Co., Ltd) Organism Human Tissue Pancreas Disease Pancreatic carcinoma Growth Properties Adherent Resistance Puromycin, 0.2 μg/ml Fluorescence detection Bright-GloTM luciferase Assay System (Promega, Cat E2610) Genotypes AAVS1 LStd (wt/mut) Genotyping Information Genotyping Protocols Cells can be thawed and passaged keeping continuously undifferentiated proliferation, no replicative crisis was observed. Primer Sequence Product size (bp) Tm ( C) MIA PaCa-2 luc -primer 1 AGGCCTGCATCATCACCGTTTTTCTG G WT: MIA PaCa-2 luc -primer 2 CAGGATCCTCTCTGGCTCCATCGTA 62 MIA PaCa-2 luc -primer 2 CAGGATCCTCTCTGGCTCCATCGTA 62 MIA PaCa-2 luc Mut: 791 -primer 3 GCAACAGATGGAAGGCCTCCTGGCG 64 Polymerase: KOD-plus Description & Application Description This MIA PaCa-2 luc cell line expresses firefly luciferase as a marker of MIA PaCa-2 cells. Fluorescence can be observed in MIA PaCa-2 luc cells. Application This MIA PaCa-2 luc cell line can be used to support research in tracer for MIA PaCa-2 cells. Availability Cryopreserved vial 1x10 6 cells/vial
10 Gene Targeting Strategy Gene Targeting Strategy Media & Culturing Complete Growth The base medium for this cell line is ATCC formulated DMEM Modified. To make the complete growth medium, add the following components to the base medium: fetal bovine serum to a final concentration of 10%, horse serum to a final concentration of 2.5%. Cell line revival Rapidly thaw cells in a 37 C water bath. Transfer contents into a tube containing prewarmed media. Centrifuge cells and seed into a 25 cm 2 flask containing pre-warmed Subculture Cryopreservation media. Cells are cultured as a monolayer at 37 C in a humidified atmosphere with 5% CO 2. Cells should be passaged 2 to 3 times per week. Split at 80-85% confluency, approximately 1: 3 to 1: 8 is recommended. 90% FBS+10% DMSO
11 B-luciferase-GFP HT-29 Cell Line Basic Information Strain Name HT-29 tg(luciferase-gfp) /Bcgen Stock Number BCG-PS-056-luc Common Name B-luciferase-GFP HT-29 Cell Line Source / Investigator Bcgen (Beijing Biocytogen Co., Ltd) Organism Homo sapiens, human Tissue Colon Disease Colorectal adenocarcinoma Growth Properties Adherent Resistance Blasticidin S HCl (10 μg/ml, Invitrogen, Cat R210-01) Fluorescence detection Bright-GloTM luciferase Assay System (Promega, Cat E2610) Cells can be thawed and passaged keeping continuously undifferentiated proliferation, no replicative crisis was observed. Fig.1. Fluorescence can be observed in these HT-29 luc-gfp cells. Fig.2. Luminescence can be observed in these HT-29 luc-gfp cells. HT-29-mix with high luciferase expression is for sale. Description & Application Description This HT-29 luc-gfp cell line expresses green fluorescent protein (GFP) and firefly luciferase as a marker of HT-29 cells. Fluorescence and luminescence can be observed in HT-29 luc- GFP cells. Application This HT-29 luc-gfp cell line can be used to support research in tracer for HT-29 cells. Availability Cryopreserved vial 1x10 6 cells/vial
12 Transgenic Strategy Strategy Media & Culturing Complete Growth The base medium for this cell line is ATCC formulated McCoy's 5a Modified. To make the complete growth medium, add the following components to the base medium: fetal bovine serum to a final concentration of 10%. Cell line revival Rapidly thaw cells in a 37 C water bath. Transfer contents into a tube containing prewarmed media. Centrifuge cells and seed into a 25 cm 2 flask containing pre-warmed Subculture Cryopreservation media. Cells are cultured as a monolayer at 37 C in a humidified atmosphere with 5% CO 2. Cells should be passaged 2 to 3 times per week. Split at 80-85% confluency, approximately 1: 3 to 1: 8 is recommended. 90% FBS+10% DMSO
13 B-luciferase-GFP Raji Cell Line Basic Information Strain Name Raji tg(luciferase-gfp) /Bcgen Stock Number BCG-PS-087-luc Common Name B-luciferase-GFP Raji Cell Line Source / Investigator Bcgen (Beijing Biocytogen Co., Ltd) Organism Homo sapiens, human Tissue Lymphoblast Disease Burkitt's lymphoma Cell Type B lymphocyte Growth Properties Suspension Resistance Blasticidin S HCl (10 μg/ml, Invitrogen, Cat R210-01) Fluorescence detection Bright-GloTM luciferase Assay System (Promega, Cat E2610) Cells can be thawed and passaged keeping continuously undifferentiated proliferation, no replicative crisis was observed. Fig.1. Fluorescence can be observed in Raji luc-gfp cells. Fig.2. Luminescence can be observed in Raji luc-gfp cells. Raji-mix with high luciferase expression is for sale. Description & Application Description This Raji luc-gfp cell line expresses green fluorescent protein (GFP) and firefly luciferase as a marker of Raji cells. Fluorescence and luminescence can be observed in Raji luc-gfp cells. Application This Raji luc-gfp cell line can be used to support research in tracer for Raji cells. Availability Cryopreserved vial 1x10 6 cells/vial Transgenic Strategy
14 Strategy Media & Culturing Complete Growth The base medium for this cell line is ATCC formulated RPMI1640. To make the complete growth medium, add the following components to the base medium: fetal bovine serum to a final concentration of 10%. Cell line revival Rapidly thaw cells in a 37 C water bath. Transfer contents into a tube containing prewarmed media. Centrifuge cells and seed into a 25 cm 2 flask containing pre-warmed media. Subculture Cells are cultured as a monolayer at 37 C in a humidified atmosphere with 5% CO 2. Adjust the cell density of the suspension to 35 x 10 5 viable cells/ml in the shipping medium. Corning T75 flasks are recommended for subculturing this product. Renewal: Every 2 to 3 days Cryopreservation 90% FBS+10% DMSO