DNA Matters Constructing Genes, Enzymes and Pathways by the Plate

Transcription

1 DNA Matters Constructing Genes, Enzymes and Pathways by the Plate Leda Notchey May 19, 2015

2 Agenda 1. The Synthetic Biology Opportunity 2. The Gen9 Advantage 3. Working with Gen9: o o Custom Gene Synthesis Variant Libraries Genes Pathways Genomes 2

3 Agenda 1. The Synthetic Biology Opportunity 2. The Gen9 Advantage 3. Working with Gen9: o o Custom Gene Synthesis Variant Libraries Genes Pathways Genomes 3

4 The Synthetic Biology Opportunity The Need The Problem The Solution New Sensors Resistant Plants Low Cost Fuels Cutting-edge Materials Better Drugs Researchers have the DNA sequence information needed and the computing power to design all of these. Using semiconductor technology, Gen9 developed a HT process to build DNA at a very high quality and low cost High value, biologically-based engineered products There is a lack high quality, low cost parts needed to build them. The Rational Design of vast numbers of genes thru Next Gen Gene Synthesis 4

5 Today there is a 10,000X discrepancy between what is sequenced vs. what is synthesized 3 Trillion Annual Synthesis Capacity Annual Sequencing Capacity 300 Million Capacity in Base Pairs Per Year 5

6 Agenda 1. The Synthetic Biology Opportunity 2. The Gen9 Advantage 3. Working with Gen9: o o Custom Gene Synthesis Variant Libraries Genes Pathways Genomes 6

7 The Gen9 Advantage: Synthesizing the Future Founders Fabrication Genetics Bio-engineering Investors Joe Jacobson MIT George Church Harvard Drew Endy Stanford Founded 2009 First commercial product Employees Located in Cambridge, MA, USA 7

8 The Gen9 Advantage: Chip to Gene Process Gen9 Parallel Chip synthesis 10 5 oligos synthesized simultaneously Pooled Assembly Enzymatic Error Correction 1,000s parallel synthesis Next-Gen Sequence Verification Low $/bp cost Oligo Chip Synthesis Design Gene Assembly Quality Control Others Standard synthesis Microliter scale Plate at a time Humans/robots Complex process 10s at once Manual QC Variable yield High Cost 8

9 The Gen9 Advantage: The BioFab Platform Highly Parallel, Scalable, Automated Process Design Services On-Chip Synthesis DNA Assembly Error Correction Clonal Selection Sequence Verification Shipment CAD FAB 9

10 The Gen9 Advantage: Design Services Difficult Sequences Removal of high or low GC%, restriction enzyme sites, homopolymers and repeats Variant Libraries Rational design from amino acid variants and Safety & Security Usage of IGSC harmonized screening Back Translation to any codon frequency table requested NEW - Online design and ordering portal with best-in-class DNA editing tools and optimized for parallel sequence processing GCG GGC CCC CCC CCC Ala Gly Pro Pro Pro GCA GGT CCA CCC CCT Ala Gly Pro Pro Pro 10

11 Review Your Sequence Analysis Results Screenshot seq analysis Optimize! 11

12 The Gen9 Advantage: Oligos on a Chip A.P. Blanchard, R.J. Kaiser, L.E. Hood. Biosensors and Bioelectronics, Volume 11, 1996 The Starting material for the BioFab process is an eluate pool from Agilent OLS chip 12

13 The Gen9 Advantage: DNA Assembly Pooled DNA Assembly of Chip-Synthesized Oligos Scalable gene synthesis by selective amplification of DNA pools from high-fidelity microchips Kosuri S, et al. Nat Biotechnol Dec; 28(12):

14 The Gen9 Advantage: Chip to Gene Assembly Truncated Product Kosuri S., et al. Nature Biotechnology,

15 The Gen9 Advantage: Error Filtering MutS treatment selectively filters out error laden DNA molecules Error Type Error-enriched Untreated Error-depleted Error-depleted 2x Single Deletion Multiple Deletion Single Insertion Multiple Insertion MutS treated Substitution Other Protein-mediated error correction for de novo DNA Synthesis. Carr PA, Park JS, Lee Y-J, Yu T, Zhang S, Jacobson JM. Nucleic Acids Research, 2004, Vol. 32, No. 20 e162 15

16 The Gen9 Advantage: Improving Fidelity for Longer Constructs Carr PA, Park JS, Lee Y-J, Yu T, Zhang S, Jacobson JM. NAR, :600 1:1400 1:10,000 Better error rates results in less bacterial colony picks to ensure a chance of identifying a perfect construct 16

17 The Gen9 Advantage: Sequence Verification NGS redundancy results in more accurate base calling Actual Sequence C C C G C A T GGAAG C GGGCCT GGT GG Sanger Sequencing NGS Sequencing CCCGCATGGAAGCGGGCCTGGTGG 17

18 Agenda 1. The Synthetic Biology Opportunity 2. The Gen9 Advantage 3. Working with Gen9: o o Custom Gene Synthesis Variant Libraries Genes Pathways Genomes 18

19 Working with Gen9 Gen9 s extensive portfolio of GeneBit, GeneByte, and GeneByte Plus products o o o From 400bp to as large as 10 kb Custom vector cloning available Turnaround time in as little as 20 business days Utilizes Gen9 s manufacturing and customer support infrastructure Industry-leading, volume-based construct pricing on a per-base basis linear vector GeneBit (0.4kb-1.0kb) or Clonal, Sequence Perfect GeneByte (1.0kb-4.0kb) or Clonal, Sequence Perfect GeneByte Plus (4.0kb-10.0kb) Clonal, Sequence Perfect Affordable, Sequence-Verified, Clonal Constructs 19

20 Working with Gen9: Variant Libraries Product Variant Library Rationally Designed Combinatorial Variant DNA library of 10 8 overall diversity Single-Chain Variable Fragment 260 AA Overall Diversity is 3x2x3x2x2x3x3x2x2x2x2x2x2x2x2x9x3x4x2x First Steps Back translate and parse into manageable oligonucleotide pools 20

21 Working with Gen9: Variant Libraries We parsed the DNA sequence into 7 oligo pools, equaling 5,496 different oligo sequences Final Steps Error filtering, pooled assembly and quality check for fidelity and representation 21

22 Gen9 DNA = Dedication, Innovation, Collaboration & Integrity GeneBit perfect Gene clonal vector plus order Integrity synthesized products sequence dsdna libraries Gen9 USA service GeneByte Collaboration Sequence-perfect process Custom Next-generation constructs Dedication Variant DNA BioFab base pairs Innovation design genes synthesis 22