SUPPLEMENTAL MATERIALS

Transcription

1 SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURES Supplemental Figure S1. Analyses of the CRY1-SPA1 interaction (A) An auxotrophy growth assay (left) and a filter-based -galactosidase colorimetric assay (right) of yeast two-hybrid experiments showing the blue light-dependent CRY1- SPA1 interaction. For the leucine auxotrophy assay, the yeast cells were plated on the SD/Gal/Raf/ His/ Trp/ Ura/-Leu medium and cultured in dark or in blue light (20 molem -2 s -1 ) for three days. For the colony-lift filter -galactosidase assay, yeast cells were plated on the SD/Gal/Raf/ His/ Trp/ Ura /+BU growth medium in the dark or blue light (20 molem -2 s -1 ) for three days until analysis of the -galactosidase activity (blue color). (B) An analysis to determine the domains of CRY1 and SPA1 required for the CRY1-SPA1 interaction. Left: constructs used for analysis, with the bottom three constructs of SPA1 representing CT509. Right: -galactosidase activities (Miller units) of the corresponding constructs. Supplemental Figure S2. Analyses of interactions between CRY1 and SPA2, SPA3, or SPA4. (A) -galactosidase assays showing the lack of blue light-dependent interaction between CRY1-SPA2 and CRY1-SPA3. Yeast cells were left in the dark (Dark) or irradiated with blue light (Blue, 40 molem -2 s -1 ). Pairs of baits and preys are indicated at the bottom, SPA3.1 (Accession NO ) and SPA3.2 (Accession NO ) are two alternative-spliced forms of SPA3. (B) -galactosidase assays showing blue light-dependent CRY1-SPA4 interaction. Yeast cells were exposed to blue light with the fluence rate of 5 (B5), 25 (B25) or 50 (B50) molem -2 s -1 for the durations indicated. (C) A -galactosidase analysis determining the domains of CRY1 and SPA4 required for the

2 CRY1-SPA4 interaction. Left: constructs used for analysis. Right: -galactosidase activities (Miller units) of the corresponding constructs. Supplemental Figure S3. Effect of light on the MycSPA1 protein expression (A) Immunoblots showing the lack of light effects on the abundance of the MycSPA1 and CRY1 proteins in adult plants under the conditions tested. The wild-type (WT) and transgenic plants expressing the 35S::MycSPA1 transgene were grown in white light under long-day photoperiod (16hL/8hD) for two weeks, transferred to red light for ~18hr, exposed to blue (20 mol m -2 s -1 ) for 15 minuets (B15) or 30 minuets (B30). Some plants were transferred to darkness for 30 minuets (D30) or 60 minuets (D60). (B) Immunoblot showing the lack of effect of light on the expression of MycSPA1 protein in young seedlings under the conditions tested. 4-day-old transgenic seedlings expressing the 35S::MycSPA1 transgene were grown in continuous white light, transferred to darkness for two days, then exposed to blue light (50 molem -2 s -1 ), red light (20 molem -2 s -1 ), or far-red light (15 molem -2 s -1 ) from 1 to 3hr. Samples were fractionated by a SDS-PAGE, blotted to a nitrocellulose membrane, probed with the anti-myc antibody for the enhanced chemiluminescence immunoblot. Supplemental Figure S4. CRY1 and SPA1 form blue-dependent protein complex in Arabidopsis that affect HY5 degradation. (A) Co-immunoprecipitation (co-ip) analyses showing blue light-dependent interaction of CRY1 and SPA1 in Arabidopsis. The wild-type (WT) and transgenic plants expressing the 35S::MycSPA1 transgene were grown in white light under long-day photoperiod (16hL/8hD) for two weeks; transferred to red light for ~18hr, exposed to blue (20 mol m -2 s -1 ) for 15 minuets (B15) or 30 minuets (B30). Aliquots of plant samples were transferred to darkness for 30 minuets (D30) or 60 minuets (D60). Total protein extractions (Input) and IP products prepared by the anti-cry1 antibody (CRY1- IP) or preimmune serum (Preim) were fractionated in a SDS-PAGE gel, blotted to membranes, probed with the anti-myc antibody (MycSPA1), stripped, and reprobed with the anti-cry1 antibody (CRY1).

3 (B) Immunoblot showing blue light-dependent stabilization of the HY5 protein in the wild-type plants and spa1spa4cry1 mutant plants but not in the cry1 mutant plants. 14- day-old transgenic plants expressing 35::MycHY5 in the Col, cry1 and spa1spa4cry1 plants were transferred to dark for 18 hours, irradiated with blue light (30 mmolm -2 s -1 ) for 6hr. Immunoblots were probed with anti-myc antibody (MycHY5), stripped, and reprobed with the anti-cry1 antibody (CRY1). A portion of the membrane stained with Ponceau is included to show the relative loading of samples (Ponceau). Supplemental Figure S5. Genotyping of the spa1spa4cry1 triple mutant (A) An agrose gel showing the allele-specific genomic PCR of the respective genotype tested. (B) An immunoblot showing the presence or absence of CRY1 protein in the wild-type (WT) or the spa1spa4cry1 mutant plants. Supplemental Figure S6. Yeast three-hybrid analysis showing CRY1 mediates blue light-dependent suppression of the SPA1-COP1 interaction. (A) Immunoblot showing the CRY1 protein expression in yeast cells cultured in the SD/- Trp/-Leu/-Met/+Asp and absence of CRY1 in yeast cells grown in SD/-Trp/-Leu/- Asp/+Met liquid medium. (B) Yeast cells were transformed with respective plasmid, cultured in SD/-Trp/-Leu/-Met/+Asp (green column) or SD/-Trp/-Leu/-Asp/+Met liquid medium (yellow column) in the dark or blue light (40 molem -2 s -1 ). The protein-protein interaction was presented as arbitrarily unit (AU), which is calculated by converting the -galactosidase activity (miller units) to arbitrarily unit (AU) according to the formula: [miller units (light)]/[miller unit (dark)], with the AU of dark-treated samples set to 1. Supplemental Figure S7. Spectra of experimental light used in the study The emission spectra of experimental lights (White, Blue, Red) are shown as the relative spectral irradiance in the wavelength range of nm. The light emitting diode (LED) matrixes (Shanghai Qiding photoelectric Co., LTD, Shanghai, China) were used as the Blue and Red light sources. High output cool white fluorescence light (F48T12/CW/HO, GE or Sylvania) are used for white light.

4 SUPPLEMENTAL MATERIALS AND METHODS Plant materials spa1-3 (RLD accession), cop1-4 (Col accession), spa1spa3spa4 (RLD and Col accession), and cry1-304 are previously reported 1-3. Transgenic lines expressing the 35S::MycSPA1 (Line #2-5, 2-8) and 35S::MycCT509 (Line #16-1, 16-3) in spa1-3 background are previously reported 4. Line#2-8 and line #16-3 were used for co-ip experiment. The spa1spa4cry1 triple mutant was prepared by a genetic cross of the cry1-304 and spa1spa3spa4. The genotype of spa1-3 was firstly confirmed by genomic PCR, using primer pairs SPA1F (5 -CAGACAGTTGCGAGCTTC) and SPA1R (5 - CCTTTGTACCACTCCTAGAC) for the wild-type locus, and the primer pairs SPA1mutF (5 -CAGACAGTTGCGAGCTTT) and SPA1R for the spa1-3 mutant locus. The C-to-T mutation of spa1-3 was further confirmed by sequencing the genomic DNA of spa1 mutant locus. spa3-1 was confirmed by genomic PCR, using the primer pairs SPA3F (5 -CTGGATAAACCTGAACGATCTG) and SPA3R (5 - CAGTATCCTGCAATCTATACGCA) for the wild-type SPA3 and the primer pairs SPA3F and LB3 (5 -TAGCATCTGAATTTCATAACCA) for the T-DNA insertional spa3-1 mutant locus. The genotype of spa4-1 was confirmed by genomic PCR, using the primer pairs SPA4F (5 -GTAACTTTGAAGGCGTGGTTCAAG) and SPA4R (5 - CATCTCCAAAATCTTGATATTGCCGG) for the wild-type SPA4 locus, and the primer pairs SPA4F and LB3 for the T-DNA insertional spa4-1 mutant locus. Monochromatic LED blue light, LED red light, and cool white fluorescent light are used in this experiments, and the spectra of those light are shown in Supplemental Fig. S7. Yeast two-hybrid assay The LexA-based yeast two-hybrid system was used to analyze the CRY1-SPA1 interaction according to the manufacturer s recommendations (CLONTECH Protocol #PT3040-1, Version # PR67300). Briefly, the EGY48 yeast strain was transformed with p8op-lacz reporter vector to create EGY48 [p8op-lacz]. Two plasmids, one contains

5 the prey sequence fused to the B42 activation domain in the pb42ad vector and the other contains the bait sequence fused to the LexA DNA binding domain in the PEG202 vector, were co-transformed into EGY48 [p8op-lacz]. Colonies were selected on palates (SD /-His/-Trp/-Ura). The fresh colonies were inoculated in liquid medium (SD/Gal/Raf/ His/ Trp/ Ura /+ BU salts) and cultured in the dark until it reached OD 600 of 0.3. Yeast cells were grown in dark or under light for 6hr or the periods described in the figures. The -galactosidase activity assay was performed using chlorophenol red- - D-galactopyranoside (CPRG) as substrate and the Miller Unit calculated according the manufacturer s recommendations (CLONTECH yeast hand book, Protocol # PT3024-1, Version # PR742227) or as described 5. Immunostaining Immunostaining analyses are as described previously 6. Briefly, the 4-day-old seedling grown in continues white light (20 molem -2 s -1 ) was adapted in dark for 2 days and then exposed to blue light (15 molem -2 s -1 ) for 15min before fixation in 4% formaldehyde. Nuclei were isolated from dark-treated or blue light-treated seedlings and probed with the respective primary antibodies. Samples were then incubated with the secondary antibodies, the Rhodamine Red-x-conjugated goat anti-rabbit IgG (1/200 dilution) (Jackson Immuno Research Lab) or the Diaminotriazinylaminofluorescein (DATF)-conjugated goat-against-mouse IgG (1/200)(Abcam, #ab7064). The detection and analyses of fluorescence images are as described 6. Immunoprecipitation The immunoprecipitation experiments using anti-cry1 antibody are as previously described 5. The immunoprecipitation experiments using the anti-myc antibody followed the following protocol. 4-day-old seedling grown in continues white light were transferred to the dark for two days, remained in the dark or transferred to blue light (50 molem -2 s -1 ) for 1hr. 0.5g tissues were ground in liquid nitrogen and mixed with 1ml 2xBinding Buffer (200mM Tris PH7.5, 300mM NaCl, 0.1% Tween-20, 1mM beta-mercaptoethanol, 1mM PMSF, 1 tablet/50ml protease inhibitor cocktail, 50 M MG132). Mixtures were filtered through Miracloth and forced through a #27 needle in a

6 3ml syringe for 5 times. Samples were centrifuged at 14000rpm for 5min twice, the supernatants were pre-cleaned for 20min with 50ul protein G beads (PIERCE, Cat# 20398), supernatants (with a briefly spin) were mixed with 50ul Monoclonal mouse antibody 9E10 beads (COVANCE, Cat# AFC-150P) and incubated for 1hr. Beads were washed with 10x volumes of the 1xBinding Buffer, spun briefly to remove supernatant, mixed with 50ul SDS loading buffer, boiled for 5min, spun at 12000rpm for 5min at room temperature. 10ul supernatant were fractioned by 10% SDS-PAGE, and the immunoblotted as previously described 5. REFERENCES 1. Hoecker, U., Xu, Y. & Quail, P.H. SPA1: a new genetic locus involved in phytochrome A-specific signal transduction. Plant Cell 10, (1998). 2. Laubinger, S., Fittinghoff, K. & Hoecker, U. The SPA quartet: a family of WD-repeat proteins with a central role in suppression of photomorphogenesis in arabidopsis. Plant Cell 16, (2004). 3. Mockler, T.C., Guo, H., Yang, H., Duong, H. & Lin, C. Antagonistic actions of Arabidopsis cryptochromes and phytochrome B in the regulation of floral induction. Development 126, (1999). 4. Yang, J. & Wang, H. The central coiled-coil domain and carboxyl-terminal WD-repeat domain of Arabidopsis SPA1 are responsible for mediating repression of light signaling. Plant J 47, (2006). 5. Liu, H. et al. Photoexcited CRY2 interacts with CIB1 to regulate transcription and floral initiation in Arabidopsis. Science 322, (2008). 6. Yu, X. et al. Arabidopsis cryptochrome 2 completes its posttranslational life cycle in the nucleus. Plant Cell 19, (2007).