Discovery of a trans-dichloroethene Respiring Dehalogenimonas in the 1,1,2,2-

Transcription

1 Supplemental materials Discovery of a trans-dichloroethene Respiring Dehalogenimonas in the 1,1,2,2- Tetrachloroethane-Dechlorinating WBC-2 Consortium Authors Marie J. Manchester 1, Laura A. Hug 2, Matt Zarek 1,3, Anna Zila 1, Elizabeth A. Edwards 1,2 1 Department of Chemical Engineering and Applied Chemistry, University of Toronto, Toronto, ON, Canada 2 Department of Cell and Systems Biology, University of Toronto, Toronto, ON, Canada 3 Current address: Department of Chemistry, The Hebrew University of Jerusalem, Jerusalem, Israel

2 Table S1: The standard curve equations generated from the qpcr runs from the 1:5 and 1:20 growth trials and the relative abundance screens with SYBR Green qpcr reagent. E = efficiency of the reaction (%); E = (10^(-1/slope)-1)*100 Standard Curve Equations E Mean y intercept standard deviation Mean Efficiency standard deviation Dehalobacter y = x ; r 2 = y = x ; r 2 = y = x ; r 2 = y = x ; r 2 = y = -3.56x ; r 2 = y = x ; r 2 = y = x ; r 2 = Dehalococcoides y = -3.55x ; r 2 = y = x ; r 2 = y = x ; r 2 = y = x ; r 2 = y = x ; r 2 = y = X ; r 2 = y = x ; r 2 = y = x ; r 2 = y = x ; r 2 = y = x ; r 2 = Dehalogenimonas y = x ; r 2 = y = x ; r 2 = y = x ; r 2 = y = x ; r 2 = y = x ; r 2 = y = x ; r 2 = y = x ; r 2 = Geobacter y = x ; r2 =

3 Table S2: The standard curve equations generated from the qpcr runs from the relative abundance screens with Sofast EvaGreen qpcr reagent. E = efficiency of the reaction. Organism Standard Curve Equations E (%) Dehalobacter y = x ; r 2 = Dehalococcoides y = x ; r 2 = Dehalogenimonas y = x ; r 2 =

4 Table S3: Primer comparison of Dehalogenimonas genus-specific primers from this study and from Yan et al. (1). Primers were aligned to 16S rrna from three Dehalococcoides (clone Dhc-4 (GQ470678), 2 WBC-2 Dhc clones (JQ599696, JQ599680)) and three Dehalogenimonas sp. (one WBC-2 Dhg clone (JQ599651), and D. lykanthroporepellens strains BL-DC-9 (NC_014314) and BL-DC-8 (EU679418)) and the number of mismatches to each sequence evaluated. Primer Name Sequence Clone Dhc-4 Primer set designed in this study Number of Mismatches WBC-2 Dhg WBC-2 Dhc Dhg BL-DC-9 & BL-DC-8 Insert size Reference Dehly_UTF CGGGCGACCGGGAGCTA This study Dehly_UTR CCTCACCAGGGTTTGACATGTTAGAAG This study Applicable primers pairs for qpcr from Yan et al. (1) BL-DC-631f GGTCATCTGATACTGTTGGACTTGAGTATG BL-DC-796r ACCCAGTGTTTAGGGCGTGGACTACCAGG BL-DC-727f GAAGGCGGTTTTCTAGGCCAWA BL-DC-982r TCTAACATGTCAAGCCCTGGTG 7or Full length Dehalogenimonas genus-level primer pairs from Yan et al. (1) BL-DC-142f GTGGGGGATAACACTTCGAAAGAAGTGC BL-DC-796r ACCCAGTGTTTAGGGCGTGGACTACCAGG BL-DC-727f GAAGGCGGTTTTCTAGGCCAWA BL-DC-1351r AACGCGCTATGCTGACACGCGT 6or Dehalogenimonas lykanthroporepellens-specific primers, unsuitable for the WBC-2 culture BL-DC-57f GCAAGTCGAACGGTCTCTCGC BL-DC-117f GTAATAGGTAAGTAACCTGCCCTT BL-DC-183f GGTGCTCTTTCACAAGGAAGAGTACTG 13or BL-DC-1020r ATAGCTCCTGACTTGACAGGTGGATC 6or BL-DC-1243r CCGGTGGCAACCCATTGTACCGC BL-DC-1410r AGGTGTTACCAACTTTCATGAC BL-DC-610f** TCTCCCGGCTCAACTGGGAGGGGTCATCTG 8 8 or ** = Suitable genus level primer with no suitable reverse primer

5 A) B) 16S rrna gene copies/ml culture Concentration (µmol/bottle) E+07 1.E+06 1.E+05 1.E+04 Ethene tdce TeCA Dhc Dhb Dhg 1.E Time (Days) Figure S1: Dechlorination of 1,1,2,2-TeCA and corresponding 16S rrna gene copies of putative dechlorinating organisms in the 1:20 dilution experiments. A) Concentration profile. Data points are average concentrations (µmoles/bottle) from triplicate bottles, error bars represent one standard deviation. Black squares: TeCA; black crosses:1,1,2-tca; black circles: tdce; and white squares: ethene. Electron acceptor and donors were amended at time zero and again as indicated by wide arrows. Narrow arrows indicate when cultures were reamended with additional lactate. B) 16S rrna gene copies per ml of culture during TeCA dechlorination. Dehalobacter (Dhb, circles), Dehalococcoides (Dhc, squares) and Dehalogenimonas (Dhg, triangles). Closed symbols indicate cultures amended with electron donor and TeCA, open symbols with dashed lines indicate controls amended with electron donor only.

6 A) B) 25 tdce 20 Ethene VC 0 Concentration (µmol/bottle) Concentration (µmol/bottle) cdce Ethene VC S rrna gene copies/ml culture C) Dehalogenimonas D) Dehalococcoides 5.E+06 5.E+05 Amended with cdce Amended with tdce 16S rrna gene copies/ml culture 5.E+06 5.E+05 e-donor only Amended with cdce Amended with tdce 5.E+04 e-donor only Time (Days) 5.E Time (Days)

7 Figure S2: Dechlorination of tdce and cdce and corresponding 16S rrna gene copies of putative dechlorinating organisms. A) Concentration profile in the 1:5 dilution experiment amended with tdce. B) Concentration profile in 1:5 dilution experiment amended with cdce. Data points are average concentrations (µmoles/bottle) from triplicate bottles. Error bars represent one standard deviation. Black circles: tdce; black triangles:vc; black diamonds: cdce and white squares: ethene. All cultures were amended with electron acceptor and donors at time zero and arrows indicate when cultures were reamended with additional lactate. C) Dehalogenimonas 16S rrna gene copies per ml and D) Dehalococcoides 16S rrna gene copies per ml in separate cultures amended with tdce, cdce or only electron donor. Dehalococcoides (Dhc, squares) and Dehalogenimonas (Dhg, triangles). Closed symbols indicate cultures amended with both electron donor and acceptor, open symbols with dashed lines indicate controls amended with electron donor only.

8 A) 25 B) 16SrRNAgenecopies/mlculture Concentration(µmol/bottle 20 TCE Ethene cdce VC tdce E+06 Dhc 5.E+05 Dhg Dhb 5.E Time(Days) Figure S3: Dechlorination of TCE and corresponding 16S rrna gene copies of putative dechlorinating organisms. This experiment was set up as described in the materials and methods for the 1:20 dilution growth experiments, except that the culture was diluted 1:10 in a final volume of 50 ml. A) Concentration profile in cultures fed TCE. Data points are average concentrations (µmoles/bottle) from triplicate bottles, error bars represent one standard deviation. Black dashes: TCE, black circles: tdce, black diamonds: cdce, black triangles: VC, and white squares: ethene. B) 16S rrna gene copies per ml of culture during TCE dechlorination. Dehalobacter (Dhb, circles), Dehalococcoides (Dhc, squares) and Dehalogenimonas (Dhg, triangles). Closed symbols indicate cultures amended with electron donor and TCE, open symbols with dashed lines indicate controls amended with electron donor only.

9 References 1. Yan, J., Rash, B.A., Rainey, F.A., Moe, W.M Detection and quantification of Dehalogenimonas and Dehalococcoides populations via PCR_based protocols targeting 16S rrna genes. Appl. Environ. Microbiol. 75(23):