F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated

Transcription

1 SDC MATERIALS AND METHODS Flow Cytometric Detection of A-Antigen Expression Single cell suspensions were prepared from bone marrow, lymph node and spleen. Peripheral blood was obtained and erythrocytes lysed with ammonium chloride lysis buffer (Stemcell Technologies, Vancouver, British Columbia). Cells were labeled with fluorescently conjugated monoclonal antibodies (ebioscience, San Diego, CA) with specificities to the following markers: F4/80, CD11b, Gr-1, NK1.1, CD3, CD4, CD8 and CD19. A-antigen was detected with FITCconjugated mouse IgG3 anti-a monoclonal antibody (clone NaM87-1F6, BD Biosciences). Mouse FITC-conjugated IgG3 monoclonal antibody (clone A112-3, BD Biosciences) was used as an isotype control. An initial gate was made based on forward and side-light scatter with exclusion of cell debris. Subsequently, leukocytes were gated on F4/80 expression with positive and negative populations gated on CD11b and Gr-1. Cells negative for F4/80 were gated on CD3 and NK1.1 expression, with determination of A-antigen expression in the CD4 + CD3 +, CD8 + CD3 + and CD19 + (CD3 NK1.1 ) populations. For flow cytometric detection of A-antigen on erythrocytes, heparinized whole blood was labeled with FITC-conjugated anti-a monoclonal antibody and analysis of the erythrocyte gate as determined by forward and side light scatter. Serum Anti-A Antibody: ELISA 96-well, PS, half-area, Microlon 600 plates (Greiner Bio-One, Monroe, NC) were coated overnight with 5 µg/ml A-PAA (Glycotech, Gaithersburg, MD) or 10 µg/ml anti-mouse IgG (Bethyl Laboratories, Montgomery, TX) in 0.1 M Na 2 CO 3 (ph 9.6). Following blocking with 5% Page 1 of 11

2 (vol/vol) normal goat serum (Vector Laboratories) diluted mouse serum (from terminal bleeds) or serially diluted mouse reference serum IgG (Bethyl Laboratories) were added to wells in triplicate. Bound antibody was detected with HRP-conjugated goat anti-mouse IgG antibody (Bethyl Laboratories) and 3,3,5,5 -tetramethylbenzidine substrate (TMB; Sigma-Aldrich) and the concentration of IgG anti-a antibody determined from the mouse reference serum IgG standard curve. Immunophenotypic Assessment of AMR For detection of C4d complement deposition in FFPE sections, antigen retrieval was first performed by treating sections for 2.5 hours in 10 mm Tris, 1 mm EDTA buffer (ph 8.5) using protocol R-1.5 (Retriever, Electron Microscopy Sciences, Hatfield, PA). Subsequently, sections were incubated with rabbit anti-c4d polyclonal antibody (Hycult Biotech, Plymouth Meeting, PA) followed by peroxidase-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch, West Gove, PA) and ImmPACT DAB peroxidase substrate (Vector Laboratories). For detection of macrophages, frozen sections were labeled with rat IgG2a anti-mouse CD68 monoclonal antibody (clone FA-11; AbD Serotec, Raleigh, NC) followed by ImmPRESS horseradish peroxidase-conjugated goat anti-rat IgG (Vector Laboratories) and ImmPACT VIP peroxidase substrate (Vector Laboratories) which yielded purple colored CD68 staining. Localization of these cells in relation to tissue vasculature was facilitated by subsequent staining using rat IgG2a anti-mouse CD31 (PECAM-1, clone MEC 13.3, BD Biosciences), a second application of the same secondary antibody (see above) followed by ImmPACT DAB Peroxidase substrate (Vector Laboratories) which outlined tissue vasculature in brown. Page 2 of 11

3 Page 3 of 11

4 SDC RESULTS Table S1. A-antigen scoring: Comparison of native A-Tg heart, A-Tg heart grafts, and human A-heart Heart tissue A-sensitized recipient A-antigen IHC score b Recipient anti-a titre a n Mean Range A-Tg heart - native no NA 8 3 ± 0 3 A-Tg heart - graft no ± 0 3 A-Tg heart - graft yes 256 ( ) ± WT heart - graft yes 128 (64-512) human A heart - biopsy NA NA 4 3 ± 0 3 human B heart - biopsy NA NA a Serum anti-a antibody titre at time of graft harvest; range indicated in brackets b A-antigen IHC score: 0=negative, 1=weak, 2=moderate, 3=strong; mean ± standard deviation NA, applicable; ND, not determined Page 4 of 11

5 Table S2. Serum anti-a agglutination titre and IgG anti-a antibody following i.p. vs s.c. injection of human A erythrocyte +/- adjuvant into WT mice Route Adjuvant a of mice Number Hemagglutination titre b Anti-A antibody IgG (ng/ml) c i.p. yes ( ) ± (6/8) i.p. no ( ) ± 43.0 (12/16) s.c. yes (64-256) 22.2 ± 0.7 (4/4) s.c. no 4 8 ( 2-16) 22.0 ± 1.4 (4/4) a Complete/Incomplete Freund's adjuvant b Median serum anti-a antibody titre 1-3 week post final injection; range indicated in brackets c Mean ± standard error of the mean of serum IgG anti-a antibody titre 1-3 weeks post final injection; number of mice with detectable IgG anti-a antibody in brackets i.p., intraperitoneal; s.c., subcutaneous Page 5 of 11

6 Table S3. Serum anti-a antibody titre, graft palpation score, and morphological and immunophenotypic scoring of A-Tg or WT heart grafts in B6 WT recipients Group Recipient ID Sensitized C' addition post-tx Graft type Graft harvest (days post-tx) Graft Anti-A Ab titre AMR A-Ag score Graft At Tx At graft Morphology a score b harvest score c C4d CD68 + score d cells e pamr grade f / /0 0 no no A-Tg / / ND necrotic ND /0 1(i+) /7 1(i+) ND 1(i+) yes no A-Tg /1 1(i+) /6 1(i+) / /10 1(i+) / /0 1(i+) ND / yes no WT / / / ND /10 1(h+) 24 yes yes A-Tg / ND ND 3 Page 6 of 11

7 ND 0 28 yes yes WT / /0 0 a Graft A-antigen IHC score at harvest: 0=negative, 1=weak, 2=moderate, 3=strong b Graft palpation score at harvest c AMR morphology score 17 ; 0=none, 1=histopathologic features of AMR, 2=severe histopathologic features of AMR d C4d score 20 e CD68+ cells; number of CD68+ cells per 5hpf (40 ) interstitial / intravascular f Overall pamr grade 17 Ab, antibody; Ag, antigen; C', complement; ND, not determined; Tx, transplantation. Page 7 of 11

8 Table S4. Serum anti-a antibody titre, graft palpation score, and morphological and immunophenotypic scoring of A-Tg or WT heart grafts following passive antibody and complement injection to non-sensitized B6 WT recipients Group Recipient ID Graft Anti-A antibody titre b score b Graft palpation Graft type A-Ag score a 0 hr 1 hr 3 hr 24 hr 0 hr 1 hr 3 hr 24 hr Morphology score c AMR C4d CD68 + cells e pamr score d grade f / / / /1 3 A-Tg / / / / / WT / /2 0 a Graft A-antigen IHC score at harvest: 0=negative, 1=weak, 2=moderate, 3=strong b Anti-A antibody titre and graft palpation score determined just prior (0 hr) and post (1, 3 and 24 hr) passive antibody and complement injection; grafts harvested 24 hr post injection c AMR morphology score 17 ; 0=none, 1=histopathologic features of AMR, 2=severe histopathologic features of AMR d C4d score 20 e CD68+ cells; number of CD68+ cells per 5hpf (40 ) interstitial / intravascular f Overall pamr grade 17 Page 8 of 11

9 A B A transferase: H transferase: C heart lung liver kidney spleen A-Tg WT Figure S1. Generation of A-Tg mice. (A) Transient transfection of COS-7 cells with CMV/HT-AT construct. Flow cytometric detection of A-antigen after staining with FITC-conjugated Helix pomatia (HP) lectin (thick light grey line) and H-antigen after staining with FITC-conjugated Ulex europea (UEA) lectin (thick dark grey line); vector control is also shown (thin black line). (B) Genotyping of A-Tg mice: representative agarose gel electrophoresis of PCR reactions using A Page 9 of 11

10 and H transferase specific primers and DNA isolated from tail biopsies from A-Tg lineage mice (n>100). Each lane represents a separate mouse. Lanes 1 and 2: genotype A and H transferase positive (A-transferase band ~330 bp, H-transferase band ~250 bp) mice; lane 3: genotype negative non-transgenic littermate. A-transferase primers: ACTTCGACCTATGATCCTTTTCC and CACGTATTTCTTGATGGCAAACAC with 224 bp product; H-transferase primers: AGTCTGTGTCCTCTCTGTAATC, TGGCATACTGTCCCATCTG with 248 bp product. (C) Representative A-antigen staining of heart and other organs from A-Tg and WT (non-transgenic littermates) mice with HP lectin (n=3 each, 200 magnification). A-antigen expression was limited to vascular endothelium of tissue from A-Tg mice. Page 10 of 11

11 Figure S2. A-antigen expression on A-Tg heart grafts: A-antigen scoring. Shown are representative examples of A-antigen staining on A-Tg heart grafts transplanted into A- sensitized WT mice: strong (score=3; recipient 7), moderate (score=2; recipient 13) and weak (score=1; recipient 14) staining for A-antigen. Staining was performed with anti-a monoclonal antibody as outlined in Material and Methods, all images at 200 magnification). A-antigen expression was limited to vascular endothelium. Page 11 of 11