Multi-pathogen Screening and/or Confirmation via Microarray Detections. Bruce Applegate, Sergei Savikhin and Michael Kane

Transcription

1 Multi-pathogen Screening and/or Confirmation via Microarray Detections Bruce Applegate, Sergei Savikhin and Michael Kane

2 Multiplex PCR Detect multiple target DNA sequences Multiple organism detection Reduction of false positives and false negatives Limited number of amplicons for simultaneous analysis Electrophoresis limitation Fluorophore pairs

3 Multiplex PCR primer and beacon binding sites in target genes from L. monocytogenes, Salmonella spp, and E. coli O157:H7

4 SIPC INLA PRFA HLYA IAP RFBE HLYC EAEA STX1 STX2 FLICH7 SPVC FIMY SIPB INVA 600bp 100bp PCR of multiplex PCR primer pairs

5 Analysis of multiplex PCR reactions Capillary Electrophoresis ROX standard JOE, FAM and NED tagged Primers for PCR Multiplex PCR One reaction with 12 genes Three reactions with four genes for each pathogen

6 Relative Fluorescence Units sipc sipb inva spvc Time Capillary electrophoretic fragment analysis for multiplex PCR from S. Enteritidis with approximately four copies of genomic DNA in 25 µl.

7 Relative Fluorescence Units prfa hlya inla iap Time Capillary electrophoretic fragment analysis for multiplex PCR from L. monocytogenes with approximately four copies of genomic DNA in 25 µl.

8 Relative Fluorescence Units stxi rfbe eaea hlyc Time Capillary electrophoretic fragment analysis for multiplex PCR from E. coli O157:H7 gene fragments with approximately four copies of genomic DNA in 25 µl.

9 Relative Fluorescence Units sipb sipc spvc prfa inva eaea hlya rfbe stxi inla iap hlyc Time Capillary electrophoretic fragment analysis for multiplex PCR with approximately 4x10 3 copies of genomic DNA in 25 µl from E.coli O157:H7, S. Enteritidis, and L. monocytogenes.

10 Relative Fluorescence Units eaea hlyc stxii rfbe Time Fragment analysis using capillary electrophoresis of a positive multiplex PCR from E. coli O157:H7 inoculated beef.

11 mpcr results for E. coli O157:H7 inoculated ground beef

12 Relative Fluorescence Units spvc sipb inva sipc Time Fragment analysis using capillary electrophoresis of a positive multiplex PCR from S. Enteritidis inoculated lettuce.

13 mpcr results for S. enteritidis inoculated on lettuce

14 Relative Fluorescence Units prfa hlya inla iap Time Fragment analysis using capillary electrophoresis of a positive multiplex PCR from L. monocytogenes inoculated hot dog.

15 mpcr results for L. monocytogenes inoculated hotdogs

16 Multiplex Amplicon detection using Microarrays

17 Beacon Concept Complementary strand Target strand A B C Molecular beacon closed (A), open (B), and hybridized (C).

18 Fluorescence (a. u.) Fluorescence of iap (Listeria) in solution with cy-3 and cy-5 dye labeled Wavelength (nm) 70 C (black, line) => 55 C (blue, line) => 40 C (red) => 55 C (blue, circle) => 70 C (black, circle)

19 Beacon structure and attachment chemistry CATTTCCCGTGGTTGCTTGCGTTTGAGACTGGAAATG NH 2 Palindromic Sequence Attachment to Microarray using internal C6 aminolinker

20 Arrayer (Genomic Solutions) Michael Kane

21 Scanner (Genomic Solutions) Michael Kane

22 Preliminary array experiments Unhybridized beacon Hybridized beacon Target beacon eae Target beacon eae hybridized with complimentary oligo

23 Multiplex Microarray Microarray A. Results from 3 different microarrays hybridized with control (no DNA, top row), ng/ul of DNA (1:50 dilution of the PCR products, middle row), and 5-10 ng/ul of DNA (1:10 dilution of PCR products, bottom row). Note that in the absence of target DNA, the microarray features appear red due to FRET signaling (B), and in the presence of target DNA the microarray features appear green due to the absence of FRET signaling (C).

24 Green/red fluorescence ratios of beacon probes upon target DNA hybridization measured with microarray scanner Target DNA concentration eaea hlyc rfbe stxi Control (none) 0.30 ± ± ± ± ng/μl 1.9 ± ± ± ± ng/μl 12.8 ± ± ± ± 0.7

25 Prototype Detector

26 Simplified setup of the biosensor. ND: neutral density filter, TS: translation stage, FL: collimating lens, FW: interference filter wheel, PMT: photomultiplier. TS and FW are pc-controlled and the data from PMT are sent to pc and analyzed. Two interference filters of 570 nm and 670 nm are switched during each measurement.

27 The picture of the working biosensor prototype with the cover open. All components of the system are housed in a dark box. The green line in the picture is following the path of the green exciting laser (532 nm) which is hitting the target MB spot.

28 The close view of the MB arrayed slide with the laser on. During the measurement, the neutral filters will be inserted at the output of the laser to adjust the intensity of the excitation. The temporary manual translation stage for the adjustment of the vertical height of the slide is also seen.

29 The screen shot of the biosensor controlling software. (A) Individual measurement control with the choice of spot position and filter. (B) The status box showing the position, filter choice and PMT measurement at each spot. (C) The automated scan result is shown here and real time analysis is presented.

30 Green/red fluorescence ratios of eaea sequenced beacon probes upon target DNA hybridization measured with prototype detection platform Target DNA concentration Green/red fluorescence ratio Control (none) 0.24 ± ng/μl 0.23 ± 0.03 (0.96 ± 0.17) 5 10 ng/μl 0.53 ± 0.06 (2.21 ± 0.40) ng/μl 0.86 ± 0.09 (3.58 ± 0.64) In parentheses: degree of increase of the measured green/red fluorescence ratio compared to that of the control probe.

31 Hybridization chamber prototype Microarray Hybridization Chamber (200 ul) Gasket RED Emission (FRET Acceptor Fluorescence) Peltier Block (cool) Stem base-pairing facilitates FRET signal Microarray GREEN Emission (FRET Donor Fluorescence) Gasket Heat disrupts stem hybridization and FRET signal Peltier Block (hot)

32 Online amplicon detection prototype Outlet Line Inlet Line Microarray w/ gasket cover (including inlet/outlet) Green Laser Peltier Block Bar Code Microarray Layout Emisssion/Fluoresence Detection Each line (rather than a spot) is the FRET-probe, and its ID is derived from its location within the bar code pattern and/or the line thickness.

33 Hybridization Chamber PCR and Detection (End-Point Detection) Microarray Hybridization Chamber (200 ul) Gasket Peltier Block (thermocycles) Hyb Chamber contains: 1) Sample 2) PCR mix 3) Primers 95C (30 sec) 60C (30 sec) 72C (30 sec) 25C (1-2 min) 30 Cycles Detect Fluorescence

34 Hybridization Chamber PCR and Detection (Inter-Cycle Detection) Microarray Hybridization Chamber (200 ul) Gasket Peltier Block (thermocycles) 95C (30 sec) 72C (30 sec) 95C (30 sec) RED Emission (FRET Acceptor Fluorescence) 60C (30 sec) 30 Cycles 25C (1 min) Detect Fluorescence GREEN Emission (FRET Donor Fluorescence) Thermocycles

35 Hybridization Chamber PCR and Detection (On-board Quality Control) Microarray Hybridization Chamber (200 ul) Gasket Peltier Block (thermocycles) OK BAD BAD 50C (1 min) 50C 25C (1 min) 25C Detect Fluorescence Microarray & System can be re-used if QC is OK

36 Summary Collective twelve gene mpcr was able to yield a detectable signal with 4E+03 copies of template chromosomal DNA An enrichment step was necessary to yield a detectable signal in all three cases The method to extract the DNA from the samples was inefficient for L. monocytogenes in hotdogs Array detection of PCR products using the beacon approach was successful

37 Summary Prototype detection device has been completed and is currently being evaluated Currently developing peltier hybridization chamber for interfacing with detection platform (can be expanded into multiple formats) Designed new fluorophore pairs to facilitate synthesis of beacon probes and lower expense Currently developing array for multiplex detection

38 Acknowledgments Center for Food Safety Engineering, Purdue University Purdue core sequencing facility USDA/ARS cooperative agreement