Supplementary Figures S1-S5. a b c

Transcription

1 Supplementary Figures S1-S5 a b c Supplementary Figure S1. Generation of IL-17RD-deficient mice. (a) Schematic shows the murine il-17rd gene and the genetrap targeting vector, containing a promoter-less reporter/selectable marker fusion gene (β-geo) downstream of a splice acceptor, which incorporates into the il-17rd gene after the first exon. Exons are numbered and regions targeted by genotyping primers are also indicated. The targeting vector also contains frt, f3, lox5171 sites omitted in schematic. (b) Genotyping was performed by PCR on genomic DNA from ear punches. Primer 1 and 2 amplify a fragment from the WT allele of size 449 bp and from the knockout allele due to insertion of the genetrap cassette at a predicted size >7 Kb, too large to amplify. Primer 1 with primer 3 amplifies a fragment spanning the genetrap cassette of size 1103 bp and identifies the knockout allele. Primers 4 and 5 amplify a region of the β-geo insert at a size of 508 bp further confirming the presence of the genetrap cassette only found in Il17rd +/ and Il17rd / mice. (c) cdna was prepared from Il17rd +/+ and Il17rd / primary MEFs and expression of il-17rd mrna was evaluated by qpcr. Data represent mean +/- SEM of three independent experiments.

2 a b Supplementary Figure S2. IL-17RD does not affect the Act1- dependent mrna stability pathway. (a) Primary MEFs from Il17rd +/+ and Il17rd / mice were pre-treated with IL-17A (100 ng/ml) for 2 h. Cells were then treated with actinomycin D (5 µg/ml) and IL- 17A (100 ng/ml) for the indicated times. KC and MIP-2 mrna levels were evaluated by qpcr. (b) HEK293 cells were cotransfected with TNF-α, IL-8, and β-actin UTR reporter constructs (80 ng) and constitutively expressed TK Renilla luciferase (40 ng) with or without Act1 (50 ng) or/and IL-17RD (50 ng) or EV. Data represent mean +/- SEM of three independent experiments (a, b) with triplicate determinants (b).

3 Supplementary Figure S3. IL-17RD regulates activation of NF-κB and MAPK signalling pathways. MEFs from Il17rd +/+ and Il17rd / mice were stimulated with IL-17A (100 ng/ml) as indicated. Cell lysates were collected and subsequently subjected to immunoblotting with the indicated antibodies (left panel) or nuclear extracts were assayed for binding to a labelled oligonucleotide containing a consensus NF-κB-binding motif by EMSA (right panel). Nuclear extracts from Il17rd +/+ MEFs, stimulated for 30 minutes with IL-17RA, were also pre-incubated with a competing non-labelled NF-κB oligonucleotide (Comp), before assaying NF-κB-DNA binding activity. Data are representative of three independent experiments.

4 Supplementary Figure S4. The SEFIR domain of IL-17RD is important for Act1 and IL-17RA binding. HeLa cells were transfected for 24 h with EV, IL-17RD WT (Myc-tagged or IL-17RD ΔC (Myc-tagged) (5 µg) in 90 mm petri dishes. Lysates were immunoprecipitated with anti-myc followed by immunoblotting with anti-il-17ra, anti-act1, anti-myc and anti-β-actin antibodies. Data are representative of three independent experiments.

5 Supplementary Figure S5. IL-17RD does not disrupt the interaction of Act1 with IKKi. HEK 293 cells were cotransfected with expression constructs encoding IKKi-FLAG, Act1-HA, and IL-17RD-Myc (1 µg). After 24 h cell lysates were immunoprecipitated with anti-flag and immunoblotted with anti-ha, anti-myc, anti-flag and anti-β-actin antibodies. Data are representative of three independent experiments.

6 Supplementary Information Supplementary Table S1. Murine and human primers used for quantitative PCR GENE NAME FORWARD PRIMER REVERSE PRIMER kc AGACCATGGCTGGGATTCAC CAAGGGAGCTTCAGGGTCAA mil6 ACAACCACGGCCTTCCCTAC TCCACGATTTCCCGAGAACA mil17rd ACCTGAGCACCAAGTACAAGCTCA TGCAAATGGCAACATACAGGGAGC mmip2 CTGGGGAGAGGGTGAGTTG GCTGTTCTACTCTCCTCGGTG mhprt GCTTGCTGGTGAAAAGGACCTCTCGAAG CCCTGAAGTACTCATTATAGTCAAGGGCAT hil6 ATGTAGCCGCCCCACACAGA ATTTGCCGAAGAGCCCCTCAG hil8 CACCGGAAGGAACCATCTCACTGT TCCTTGGCAAAACTGCACCTTCA hmip2 GAACTGCGCTGCCAGTGCTT CGATGCGGGGTTGAGACAAG hil17rd CTGTCTCTGCCACTGATGGA AGAGGAGCTTGGAAGGAAGG hhprt GGTGAAAAGGACCCCACGAA GGCGATGTCAATAGGACTCCAGAT Supplementary Methods Genotyping of mice Mice were genotyped by PCR analysis of DNA isolated from ear punches using primers 1 5ꞌ- TGTGGTAGCCAAAGACTG CTTCATG-3ꞌ, 2 5ꞌ-ATAGGTCACTTGCAAATCC-3ꞌ, 3 5ꞌ- GGACAGGATAAGTATGA CATCATC-3ꞌ, 4 5ꞌ-CTGGCGTAATAGCGAAGAGG-3ꞌ and 5 5ꞌ-CCGCCACATA TCCTGATCTT-3ꞌ. PCR analysis using primers 1 and 2 generates a fragment of 449 bp for the WT allele. Primers 1 and 3 generate a fragment of 1103 bp for the knockout allele (Supplementary Fig. S1b). To further confirm the presence of the genetrap cassette primers 4 and 5 amplify a region of the β-geo insert at a size of 508 bp and this is only found in Il17rd +/+ and Il17rd / mice. 1

7 Immunoblot analysis BMDMs, MEF cells or U373 cells, stably transfected with IL-17RD shrna or control shrna (3 x 10 5 cells/ml), were seeded in 6-well plates and grown for 24 h. Cells were stimulated with IL-17A (100 ng/ml) for different time points as indicated in the figure legends. Cells were washed in 1 ml of ice-cold PBS and lysed in 100 µl of NP-40 lysis buffer (50 mm Tris-HCl, ph 7.5, containing 150 mm NaCl, 0.5% (w/v) igepal, 50 mm NaF, 1 mm Na 3 VO 4, 1 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride and complete protease inhibitor mixture (Roche)). The cell lysates were centrifuged at 12,000 g for 10 min, supernatants were collected and subjected to western blotting using the indicated antibodies. Immunoreactive bands were detected using the Odyssey Infrared Imaging System from LI- COR Bioscience, according to the instructions of the manufacturer. Co-immunoprecipitation analysis Cells were seeded (2 x 10 5 cells/ml; 3 ml or 10ml) in 6-well plates or 90 mm petri dishes and transfected, using Lipofectamine 2000, with defined amounts of various expression constructs as described above or were untransfected for endogenous co-immunoprecipitation studies. Cells were washed with pre-chilled PBS (1 ml) and then lysed with pre-chilled lysis buffer (250 µl) (50 mm HEPES, ph 7.5 containing 1 mm EDTA, 10% (v/v) glycerol, 0.05% (w/v) CHAPS, 0.5% (v/v) Triton-X and 250 mm NaCl, 1 mm Na 3 VO 4, 1 mm dithiothreitol (DTT), 1 mm phenylmethylsulfonyl fluoride (PMSF) and complete protease inhibitor mixture (Roche)) for 30 min on a rocker at 4 o C. Lysates were centrifuged at 12,000 g for 10 min at 4 o C. Aliquots (50 μl) were retained for immunoblotting whilst the remaining supernatants were removed to fresh pre-chilled tubes. Samples were incubated overnight with the appropriate antibody (2 µg) at 4 C with rocking. This was followed by the addition of protein A/G agarose beads (30 μl per sample). Incubations were placed at 4 o C with rocking for 4 hours. Immunoprecipitates were collected by centrifugation at 1000 g for 5 min at 4 o C and the beads were then washed 4 times with lysis buffer (600 µl) lacking the protease inhibitor mixture. The beads were resuspended in 2X SDS-PAGE sample buffer (40 μl) and incubated for 30 min at RT. Samples were centrifuged at 16,000 g for 2 min, subsequently boiled at 100 o C for 5 min and subjected to immunoblotting. The immunoreactive bands were detected and images captured using Odyssey Infrared Imaging System from Licor Bioscience. 2

8 RNA isolation and quantitative PCR BMDMs, MEFs or U373 cells, stably transfected with control or IL-17RD shrna, were seeded (2 x 10 5 cells/ml; 3ml) into 6-well plates and grown for 24 h. Cells were then treated with IL-17A (100 ng/ml) for the indicated time points and/or pretreated with various inhibitors as indicated. Cells were washed in PBS and RNA was extracted using Tri-Reagent (Sigma) according to the manufacturer s instructions. Total RNA was also isolated from PECs, PBMCs and from the perfused lungs that were snap-frozen in liquid nitrogen and homogenized in 1 ml volume of Tri-Reagent. After DNase I digestion, cdna was generated from normalized RNA using AMV reverse transcriptase (Promega). Samples were assayed by quantitative real time PCR using Brilliant SYBR Green QPCR Master mix (Stratagene). PCR was conducted with the CFB G Opticon thermal cycler (Bio-Rad Laboratories). Reactions were performed using pre-validated primers (Eurofins MWG Operon) as indicated (Supplementary Table S1). Flow cytometry Infiltrating cells were analyzed by surface marker expression by flow cytometry with data collection on a CyAn (Beckman Coulter), as described (Ludwig et al. 2010). Data were analyzed using or FlowJo software (Tree Star). Cells were stained using PerCP anti-cd11b (M1/70), PE anti-ly6g (RB6-8CS) and APC anti-f4/80 (BM8). Flow buffers used contained 2 mm EDTA to exclude doublets. Using appropriate isotype-controls, gates were drawn and data were plotted on logarithmic scale density- or dot-plots. Slide preparation and differential cell counting Slides were prepared from BAL fluid or peritoneal lavage (50,000 cells/slide) using a cytospin (Thermo-Shandon). All slides were stained with Wright-Giemsa (Thermo-Shandon) to depict leukocyte subsets. A total of 200 leukocytes were counted per slide. 3