Figure S1. Biosynthetic pathway of GDP-PerNAc. Mass spectrum of purified GDP-PerNAc. Nature Protocols: doi: /nprot

Transcription

1 Synthesis of GDP-PerNAc In E. coli O157, the biosynthesis of GDP- -N-acetyl-D-perosamine (GDP-PerNAc) involves three enzymes (Fig. S1). GDP-D-Mannose is converted by GDP-mannose-4,6-dehydratase (GMD) into GDP-4-keto-6-deoxy-D-mannose, and is then transaminated by a pyridoxal-phosphate dependent GDP-D-perosamine synthetase (PerA). Finally, GDP-D-perosamine is acetylated by a GDP-Dperosamine-N-acetyltransferase (PerB) to form GDP-PerNAc 55. We have previously synthesized GDP-D-perosamine 56. In this work, PerB was cloned for the synthesis of GDP-PerNAc. Briefly, a DNA fragment encoding PerB was amplified by PCR from chromosomal DNA of E. coli O157 using the following oligonucleotides with restriction sites underlined: PerB_F: 5 - GCTCATATGAATTTGTATGGTATTTTTGGTG -3 (NdeI) / PerB_R: 5 - TCTGGATCCTTAAATAGATGTTGGCGATCTTTT -3 (BamHI). The PCR-products were digested with NdeI and BamHI and were ligated into expression vector pet15b (Novagen) to form plasmid pet15b-perb. The expression and purification of PerB, as well as the synthesis and purification of GDP-PerNAc were performed as reported by Albermann C 55. The product was identified by mass spectrometry. Figure S1. Biosynthetic pathway of GDP-PerNAc. Mass spectrum of purified GDP-PerNAc

2 References 55 Albermann, C. & Beuttler, H. Identification of the GDP-N-acetyl-d-perosamine producing enzymes from Escherichia coli O157:H7. FEBS Lett 582, (2008). 56 Zhao, G. et al. Cloning and characterization of GDP-perosamine synthetase (Per) from Escherichia coli O157:H7 and synthesis of GDP-perosamine in vitro. Biochem Biophys Res Commun 363, (2007).

3 Cloning and expression of putative GTs WbdN, WbdO and WbdP The wbdn, wbdo and wbdp genes were amplified by PCR from the E. coli O157 ATCC chromosome. The primers with restriction sites or nucleotide fragment for Ligation-independent cloning (LIC) underlined for amplification of each gene were as follows: (wbdn) WbdN_F: 5 - GCGCATATGAACAAAGAAACCGTTTCAA -3 (NdeI) / WbdN_22b: 5 - TATCTCGAGCTTTTTAGTCTCCTTTCTCCTT -3 (XhoI); (wbdo) WbdO_9F: 5 - TACTTCCAATCCAATGCGATGAAAATATCAGTTATA -3 / WbdO_9R: 5 - TTATCCACTTCCAATGTTATTCATTATCATATGGTG -3 (LIC); (wbdp) WbdP_F: 5 - GCTCATATGAAAATTGCGTTGAATTCAG -3 (NdeI) / WbdP_22b: 5 - TATCTCGAGAGATCGGGATTCAATTTCTTGTT -3 (XhoI) The wbdn and wbdp DNA fragments were digested with corresponding restriction enzymes and inserted into a pet22b vector linearized by the same restriction enzymes to form pet22b-wbdn and pet22b-wbdp. The wbdo DNA fragment was treated with T4 DNA polymerase and inserted into a pmcsg9 vector linearized by SspI and treated with T4 DNA polymerase to form the plasmid pmcsg9-wbdo. The recombinant plasmids were confirmed by DNA sequencing. The correct constructs were transformed into E. coli BL21 (DE3) or E. coli BL21 (DE3) plyss for expression. E. coli BL21 (DE3) harboring plasmid pet22b-wbdn was grown in 1 L low-salt Luria-Bertani (LB) (for 1 L of medium: 5 g of NaCl, 5 g of Yeast extract and 10 g of Tryptone) at 37 C until the O.D. 600 reached 0.8. Isopropyl-1-thio- -D-galactospyranoside (IPTG) was added to a final concentration of 0.1 mm. Expression was allowed to proceed for 20 h at 16 C. Cells were harvested and stored at -80 C until needed. WbdN was purified to 95% in one step using Ni-NTA agarose (Qiagen, Germany) according to standard procedure. Briefly, the cell pellet was suspended in buffer A (20 mm Tris-HCl ph 8.0, 500 mm NaCl, 0.1% Tween-20, 5 mm -mercaptoethanol, 20% glycerol, 20 mm Sucrose, 30 mm imidazole) with 0.2 mm phenylmethylsulfonyl fluoride (PMSF) and was disrupted by sonication on ice. After centrifugation, the lysate was loaded onto a Ni-NTA agarose column (2 ml) which was prequilibrated with buffer A. The loaded column was washed with 200 ml of buffer A. The His-tag WbdN was eluted with buffer A with 270 mm imidazole. After elution, the protein containing fractions were analyzed by SDS-PAGE to check the purity and the molecular mass. Imidazole was removed using a PD-10 column (GE Life Science, USA) equilibrated with 50 mm Tris-HCl, ph 8.0, 150 mm NaCl, 1 mm dithiothreitol (DTT) and 20% glycerol. The same expression and purification procedures were used for WbdO, except that -mercaptoethanol, Tween 20, sucrose and glycerol were removed in all purification steps. In the case of WbdP, the E. coli BL21 (DE3) plyss cells harboring

4 recombinant plasmid pet22b-wbdp were grown in 1 L low-salt LB medium at 37 C until the O.D. 600 reached 0.6. The cells were then induced with 0.1 mm IPTG at 37 C for 2 hrs. Subsequently, the cells were harvested by centrifugation, washed twice in ice-cold 50 mm Tris-HCl, ph 7.5, and resuspended in buffer B (50 mm Tris-HCl, ph 7.5, 150 mm NaCl, 10 mm MgSO 4, 5 mm -mercaptoethanol, 10% glycerol, 0.5% Triton X-100, 10 mm imidazole) with 0.2 mm PMSF. After disruption by sonication the crude extract was clarified by centrifugation. The lysate was loaded onto a Ni-NTA agarose column (2 ml) which was prequilibrated with buffer B. The loaded column was washed with buffer B with 40 mm imidazole. WbdP with His-tag was eluted with buffer B with 400 mm imidazole. Protein eluted from the column was analyzed by SDS-PAGE (Fig. S2) and desalted as described above. Figure S2. SDS-PAGE detection of purified putative glycosyltransferases. (a) WbdN; (b) MBP fused WbdO; (c) WbdP. 1, Whole cell after IPTG induction; 2, Supernatant after brief sonication and centrifugation; 3, Elutions from Ni-Column.

5 Mass spectra of RU-PP-Lipids GalNAc -PP-Farnesyl Glc 1,3-GalNAc -PP-Farnesyl Fuc 1,4-Glc 1,3-GalNAc -PP-Farnesyl

6 PerNAc 1,3-Fuc 1,4-Glc 1,3-GalNAc -PP-Farnesyl GalNAc -PP-MS pentaprenyl Glc 1,3-GalNAc -PP-MS pentaprenyl

7 Fuc 1,4-Glc 1,3-GalNAc -PP- MS pentaprenyl PerNAc 1,3-Fuc 1,4-Glc 1,3-GalNAc -PP- MS pentaprenyl

8 NMR spectra of chemically synthesized compounds SpinWorks 2.3: PPM file: C:\Users\BW\Desktop\Spec Data\NMR DATA\Wzy Project\AcGalNAc\4\fid expt: <zg30> freq. of 0 ppm: MHz transmitter freq.: MHz LB: GB: width: Hz = ppm = Hz/pt number of scans: 16

9 SpinWorks 2.3: PPM file: C:\Users\BW\Desktop\Spec Data\NMR DATA\Wzy Project\AcGalNAc\5\fid expt: <zgpg30> freq. of 0 ppm: MHz transmitter freq.: MHz LB: GB: width: Hz = ppm = Hz/pt number of scans: 1024

10 SpinWorks 2.3: PPM file: C:\Users\BW\Desktop\Research\Spec Data\NMR DATA\AcGalNAcOH\1\fid expt: <zg30> freq. of 0 ppm: MHz transmitter freq.: MHz LB: GB: width: Hz = ppm = Hz/pt number of scans: 128

11 SpinWorks 2.3: PPM file: C:\Users\BW\Desktop\Research\Spec Data\NMR DATA\AcGalNAcOH\2\fid expt: <zgpg30> freq. of 0 ppm: MHz transmitter freq.: MHz LB: GB: width: Hz = ppm = Hz/pt number of scans: 332

12 SpinWorks 2.3: in MeOH-d4 at rt on 500 M PPM file: C:\Users\BW\Desktop\Spec Data\NMR DATA\RamuNMR2\prs-GalNAc-dibenzyl\1\fid expt: <zg30> freq. of 0 ppm: MHz transmitter freq.: MHz LB: GB: width: Hz = ppm = Hz/pt number of scans: 16

13 SpinWorks 2.3: PPM file: C:\Users\BW\Desktop\Ramu NMR\prs-GalNAc-dibenzyl\2\fid expt: <zgpg30> freq. of 0 ppm: MHz transmitter freq.: MHz LB: GB: width: Hz = ppm = Hz/pt number of scans: 1188

14 SpinWorks 2.3: PPM file: J:\AcGalNAc Protected Phosphate\2\fid expt: <zgpg30> freq. of 0 ppm: MHz transmitter freq.: MHz LB: GB: width: Hz = ppm = Hz/pt number of scans: 57

15 SpinWorks 2.3: AcO AcO OAc O AcHN O O O P O P O O O NH 4 NH 4 9 PPM file: M:\AcGalNAcPPUnd\1\fid expt: <zg30> freq. of 0 ppm: MHz transmitter freq.: MHz LB: GB: width: Hz = ppm = Hz/pt number of scans: 64

16 SpinWorks 2.3: AcO AcO OAc O AcHN O O O P O P O O O NH 4 NH 4 9 PPM file: J:\AcGalNAcPPUnd2\2\fid expt: <zgpg30> freq. of 0 ppm: MHz transmitter freq.: MHz LB: GB: width: Hz = ppm = Hz/pt number of scans: 15086

17 SpinWorks 2.3: AcO AcO OAc O AcHN O O O P O P O O O NH 4 NH 4 9 PPM file: J:\GalNAcPPUndPhos\1\fid expt: <zgpg30> freq. of 0 ppm: MHz transmitter freq.: MHz LB: GB: width: Hz = ppm = Hz/pt number of scans: 728