C57BL/6N Female. C57BL/6N Male. Prl2 WT Allele. Prl2 Targeted Allele **** **** WT Het KO PRL bp. 230 bp CNX. C57BL/6N Male 30.

Transcription

1 A Prl Allele Prl Targeted Allele 631 bp bp 1 SA β-geo pa Het B Het 631 bp bp PRL CNX C 1 C57BL/6N Male (14) Het (7) (1) 1 C57BL/6N Female (19) Het (31) (1) % survival 5 % survival 5 **** D days Day (at birth): C57BL/ days 1.5 *** ** Body (g) 1..5 E. 5 Het Het (7) (17) (6) (15)(16) () C57BL/6N Male 5 C57BL/6N Female Body (g) 15 1 PRL- (7-1) 5 PRL- Het (17-5) PRL- (6-7) **** Body (g) 15 1 PRL- (1-15) 5 PRL- Het (17-7) PRL- (1-) N.A Body Gain / Week (g) C57BL/6 Male 8 PRL- (-1) PRL- Het (3-5) 6 PRL- (4-8) 4 *** Body Gain / Week (g) C57BL/6 Female 8 PRL- (9-16) PRL- Het (1-7) 6 PRL- (1) Supplemental figure S1 Gender-dependent differences in viability of the PRL mice in C57BL/6N background (A) Generation of the PRL (PTP4A) deficient mice. Schematic genomic construction of the targeted allele for Prl (Ptp4a) gene is shown. The trapping vector was inserted between exon 1 and exon of the gene coding for PRL. Arrows indicate PCR primers used for genotyping. (A, right) PCR genotyping was performed on genomic DNA. Predicted sizes of PCR products were obtained for, heterozygous and mutant alleles. (B) Protein was extracted from skeletal muscle and immunoblotted with PRL1/ and calnexin (CNX) antibodies. (C) % survival of the mice after birth was plotted for both male (left) and female (right). ****p.1 ( vs ), Log-rank (Gehan-Breslow-Wilcoxon) test. (D) Average body weight at birth for each genotype are shown. (E) Average body weight for each genotype (top) and body weight gain per week (bottom) were plotted every week from birth to 8 weeks. P values were calculated by one-way ANOVA with Dunnet s multiple comparison test (D), two-way ANOVA with Dunnett s multiple comparison test (E), *p.5, **p.1, ***p.1, ****p.1

2 Brain P.17 P.9 (6) (7) (1) (5) Supplemental figure S Body composition of PRL mice Dissected tissue weights were normalized by body length and mean values were plotted. Data is expressed as mean ± SEM. Statistical analysis was performed by Student s t-test (*p.5, **p.1, ***p.1). EDL: extensor digitorum longus muscle, SOL: soleus muscle. Pancreas Spleen Liver WAT Colon Kidney Thymus Heart Lung BAT EDL GA SOL Brain Thymus P.6 P.199 (6) (8) (11) (7) Spleen P.1 P.1 ** *** (8) (8) (1) (8) Heart P.73 P.37 (6) (9) (1) (1) Muscle (EDL) P.375 P.5 * (7) (9) (14) (8) Muscle (SOL) P.65 P.3 (6) (9) (1) (8) Lung P.1 P.8 ** (6) (8) (11) (7) Kidney P.3 P.98 (6) (8) (1) (7) Male Female PRL1 PRL PRL1 PRL Supplemental figure S3 PRL1/ protein expression pattern in major tissues Tissue distribution of PRL1 and PRL proteins is shown. Tissues were lysed, then male and female tissues were separately loaded on the gels and immunoblotted with PRL1/. EDL: extensor digitorum longus muscle, GA: gastrocnemius muscle, SOL: soleus muscle.

3 Mg + content in diets (%)..1 Schematic experimental design regular diets 3 8 Age (week) BW (1%) BW 1 week Mg (+) Mg (-) Supplemental figure S4 Schematic experimental design for dietary Mg + depletion Fatty acid synthesis Mitochondria β-oxidation acetyl CoA Acly Isocitrate a-ketoglutarate Glucose Glycolysis Pyruvate acetyl CoA Citrate TCA Oxaloacetate Succinyl-CoA Succinate Malate Fumarate Cell membrane Supplemental figure S5 Schematic overview of the metabolic pathway Major cellular metabolic pathways are schematically drawn. The process where Acly act are indicated by a red arrow.

4 Prl1 (Liver) Prl (Liver) Prl3 (Heart) Cnnm1 (Colon) Cnnm (Lung) Cnnm3 (KIdney) Cnnm4 (KIdney) 4 Acly (Liver) Supplemental figure S6 Relative mrna levels of Prl and Cnnm family genes from publically available micro-array data[1-3] 1. Hughes, M.E., et al., Harmonics of circadian gene transcription in mammals. PLoS Genet, 9. 5(4): p. e14.. Zhang, R., et al., A circadian gene expression atlas in mammals: implications for biology and medicine. Proc Natl Acad Sci U S A, (45): p Hoogerwerf, W.A., et al., Transcriptional profiling of mrna expression in the mouse distal colon. Gastroenterology, (6): p

5 Male Female Body WAT BAT Muscle Body Temperature High Acute Cold Response Low Expression Food Intake O consumption O O O O (VCO /VO ) Locomotor Activity Rhythm Activities 1 Phase Activities 1 Rhythm Phase 1 1 Supplemental figure S7 Graphical summary of PRL mice phenotypes

6 Supplemental experimental procedure Quantitative real-time PCR Primers used for Figure 3D Target gene (mouse) b-actin, forward b-actin, reverse PRL-3, forward PRL-3, reverse Primer sequence (5' to 3') GGACTCCTATGTGGGTGACG GGGAGAGCATAGCCCTCGTA AAGGACGGCATCACTGTTGT GCTTCCCGGGTCATTGTAGA Primers used for Figure 6H Target gene (mouse) Tbp, forward Tbp, reverse Cs, forward Cs, reverse Fh1, forward Fh1, reverse Acc, forward Acc, reverse Fasn, forward Fasn, reverse Acly, forward Acly, reverse Cox7a1, forward Cox7a1, reverse Atp5j, forward Atp5j, reverse Primer sequence (5' to 3') ACCTTATGCTCAGGGCTTGG GCCATAAGGCATCATTGGAC ATCCATAGTGACCATGAGGG TCAGTGCCTCAGATACAGTTT TTGGACAGGAATTCAGTGGT ATCGCTTCACACTGAGTAGG GTCCCCAGGGATGAACCAATA GCCATGCTCAACCAAAGTAGC GGAGGTGGTGATAGCCGGTAT TGGGTAATCCATAGAGCCCAG AAGCCTTTGACAGCGGCATCATTC TTGAGGATCTGCACTCGCATGTCT CAGTACACTTGAAAGGCGGG CCAGCCCAAGCAGTATAAGC GGCCGGAAGTAGAACGGT GAGACTGCTGACCGAAGGAC