D NA Cosmid dA TP (6) : , ( Kaplan. , ( Nephila Clavi pes ) DNA Cosmid, , ( Kerkam et al., 1991 ; Cunniffet et al.
|
|
- Beverly Bailey
- 5 years ago
- Views:
Transcription
1 47 (6) : , 2001 A cta Zoologica S inica D NA Cosmid 3 (, ) David L. Kaplan (, Tufts, 02155, ) ( Kaplan et al., 1994 ; Mello et al., 1994) 3 cdna,,,,,,,,, - N. clavi pes,, ( Nephila Clavi pes ), cdna,, ( Kerkam et al., 1991 ; Cunniffet et al., 1995), 111, N. clavi pes Tufts Kaplan 275 kd, 324 kd 740 kd ( Mello et al., 1994 ; Candelas et al., 1981 ; Jackson et al., 1995), 2112dA TP 3 2 Fab % 25 % { 1, ( 52 ) [ , 7 ] } 242 ( CSPD) ( 132 mm) Boehringer cdna (Xu et al., 1990 ; Hinman et al., 1992 ; Guerette et al., 1996), cdna 3 2 DNA Promega cdna (Arcidiacono et al., 1998), Oligo 1 : 5 gtgccg2 (Prince et al., 1995 ; Lewis et al., 1996 ; Arcidia2 conc et al., 1998) ( bp 3 ) Oligo 2 : 5 gtcttg2 G + C, gaagccaaggtgctggacgaggtggacaaggtgcaggcgcagcc , (No. 2001F006),, 44, : E2mail : com DNA Cosmid 1 SuperCos 1 Cosmid Giga2 pack 2XL XL2Blue MR Stratagene Mannheim T 4 DNA DNA gacaaggaggatatggaggtcttggaagccaaggtgctggacga 3 3
2 ( bp 3 ) Oligo 3 : 5 ctggacaagc2 cactcagatcgttggtcaatcagtttatcaagccctaggt 3 ( bp 3 ) Tufts, 1 l, Sigma DNA Cosmid (1 %, 100 mmol/ L, DNA 1 g 150 mmol/ L NaCl, p H 715), 30 min,, DNA Fab ( 1 ( Sambrook et al., 1989), K /, DNA 013 % DNA 100 mmol/ L NaCl, p H 915) 2 min, ( kb) 10 g DNA, S au 3 A DNA kb, min, min, X, DNA Sout h Supercos 1 Cosmid ern,, 10 g SuperCos 1 Cosmid Xba,, DNA,, B am H, 617 kb DNA 1 8, 2 mg/ ml K l h, 5 SSC, 011 % Gigapack XL2,, 2 h 500 N2, 0102 %SDS, 1 % l SM 20 l CHCL 3,,, 20 pmol/ ml 4, T m = DNA Cosmid lgna ( G + C) % - XL2Blue MR 10 ml LB, 10 mmol/ L Mg2 SO 4, 012 % 4 5 h (OD 600 < 110), r/ min 10 min 5 ml 10 mmol/ L MgSO 4 10 mmol/ L MgSO 4 OD 600 = 015, SM Cosmid, 1 1 (25 l 25 l), 30 min 200 l LB, 37 DNA, 1 h,, 37 Cosmid (cfu/ g DNA) Cosmid DNA kb dU TP, pmol, 4 l 25 mmol/ L min ( 1) CoCl 2, 1 l 1 mmol/ L 2112dU TP, 1 l 10 SuperCos 1 Cosmid 719 kb, cos mmol/ L da TP, 1 l 50 U TdT 4 l Xba Cosmid Xba (1 mol/ L, mol/ L Tris2HCl, p H 616, 1125 mg/ ml BSA), 20 l, min 2 l ( 1 l 20 mg/ ml 200 l fmol/ l, 10 fmol/ l, 2 fmol/ l, 014 fmol/ l, 0108 fmol/ l min (100 mmol/ L, 150 mmol/ L NaCl, p H 715, 013 % Tween220) 2 min, 5 000), 1 h, 15 min (100 mmol/ L Tris2HCl, CSPD ( ) 5 (600/ N ) ( N ) T m 10, D NA Cosmid S au3 A DNA,, B am H, Xba, B am H (617 kb) Cosmid 012 mol/ L ED TA, p H 810), cfu/ g DNA 215 l 4 mol/ L LiCl 75 l cfu/ ml 50 l H 2 O (DIG2Oligo 2)
3 6 : DNA Cosmid kb DIG2Oligo % Sau3A DNA Scos2DS kb ( 3) Fig. 1 Partial digestion of spider genomic DNA with Sau3 A on 013 %agarose gel 1 : DNA 2 : DNA : DNA/ Hi nd ( DNA molecular weight marker) 3 : DNA ( Spider ge2 nomic DNA) 4 7 : min ( Time after 10, 20, 30 and 45 minutes of partial digestion), Cosmid,, 56 ( 2) DNA, (DIG2 Oligo 1, DIG2Oligo 3), DNA, 3, Scos2DS 1, Scos2DS 3 Scos2DS 4 Scos2DS 2 DIG2Oligo 3 ( ) DNA 4, EcoR B am H Pst Pv u, Scos2DS 1 Scos2DS 3 Scos2DS 4, Scos2 DS 2 Scos2DS 1, Scos2DS 2 Southern, DNA Pst, Scos2DS kb ; Scos2DS Southern Fig. 3 The clone of dragline silk gene was identif ied by chemilluminescent Southern Blot hybridization using DIG2Oligo 1 as a probe A. Pst Scos2DS 1 Scos2DS 2 (Scos2DS 1 and Scos2DS 2 digested with Pst ) 1 : Scos2DS 1 2 : Scos2DS 2 3 : DNA : DNA/ Hi nd (DNA molecular weight marker) B. Southern (Southern Blot hybridization) 1 3 : A (same as A) 2 22 Cosmid Fig. 2 Chemilluminescent colony hybridization using DIG2Oligo 2 As a probe to screen N. clavipes spider Cosmid library 3,,
4 ,,, Cosmid DNA Arcidiacono, NcDS21 (Arcidiacono et al., 1998),, GenBank G + C, 5 2, 3 2,, DNA 3 50 : Oligo 1, 5 2, Oligo 2, Oligo 3 3 2, Cosmid,, Cosmid DNA,, K, DNA Cosmid DNA DNA, 2 (35 45 kb) Cosmid, Pst, DNA, 150 kb, Sau 3A, kb. Southern DNA DNA Scos2DS 1 Scos2DS 2 Scos2DS 1, DNA 14kb 16kb, X, kb cos SuperCos 1 Cosmid, Cosmid DNA Cosmid, ; DNA G + C, < 30, kb,, Cosmid,, Cosmid2 DNA ( Scos2DS1, 3, 4) DNA, PEG, Pst, N. clavi pe ( References) Arcidiacono, S., C. Mello, D. L. Kaplan, S. Cheley and H. Bayley 1998 Purification and characterization of recombinant spider silk ex2 pressed in Escherichia coli. A ppl. Microbiol. Biotechnol. 49 : Candelas, G. C. and J. Cintron 1981 A spider fibroin and its synthesis. J. Ex p. Biol. 221 : 1 6. Cunniff, P. M., S. A. Fossey, M. A. Auerbach, J. W. Song, D. L. Kaplan, W. W. Adams, R. K. Eby, D. Mahoney and D. L. Vezie 1995 Mechanical and thermal properties of dragline silk from the spider Nephila clavipes. Polym. A dv. Technol. 5 : Guerette, P. A., D. G. Ginzinger, B. H. F. Weber and J. M. Gosline 1996 Silk properties determined by gland2specific expression of a spi2 der fibroin gene family. Hinman, M. B and R. Jackson, C and J. Science 272 : V. Lewis 1992 Isolation of a clone encoding a second dragline silk fibroin. J. Biol. Chem. 267 : P. O Brien 1995 Molecular weight distribution of Nephila clavipes dragline silk. Macro. Molecuies. 28 : Kerkam, K., C. Viney, D. L. Kaplan and S. J. Lombardi 1991 Liquid crystallinity of natural silk secretions. N at ure 349 : Kaplan, D. L., W. W. Adams, B. Farmer and C. Viney 1994 Silk : biology, structure, properties and genetics. In : Kaplan, D., W. W. Adams, B. Farmer and C. Viney ed. Silk Polymers : Materials Science and Biotechnology. Washington, DC : American Chemical Society Symposium Series,. Lewis, R. V., M. Hinman, S. Kothakota and M. J. Fournier 1996 Expression and purification of a spider silk protein : a new strategy for
5 6 : DNA Cosmid 717 producing repetitive proteins. Protei n. Ex pr. Purif. 7 : Mello, C. M., K. Senecal, B. Yeung, P. Vouros and D. L. Kaplan 1994 Initial characterization of Nephila clavipes dragline protein. In : Silk Polymers, Materials Science and Biotechnology. Washington, DC : American Chemical Society Symposium Series, Prince, J. T., K. P. Mc Grath, C. M. Di Girolamo and D. L. Kaplan 1995 Construction, cloning and expression of synthetic genes encoding spider dragline silk. Biochemist ry 34 : Sambrook, J., F. F. Fritsch and T. Maniatis 1989 Molecular Cloning, A Laboratory Manual (2nd ed). New York : Cold Spring Harbor. Xu, M. and R. V. Lewis 1990 Structure of a protein superfiber : spider dragline silk. Proc. N atl. Acad. Sci. USA 87 : ( Abstract) CONSTRUCTION OF SPID ER GENOMIC D NA COSMID L IBRARY AND CLONING OF D RAGL INE SIL K GENE 3 L I Min ( College of Biological Engi neeri ng, Fujian Normal U niversity, Fuz hou , Chi na) David L. Kaplan ( Biotechnology Center, Tuf ts U niversity, Massachusetts 02155, USA ) The genomic DNA Cosmid library was const ructed f rom Nephila clavi pes spider muscle using SuperCos 1 Cosmid as a vector. The title of library was > cfu/ g ligated DNA. On the basis of published sequence from a partial cdna sequence of the 3 end of the dragline silk gene, we designed and synthesized 3 oligonu2 cleotides. Oligonucleotides were labeled wit h non2radioactive digoxigenin2du TP and detected wit h chemillumi2 nescent substrate. 56 positive recombinants were screen from the Cosmid library using DIG2Oligo 2 as a probe. DNA dot hybridization using DIG2Oligo 1 and DIG2Oligo 3 as the probes, respectively, 3 positive signals were i2 dentified from 56 colonies. st riction enzymes. They were appeared the same pattern when DNA from the colones digested by re2 The spider dragline silk gene was confirmed again by Sout hern blot hybridization. Key words Spider, Genomic library, Dragline, Silk gene 3 This work was supported by the Great Project of Natural Science Foundation of Fujian Province (No. 2001F006)