STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors

Transcription

1 Immunity, Volume 41 Supplemental Information STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors Liufu Deng, Hua Liang, Meng Xu, Xuanming Yang, Byron Burnette, Ainhoa Arina, Xiao- Dong Li, Helenna Mauceri, Michael Beckett, Thomas Darga, Xiaona Huang, Thomas F. Gajewski, Zhijian J. Chen, Yang-Xin Fu, and Ralph R. Weichselbaum

2 Supplemental Figures and Legends Tumor Volume (mm 3 ) WT-nonIR WT-IR Tmem173 -/- -nonir Tmem173 -/- -IR ** Times after tumor challenge (days) Figure S1, related to Figure 1. Tumor growth in WT and Tmem173 / mice after two doses of radiation. MC38 tumors in WT and Tmem173 / mice were treated locally with two dose of 15Gy IR on day 11 and 12 after tumor implantation. Representative data are shown from two experiments conducted with 7 to 9 mice per group. Data are represented as mean ± SEM. **P <.1 (Student s t test).

3 A CD11c + from Tumors Live/Dead 8.1 CD11c CD45 CD11b F4/8 Ly6C Ly6G B CD11c + from BM SSC-A 88.4 CD11c FSC-A CD11b F4/8 Ly6C Ly6G Figure S2, related to Figure 2. (A) The phenotype of CD11c + cells in tumors. Tumors were harvested on day 3 after radiation and the single cell suspensions were stained with indicated conjugated antibodies. (B) The phenotype of CD11c + cells in GM CSF stimulated bone marrow cells. Bone marrow cells were stimulated with 2ng/ml GM CSF for 7 days and then harvested for the staining with conjugated antibodies. Representative data are shown from three experiments.

4 A IFNγ + s pots pe r 2x 1 5 CD8 + T *** WT Tm em /- MC38-SIY CD11c + CD19 + B IFNγ + spots per 2x1 5 CD8 + T WT MC38-SIY *** *** nonir IR WT Tme m17 3 -/- CD 11 c + Splenic CD19 + Sple nic CD11 c + C IFN -γ (pg/ml) 2 WT DC s Tm e m1 73 -/- DC s 15 Irf3 -/ - DC s 1 5 D pg/ml IF N-β * ** B16-SIY no nir IR 1:8 1:4 1:2 1:1 DC : CD8 + T WT T mem173 -/ - CD11c + Figure S3, related to Figure 3. (A) CD11c + cells were isolated from GM CSF stimulated WT and Tmem173 / bone marrow cells, and CD19 + cells were isolated from the spleen of WT and Tmem173 / mice. After stimulation with 4Gy pretreated MC38 SIY cells, isolated CD11c + and CD19 + cells were cocultured with purified CD8 + T cells from naive 2C mice for three days and analyzed by ELISPOT assays. (B) CD11c + cells and CD19 + cells were isolated from the spleen of the naïve mice. The cross priming activity of splenic CD11c + cell was analyzed by ELISPOT assays as described in (A). (C) WT, Tmem173 / and Irf3 / BMDCs were co cultured with isolated CD8 + T cells from naive 2C mice at different ratios in the presence of 1 µg/ml SIY peptide for three days. The supernatants were harvested and subjected to IFN γ measurement by CBA assay. (D) 1x1 6 /ml CD11c + cells isolated from WT or Tmem173 / BMDCs were cocultured with 4Gy pretreated B16 SIY or non irradiated B16 SIY at a ratio of 1:1 for 16h. ELISA assays for IFNβ level were performed. Representative data are shown from two (A B and D) or three (C) experiments. Data are represented as mean ± SEM. *P<.5, **P <.1, ***P <.1 (Student s t test).

5 A IFNγ + spots per 2x1 5 CD8 + T *** *** *** WT Tmem173 -/- Mb21d1 -/- CD11c + A549-Ld-SIY nonir IR B IFN γ + spo ts per 2x1 5 CD8 + T ** ns MC38SIY: nonir IR IR DNase I: C IFNγ + spots per 2x1 5 CD8 + T 12 * ** Transwell: - + CD11c + MC38-SIY nonir IR D IFNγ + spots per 2x1 5 CD8 + T DMSO *** Latrunculin B E pg/ml IFN-β *** *** Trans well: Latrunculin B: Figure S4, related to Figure 4. (A) WT, Tmem173 / and Mb21d1 / BMDCs were co cultured with 4Gypretreted A549 Ld SIY cells or non irradiated A549 Ld SIY cells. Then isolated CD11c + cells were incubated with purified CD8 + T cell from naïve 2C mice at a ratio of 1:2 for three days. DC cross priming activity was analyzed by ELISPOT assays. (B D) BMDCs were cultured with 4Gy pretreated MC38 SIY. Subsequently purified CD11c + cells were co cultured with isolated CD8 + T cells from naive 2C mice for three days. DC cross priming activity was analyzed by ELISPOT assays. (B) 1µg/ml DNase I was added in the incubation of BMDC and irradiated MC38 SIY. (C) Irradiated MC38 SIY tumor cells were added into the insert and BMDCs were added into the well of Transwell 6 well Permeable plates with.4µm pore size. (D) Bone marrow cells were pretreated with 1µM Latrunculin B for 2 hours and then co cultured with irradiated tumor cells in the presence of 1µM Latrunculin B. (E) The level of IFN β in media of purified CD11c + cells as in (C) and (D) was analyzed in the presence or absence of transwell and Latrunculin B. Representative data are shown from two (A, D and E) or three (B C) experiments. Data are represented as mean ± SEM. *P <.5, **P <.1, ***P <.1 and ns No significant difference (Student s t test).

6 IFNγ + spots per 2x1 5 CD8 + T DLNs *** nonir IR WT Medium B16F1 MC38 Figure S5, related to Figure 5. The function of CD8 + T cells from MC38 tumor bearing mice in response to MC38 cells and B16F1 cells. DLNs were removed from MC38 bearing WT mice on eight days after radiation. Purified CD8 + T cells were stimulated with medium, IFN γ treated B16F1 or IFN γ treated MC38 for 48 hours. Representative data are shown from two experiments conducted with three mice per group. Data are represented as mean ± SEM. ***P <.1 (Student s t test).

7 IR Tumor Cells CD8 + T Cells DNA cgamp IFNAR1 Dendritic Cells Figure S6. Schematic of proposed mechanism: cgas STING pathway is activated and orchestrates tumor immunity after radiation. Radiation results in the up regulation of find me and eat me signals from tumor cells. During cell cell contact of tumor and dendritic cells, the DNA of irradiated tumor cells is delivered into cytoplasm of DC, acting as a danger signal. The cyclase cgas binds tumor DNA, becomes catalytically active, and generate cgamp as a second messenger. cgamp binds to STING, which in turn activates IRF3 to induce type I IFN production. Type I IFN signaling on dendritic cells promotes the crosspriming of CD8 + T cells, leading to tumor control. Exogenous cgamp treatment could optimize antitumor immune responses of radiation.

8 Supplemental Experimental Procedures Cell lines and Reagents MC38 is a murine colon adenocarcinoma cell line. B16F1 is a murine malignant melanoma cell line. MC38 SIY and B16 SIY were selected for a single clone after being transduced by lentivirus expressing human EGFR (L858R) SIY. A549 cells were transduced by lentivirus expressing Ld SIY. Anti mifnar1 neutralizing mab (clone MAR1 5A3) and anti CD8 depleting mab (clone 2.43) were purchased from BioXcell (West Lebanon, NH). Anti HMGB 1 neutralizing mab (clone 3B1) was produced in house. Anti HMGB 1 mab is capable of neutralizing HMGB 1 in vivo. Conjugated antibodies against CD11b, CD11c, Ly6C, Ly6G, F4/8 and CD45, and 7 AAD were purchased from BioLegend. 2 3 cgamp was purchased from InvivoGen. DMXAA was purchased from Selleck Chemicals. Murine IFN β, murine IFN γ and murine GM CSF was purchased from PEPROTECH. Live/dead fixable dead cell stain kit was purchased from Invitrogen. Latrunculin B was purchased from Calbiochem. Direct Priming Assay Bone marrow CD11c + cells were co cultured with purified CD8 + T cells from 2C mice in the presence of 1 µg/ml SIY peptide (SIYRYYGL) for three days. The supernatants were harvested for IFN γ detection. Flow Cytometric Sorting and Analysis To obtain single cell suspensions, tumor tissues were cut into small pieces and mechanical dissociated with the gentlemacs Dissociators (Miltenyi Biotech). Then tumor tissues were digested by 1mg/ml collagenase IV (Sigma) and.2 mg/ml DNase I (Sigma) for 3 min at 37 C. For the staining, single cell suspensions were blocked with anti FcR (clone 2.4G2, BioXcell) and then stained with antibodies against CD11c, CD11b, Ly6C, Ly6G, F4/8 and CD45, and 7 AAD. Cells were performed on FACSAria II Cell Sorter

9 (BD). For Mouse IFN γ Flex Set CBA assay, IFN γ detection in the supernatants was performed on FACSCalibur Flow Cytometer (BD). Data were analyzed with FlowJo Software (ThreeStar). Primer sequences for real time PCR Primer sequences for quantitative real time PCR were as follows: mifn β forward 5 GGTGGAATGAGACTATTGTTG 3, mifn β reverse 5 AAGTGGAGAGCAGTTGAG 3 ; m cgas forward 5 ACCGGACAAGCTAAAGAAGGTGCT 3, m cgas reverse 5 GCAGCAGGCGTTCCACAACTTTAT 3 ; 18S forward 5 CGTCTGCCCTATCAACTTTCG 3, 18S reverse 5 TGCCTTCCTTGGATGTGGTA 3. Statistical Analysis Experiments were repeated three times. Data were analyzed using Prism 5. Software (GraphPad) and presented as mean values ± SEM. The P values were assessed using two tailed unpaired Student t tests and p <.5 was considered significant. For tumor bearing mice frequency, statistics were done with the log rank (Mantel Cox) test.